ID: 1163390095

View in Genome Browser
Species Human (GRCh38)
Location 19:17025675-17025697
Sequence TAGTGGTTCTCAGCCCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 616
Summary {0: 1, 1: 0, 2: 6, 3: 125, 4: 484}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163390095_1163390105 27 Left 1163390095 19:17025675-17025697 CCCCCCAGGGCTGAGAACCACTA 0: 1
1: 0
2: 6
3: 125
4: 484
Right 1163390105 19:17025725-17025747 GCATTAGGATGAAAATTTGTAGG 0: 1
1: 0
2: 1
3: 13
4: 193
1163390095_1163390104 12 Left 1163390095 19:17025675-17025697 CCCCCCAGGGCTGAGAACCACTA 0: 1
1: 0
2: 6
3: 125
4: 484
Right 1163390104 19:17025710-17025732 CCAGCTTTGAAAGAAGCATTAGG 0: 1
1: 0
2: 1
3: 9
4: 214
1163390095_1163390106 28 Left 1163390095 19:17025675-17025697 CCCCCCAGGGCTGAGAACCACTA 0: 1
1: 0
2: 6
3: 125
4: 484
Right 1163390106 19:17025726-17025748 CATTAGGATGAAAATTTGTAGGG 0: 1
1: 0
2: 3
3: 32
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163390095 Original CRISPR TAGTGGTTCTCAGCCCTGGG GGG (reversed) Intronic
900153417 1:1191930-1191952 CAGCGGTTTTCCGCCCTGGGCGG + Intronic
900481289 1:2900657-2900679 CAGTGGTTCTCAGCTCGGGGTGG + Intergenic
900615212 1:3562674-3562696 TAGTGGCTCTCCGACCTGGGGGG - Intronic
900864376 1:5257368-5257390 TAGGAGCTGTCAGCCCTGGGAGG - Intergenic
901441110 1:9279000-9279022 GAGTGTTGCACAGCCCTGGGTGG + Intergenic
901529971 1:9846720-9846742 TGGTGTTTCCCAGCCTTGGGGGG - Intergenic
902128192 1:14235436-14235458 TAGTGGTTGTCAGCGGAGGGGGG + Intergenic
902390664 1:16103152-16103174 AAGTGGTTTTCTGCCCTGGGCGG + Intergenic
902391296 1:16108636-16108658 AAGCGGTTTTCTGCCCTGGGCGG + Intergenic
902904697 1:19547339-19547361 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
904324032 1:29715839-29715861 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
904324256 1:29717619-29717641 AAGTGGTTTTCCGCCCTGGATGG + Intergenic
905843224 1:41203665-41203687 AAGTGGTTTTCTGCCCTGGGTGG - Intronic
906008890 1:42504196-42504218 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
906009738 1:42512168-42512190 AAGTGGTTTTCCACCCTGGGTGG + Intronic
906043067 1:42804530-42804552 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
906774158 1:48513582-48513604 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
906774870 1:48520080-48520102 AAGTGGTTTTCCGCCTTGGGCGG + Intergenic
906791323 1:48660872-48660894 TAGTAGTTCCCATCCCTGAGTGG + Intronic
906840718 1:49135717-49135739 AAGTGGTTTTCCGCCCTGGGCGG + Intronic
908269602 1:62410267-62410289 TGCTGGCTCTCTGCCCTGGGTGG - Intergenic
908369776 1:63469946-63469968 AAGTGGTTTTCTGCCCTGGGCGG - Intronic
908581391 1:65520908-65520930 AAGTGGTTTTTGGCCCTGGGTGG + Intronic
908894986 1:68888401-68888423 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
910216721 1:84850973-84850995 TGGTGGCTCCCAGCACTGGGAGG + Intronic
911136929 1:94450456-94450478 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
911270174 1:95791509-95791531 TAGTGGTTCTTAACCCTGGCTGG + Intergenic
911600738 1:99845398-99845420 AAGCGGTTTTCCGCCCTGGGCGG + Intergenic
912810931 1:112793937-112793959 TAGTGCATCTCAGCCTTGGAGGG - Intergenic
912856488 1:113172989-113173011 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
912875936 1:113359384-113359406 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
912933812 1:113985936-113985958 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
913053972 1:115140596-115140618 TAGGGGTGTTCTGCCCTGGGTGG + Intergenic
915180347 1:154053572-154053594 AAGTGGTTTTCCGCCCTGGGTGG - Intronic
915401335 1:155624109-155624131 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
915810170 1:158900628-158900650 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
918116162 1:181499793-181499815 CAGTGGATCTCAGCCATGGCTGG - Intronic
919780106 1:201216112-201216134 TGGTGGTCCCCAGCCCTGAGTGG + Intronic
920428187 1:205895801-205895823 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
922681160 1:227597274-227597296 AAGTGGTTTTCTGCCCTGGGTGG + Intronic
922787355 1:228289594-228289616 GAGTGGATCTCAGCCATGGCTGG + Intronic
923071767 1:230572193-230572215 TATTGATTCTCAACCCTGGCTGG - Intergenic
923365965 1:233261769-233261791 TATTGGTTCTCTGCCCAGTGTGG + Intronic
923865464 1:237934584-237934606 GAGCGGTTTTCTGCCCTGGGTGG + Intergenic
923879870 1:238091897-238091919 CAGTGGTTCTCACCCAGGGGTGG - Intergenic
924516993 1:244774481-244774503 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
924765073 1:247024792-247024814 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
1062775656 10:144601-144623 TAGTGGTTCTCAGTTATGGCTGG + Intronic
1063327568 10:5120087-5120109 AAGTGGTTTTCTGCCCTGGGTGG - Intronic
1063789249 10:9423394-9423416 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
1064282046 10:13959816-13959838 TGTTGATACTCAGCCCTGGGGGG - Intronic
1066011807 10:31201506-31201528 CAGTGGTTCACAGCTATGGGAGG - Intergenic
1066541991 10:36457387-36457409 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
1066619305 10:37326895-37326917 AAGTGGTTTTCCGCCCTGGGTGG - Intronic
1066990254 10:42506406-42506428 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1067059581 10:43071049-43071071 TGATGGTTGTCAGGCCTGGGCGG - Intergenic
1067070976 10:43131870-43131892 TAGTGGTCCTCACAACTGGGGGG + Intergenic
1067133915 10:43591627-43591649 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
1067152793 10:43750437-43750459 TGGTGGTTGTCAGGGCTGGGAGG - Intergenic
1068075445 10:52248126-52248148 GAGTGGTTTTCCGCCCTGGGCGG + Intronic
1068166200 10:53335929-53335951 AAGTGGGTTTCCGCCCTGGGCGG + Intergenic
1068337372 10:55652684-55652706 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1069056227 10:63847584-63847606 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1069151497 10:64966273-64966295 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1069172138 10:65245521-65245543 AAGTGGTTTTCTGCCCTGGGCGG + Intergenic
1069491119 10:68861403-68861425 GAGTGGTTTTCCACCCTGGGTGG + Intronic
1069591611 10:69645449-69645471 CCTTGGTGCTCAGCCCTGGGCGG + Intergenic
1069841124 10:71340059-71340081 TCATGGTGCTCAGCCCTGGCTGG - Intronic
1071517773 10:86310417-86310439 TGGTGGTCCCCAGCCCTGTGTGG + Intronic
1073741629 10:106414487-106414509 GAGTGGTTCTCAGGCCAGTGAGG - Intergenic
1075014058 10:118897110-118897132 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1075071552 10:119323348-119323370 TACTGATTCTCAGACCTGGCAGG - Intronic
1075343439 10:121665041-121665063 TGGTGGATCACAGCCCTGGGTGG - Intergenic
1076416158 10:130290964-130290986 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1076416868 10:130297435-130297457 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1076485042 10:130810401-130810423 TCGTCATTCTCAGCCCAGGGGGG - Intergenic
1076608122 10:131702564-131702586 TGGTGGTTCCCAGCCCTGGCCGG - Intergenic
1076820725 10:132938142-132938164 TGCTGGGTCTCAGCCCTGAGGGG - Intronic
1077058162 11:605978-606000 TGGTGGCTCTCAGGCCGGGGTGG - Intronic
1077210069 11:1366710-1366732 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1077434739 11:2533401-2533423 AAGTGGCTCTCCTCCCTGGGAGG - Intronic
1078206530 11:9234658-9234680 AAGCGGTTTTCTGCCCTGGGTGG - Intronic
1078561184 11:12374366-12374388 AAGTGGTTTTCCACCCTGGGCGG - Intergenic
1079224972 11:18597040-18597062 TTTTGGATCTCAGCCCTGGAGGG + Intergenic
1081826166 11:46054563-46054585 TGCTGGTTCTCAGCCCTAGCTGG - Intronic
1082249850 11:49965906-49965928 AAGTGGTTTTCCACCCTGGGCGG - Intergenic
1082560826 11:54618804-54618826 AAGTGGTTTTCTGCCCTAGGCGG + Intergenic
1082914581 11:58418522-58418544 AAGTGGTTCTCCACCCTGGGCGG - Intergenic
1083066495 11:59929421-59929443 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
1083581822 11:63830002-63830024 GTGTGGTTCTCAGCACAGGGTGG + Intergenic
1083595044 11:63915153-63915175 GAGTGGGGCACAGCCCTGGGAGG - Intronic
1083764815 11:64836690-64836712 AGGTGGGACTCAGCCCTGGGGGG + Intronic
1084005353 11:66319789-66319811 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
1084790094 11:71469662-71469684 AAGTGGTTTTCCGCCCTGGGTGG + Intronic
1085337659 11:75708463-75708485 AAGCGGTTATCTGCCCTGGGTGG + Intergenic
1085355598 11:75833862-75833884 AAGTGGTTTTCCACCCTGGGTGG + Intronic
1086436136 11:86782724-86782746 TAGTGTTTCTCAGCCTTCAGGGG - Intergenic
1086728482 11:90219552-90219574 AAGTGTTTTTCCGCCCTGGGTGG - Intronic
1087371538 11:97291231-97291253 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1087628520 11:100623630-100623652 AAGTGGTTTTCCACCCTGGGCGG - Intergenic
1087930504 11:103972362-103972384 CAGTGGTTCTCAGCCAGGGGTGG - Intronic
1088491860 11:110396373-110396395 AAGTGGTTTTCCGCCCTGAGTGG - Intergenic
1089480210 11:118798503-118798525 AAGTGGTTCTCATTCCTGGCTGG - Intergenic
1089660135 11:119980356-119980378 TAGTATTGCTCAGCCCAGGGTGG + Intergenic
1090037220 11:123259489-123259511 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1090305454 11:125687436-125687458 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1091059179 11:132445558-132445580 TAGATGTTCTCATCCCTGGGGGG + Intronic
1091366015 11:135021362-135021384 CAATGGTTCTCAGCCTTGGATGG - Intergenic
1092309993 12:7342256-7342278 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
1092598132 12:10030127-10030149 AAGTGGTTTTCCACCCTGGGCGG - Intergenic
1092686247 12:11050411-11050433 AAGTGGTTTCCTGCCCTGGGTGG + Intronic
1093147326 12:15582163-15582185 AAGCGGTTTTCCGCCCTGGGAGG + Intronic
1095095581 12:38146544-38146566 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1095912556 12:47443674-47443696 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1096069308 12:48766157-48766179 TAGCTGTTCTGGGCCCTGGGTGG - Intergenic
1096125055 12:49113086-49113108 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1096307648 12:50492219-50492241 AAGCGGTTTTCTGCCCTGGGCGG + Intergenic
1096450885 12:51740096-51740118 AAGTGGTTTTCCACCCTGGGCGG + Intronic
1097492299 12:60285180-60285202 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1101400031 12:104379219-104379241 CAGAGGTTCTCAGCCTTGAGTGG + Intergenic
1101501582 12:105309077-105309099 AAGCGGTTTTCTGCCCTGGGCGG + Intronic
1101821994 12:108191500-108191522 TTGTGTTACTCAGCACTGGGTGG - Intronic
1102322240 12:111946540-111946562 AAGTGGTTTTCCACCCTGGGTGG + Intronic
1102608783 12:114092308-114092330 AAGTGGTTTTCTGCCTTGGGTGG - Intergenic
1102609561 12:114099546-114099568 AAGTGGCTCTCAGCCCTAAGGGG + Intergenic
1102667968 12:114592242-114592264 TAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1102877111 12:116457293-116457315 CAGTGGTTCTCAGCCAGGGGTGG - Intergenic
1102877269 12:116458260-116458282 CAGTGGTTCTCAGCCAGGGGTGG + Intergenic
1103143291 12:118571047-118571069 AAGAGGTTTTCTGCCCTGGGTGG - Intergenic
1104226147 12:126835878-126835900 AAGTGGTTTTCTGCTCTGGGTGG - Intergenic
1104250036 12:127084250-127084272 TAGTGGTTCCCAGGGTTGGGGGG + Intergenic
1104446307 12:128836352-128836374 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
1105282627 13:18977248-18977270 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1105703444 13:22951197-22951219 AAGTGGTTTTCCCCCCTGGGTGG - Intergenic
1105711187 13:23010678-23010700 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1105738514 13:23297602-23297624 AAGCGGTTTTCTGCCCTGGGTGG + Intronic
1106953964 13:34915149-34915171 CAGTGGTTCTCAACCCTGTGTGG + Intergenic
1107586765 13:41858039-41858061 TATTGGTTCTCAGCCCTTCAAGG + Intronic
1109143961 13:58753090-58753112 TAGTGTTTCTTAGCACTTGGTGG - Intergenic
1111173463 13:84560993-84561015 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1111387480 13:87545564-87545586 AAGTGGTTTTCTGCCCTGGGCGG - Intergenic
1111447929 13:88374164-88374186 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
1111812969 13:93115174-93115196 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
1114214083 14:20642624-20642646 TGGTGGTCCTCAGAACTGGGAGG - Intergenic
1114677700 14:24455230-24455252 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
1114784078 14:25573994-25574016 TAGTTGTTCTCAGACTTTGGTGG - Intergenic
1115744270 14:36419878-36419900 TAGTGATTCTCAGCCCTGGTAGG + Intergenic
1115959469 14:38819393-38819415 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1117083154 14:52172238-52172260 AAGTGGTTTTCTGGCCTGGGTGG - Intergenic
1118538293 14:66793018-66793040 AAGCGGTTTTCCGCCCTGGGCGG + Intronic
1118767841 14:68922103-68922125 TGGTGGTTCTCAGCCTTTTGGGG - Intronic
1120323427 14:82994732-82994754 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
1120421151 14:84287602-84287624 AAGTGGTTTTCCGCCCTGGGAGG - Intergenic
1120480747 14:85046502-85046524 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
1121498471 14:94414378-94414400 AAGTGGCTTTCCGCCCTGGGTGG - Intergenic
1121521213 14:94587388-94587410 TGGTGCTTCTCAGCCCTCAGGGG + Exonic
1121577013 14:94996655-94996677 GAGTCGTTCTCAGCCCTTAGAGG - Intergenic
1122133242 14:99618338-99618360 CAGTGTTCCTCAGGCCTGGGTGG - Intergenic
1122652690 14:103234152-103234174 GAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1122653285 14:103239127-103239149 GAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1123146922 14:106141716-106141738 TAGTGGTTCTGAGCCCCCTGGGG + Intergenic
1123161625 14:106284080-106284102 TAGTGGGTCCCAGGCCTGTGAGG + Intergenic
1123177812 14:106438303-106438325 AAGCGGTTTTCTGCCCTGGGGGG - Intergenic
1123214959 14:106799994-106800016 AAGTGGTTCCCAGGGCTGGGAGG + Intergenic
1123891366 15:24783439-24783461 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1124020828 15:25921457-25921479 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1126687629 15:51262101-51262123 AAGTGGTTTTCTGCCCTGGGTGG - Intronic
1126841916 15:52725614-52725636 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1127674241 15:61225663-61225685 TGGTGGTACACAGCCCTGTGTGG + Intronic
1128621738 15:69157063-69157085 TAGTGGTTCTGGCCCCTTGGTGG + Intergenic
1128835332 15:70804764-70804786 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1128869947 15:71147045-71147067 TACTGGTTCTAATCCCTGGCAGG - Intronic
1129072538 15:72963204-72963226 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1130009883 15:80142866-80142888 GAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1130999234 15:88925136-88925158 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
1131037621 15:89234050-89234072 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1131038290 15:89240130-89240152 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1131165546 15:90139732-90139754 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1132909586 16:2301965-2301987 AAGCGGTTTTCCGCCCTGGGCGG - Intronic
1133044201 16:3077174-3077196 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1133767712 16:8849390-8849412 GAGTGGCTCTCAGACCTGGAAGG - Intergenic
1133954034 16:10424163-10424185 AAGGGGTTTTCTGCCCTGGGTGG + Intronic
1134315523 16:13115505-13115527 AAGCGGTTTTCTGCCCTGGGCGG + Intronic
1134900812 16:17936221-17936243 CAGTGGTTCTCCACCCAGGGTGG + Intergenic
1135005617 16:18819377-18819399 TTCTGGCTCACAGCCCTGGGAGG - Intronic
1136692123 16:32039760-32039782 TAGTGGTTCTGAGCCCCCTGGGG - Intergenic
1136792666 16:32983198-32983220 TAGTGGTTCTGAGCCCCCTGGGG - Intergenic
1136877190 16:33870856-33870878 TAGTGGTTCTGAGCCCCCTGGGG + Intergenic
1137341979 16:47616984-47617006 AAGTAGTTTTCTGCCCTGGGTGG + Intronic
1138378065 16:56580559-56580581 CAGTGGTTCTCAGCAGTGGGTGG - Intergenic
1139302143 16:65954475-65954497 CAGTGGTTCTCAACCTTGGATGG + Intergenic
1139353689 16:66354043-66354065 TCTTGGTTCTCAGACCTGGCTGG - Intergenic
1140432063 16:74912917-74912939 AAGCGGTTTTCTGCCCTGGGTGG + Intronic
1141389228 16:83650526-83650548 TAGTGGTTCTCAACCCCAGAGGG + Intronic
1141936969 16:87246691-87246713 TCCTGGTACCCAGCCCTGGGAGG - Intronic
1142371419 16:89685043-89685065 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
1203094878 16_KI270728v1_random:1244677-1244699 TAGTGGTTCTGAGCCCCCTGGGG - Intergenic
1143136400 17:4714919-4714941 CACTGCTTCTCAGGCCTGGGAGG + Intronic
1144344060 17:14334055-14334077 TAAAGGTTCTCAGCCTTGGCCGG - Intronic
1144506793 17:15838409-15838431 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1145170975 17:20656344-20656366 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1145219978 17:21080383-21080405 GAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1146293891 17:31633256-31633278 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1146294453 17:31638677-31638699 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
1146675436 17:34770385-34770407 CAGTGGTTCTCAACCAAGGGTGG + Intergenic
1147667009 17:42155157-42155179 TTGTAGTTCGCAGCGCTGGGAGG + Intergenic
1148332272 17:46819820-46819842 AATTAGGTCTCAGCCCTGGGTGG + Intronic
1148382530 17:47210198-47210220 GAGAGGGTCTCAGCCCAGGGTGG - Intronic
1149493722 17:57103492-57103514 TAGTGGTTCCCAGCCTTGGCTGG + Intronic
1150002225 17:61448395-61448417 CAGTGGTTCTCAGCCTTGCCTGG + Intergenic
1151426114 17:74032167-74032189 TCCTGGGGCTCAGCCCTGGGAGG - Intergenic
1151789306 17:76294007-76294029 AAGTGTTTCTGAGCCCTGGTTGG + Exonic
1152207312 17:78981043-78981065 CAGTGGTTCTCAGCCTGGGCTGG + Intergenic
1152527031 17:80894206-80894228 CGGTGGTTCTCAGCCGGGGGTGG + Intronic
1152760667 17:82105620-82105642 TCCTGGAGCTCAGCCCTGGGGGG + Intronic
1152925846 17:83087435-83087457 TGGAGGTGCTCAGCCCAGGGAGG - Intronic
1155228087 18:23747568-23747590 TCCTGGTTCTTGGCCCTGGGAGG + Intronic
1156086546 18:33412396-33412418 TATGGGTTCACAGCCCTGGGGGG + Intronic
1156315943 18:35968704-35968726 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
1157616785 18:48991864-48991886 TGGCGGTTTTCAGCCCTGGAGGG + Intergenic
1157671273 18:49530847-49530869 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1157713957 18:49869716-49869738 CAGTGGTTCTCAGACTTGAGTGG + Intronic
1157802385 18:50631273-50631295 TAGTGTTCCTAAGCCCAGGGAGG + Intronic
1157901934 18:51526361-51526383 CACTATTTCTCAGCCCTGGGAGG + Intergenic
1158398290 18:57097021-57097043 CAGTGGGTCTCAGTCATGGGCGG - Intergenic
1158845950 18:61443145-61443167 AATTGTTGCTCAGCCCTGGGAGG - Intronic
1160802405 19:976475-976497 TTGTGGTTGTCACGCCTGGGGGG + Intergenic
1161913507 19:7212178-7212200 AAGTGGTTCTCACCCTAGGGTGG - Intronic
1161924319 19:7289818-7289840 TAGTGGTTGTCATGCCTGGGGGG + Intronic
1162642423 19:12022157-12022179 AAGTGGTTTTCTACCCTGGGTGG - Intronic
1162652256 19:12098665-12098687 AAGCGGTTTTCCGCCCTGGGCGG + Intronic
1162652861 19:12104116-12104138 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1163390095 19:17025675-17025697 TAGTGGTTCTCAGCCCTGGGGGG - Intronic
1163648513 19:18503739-18503761 TGGTGTTTCTGAGCCCTAGGCGG - Intronic
1164051607 19:21588725-21588747 AAGTGGTTTTCCACCCTGGGCGG - Intergenic
1164251187 19:23477191-23477213 AAGTGGTTTTCTGCCCTGGGCGG + Intergenic
1164261642 19:23572919-23572941 AAGTGGTTTTCTGCCCTGGATGG + Intronic
1164262137 19:23577142-23577164 AAGTGGTTTTCTGCCCTAGGTGG + Intronic
1164656537 19:29925972-29925994 TAGTGGTTACCAGGACTGGGGGG + Intronic
1164782542 19:30905090-30905112 TGGTGGTTCTCACCCAGGGGAGG + Intergenic
1165672631 19:37692424-37692446 GCGAGGTGCTCAGCCCTGGGAGG + Intronic
1165866317 19:38941662-38941684 AAGCGGTTTTCCGCCCTGGGTGG + Exonic
1166348145 19:42179474-42179496 AAGTGGTACCCAGACCTGGGAGG + Intronic
1166658845 19:44631822-44631844 AAGTGGTTTTCCGCCCTGGGTGG + Intronic
1167143008 19:47665110-47665132 TGGTGGTTCTCAGCCAGGGAGGG - Intronic
1167477002 19:49706867-49706889 TAGAGATTCTCAGGCCTGGCAGG + Intronic
925047789 2:787797-787819 CAGTGGTTCTCATTCCTGGTGGG - Intergenic
926802815 2:16675039-16675061 TCGTAGTCTTCAGCCCTGGGTGG + Intergenic
927178009 2:20423918-20423940 TAGTGTCTCACAGCCATGGGTGG + Intergenic
928329053 2:30343484-30343506 AAGCGGTTTTCCGCCCTGGGCGG + Intergenic
928402485 2:30989090-30989112 CAGTGGTTCTTAACCCTGGCTGG + Intronic
928702590 2:33914369-33914391 AAGTGGTTTTCTGCCCTGGGCGG + Intergenic
928703148 2:33919349-33919371 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
929537360 2:42792166-42792188 AATTGTTTCTCAGCCCTGGAAGG + Intronic
930183757 2:48390296-48390318 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
930316543 2:49803024-49803046 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
930955844 2:57202132-57202154 CAGTGCTTTTCAACCCTGGGAGG + Intergenic
930993529 2:57687915-57687937 AAGTGGTTTTCTGTCCTGGGAGG - Intergenic
931287086 2:60841261-60841283 CAGTGTTTCTCAACCCTGGCTGG - Intergenic
932731526 2:74225303-74225325 TAGTGGTTCTCAGCCAGGCGTGG + Intronic
933011407 2:77068885-77068907 AAGCGGTTTTCACCCCTGGGAGG - Intronic
933596278 2:84286643-84286665 TAGTGTTTCTAAGCACTAGGAGG - Intergenic
933766669 2:85713978-85714000 TGGTGGTTCTCAACCTTGGCTGG + Intergenic
935915852 2:107948488-107948510 AAGTGGTTTTCCGCTCTGGGTGG + Intergenic
936369418 2:111891180-111891202 AAGTAGTTTTCTGCCCTGGGTGG - Intergenic
936771164 2:115915086-115915108 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
936799579 2:116251507-116251529 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
936800063 2:116255786-116255808 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
937170986 2:119868607-119868629 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
940887808 2:159005096-159005118 AAGTGGTTTTCTGCCCTGGGTGG + Intronic
941249631 2:163146364-163146386 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
942611919 2:177751040-177751062 CAGTGGCTCTCAGCTCTGGCTGG - Intronic
943476278 2:188360408-188360430 TAGTAGTTTTCAGCCATTGGAGG - Intronic
944934132 2:204549622-204549644 TAGTGATTCTCAACCTTGGCTGG - Intronic
945790921 2:214304356-214304378 AAGTGGTTTTCTGCCCTGGGCGG - Intronic
946206467 2:218112410-218112432 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
946206958 2:218116648-218116670 AAATGGTTTTCCGCCCTGGGTGG - Intergenic
946210677 2:218144720-218144742 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
946439117 2:219680093-219680115 CAGTGGTTCTCAGTCAGGGGTGG - Intergenic
947640983 2:231707867-231707889 TAGGGGTGCCCTGCCCTGGGAGG + Intronic
948041637 2:234905958-234905980 AGGTGGGTCTCAGTCCTGGGAGG - Intergenic
948074000 2:235150938-235150960 TACTGGTTCCCAAGCCTGGGAGG - Intergenic
948242983 2:236453980-236454002 GAGTGATTCTCTGCCCTGGATGG + Intronic
1168936699 20:1671852-1671874 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
1169404021 20:5308340-5308362 AAGCGGTTTTCTGCCCTGGGCGG - Intronic
1169784912 20:9349305-9349327 GAGTGGTTATCAGCGCTGTGGGG - Intronic
1170641329 20:18156213-18156235 TGGTGGTTGTCAGCACTTGGCGG + Intronic
1170740788 20:19054299-19054321 CAGTGGTTCTCAACCTTGAGTGG - Intergenic
1171228979 20:23467079-23467101 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
1172132291 20:32663941-32663963 TTCTGATTCTCAGCCCTGAGTGG - Intergenic
1172947591 20:38701196-38701218 AAGTTCTTCTCAGGCCTGGGTGG + Intergenic
1173362749 20:42359441-42359463 CAGTGGTTTTCAGCCTTAGGAGG - Intronic
1173792607 20:45837602-45837624 TTCAGGTTCTCAGACCTGGGAGG + Intronic
1174275090 20:49397858-49397880 TAGAGGGTCTCAGCTCTGGGTGG - Intronic
1174415661 20:50364934-50364956 TAGTAGTTCTCAACCAAGGGTGG + Intergenic
1174480123 20:50825394-50825416 TTATGGTTCCCAGCCCAGGGTGG + Intronic
1175732978 20:61366706-61366728 AAGTGGTTTTCCGCCCTGGGTGG + Intronic
1177316634 21:19470801-19470823 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1177519175 21:22195145-22195167 AAGTGGTTTTCCACCCTGGGCGG + Intergenic
1177683837 21:24410910-24410932 AGGTGGTTTTCCGCCCTGGGTGG + Intergenic
1178107869 21:29340530-29340552 TAGTGGTTCTAATTTCTGGGAGG + Intronic
1178371991 21:32034000-32034022 CAATGGTTCTCAACCATGGGTGG - Intronic
1179134913 21:38670797-38670819 GAGTTGTGCTCAGTCCTGGGTGG - Intergenic
1179720437 21:43313398-43313420 CAGTGGTTCTCAACCAGGGGTGG + Intergenic
1179957081 21:44747323-44747345 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1180155900 21:45977349-45977371 CAGTCGTCCACAGCCCTGGGGGG - Intergenic
1181035894 22:20169592-20169614 TAGTGGCCCACAGCCCTGGGGGG + Intergenic
1181172876 22:21019915-21019937 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1181629186 22:24141600-24141622 CTGTGGTTCTGAGTCCTGGGAGG - Intronic
1182631786 22:31691584-31691606 TAGTGGTTACCAGTGCTGGGTGG - Intronic
1182913432 22:34006569-34006591 AAGTGGTTTTCCGCTCTGGGCGG + Intergenic
1183062874 22:35346528-35346550 GGGTGGTCCTCACCCCTGGGGGG - Intronic
1183067046 22:35370417-35370439 AAGGGGTTCTCTGCCCTGGCTGG + Intergenic
1183584687 22:38746120-38746142 TGGTGGTTCTCAGCCCTGTCTGG + Intronic
1184354699 22:43971283-43971305 CAGGGGTGCTCAGCCCTGGCTGG - Intronic
949316255 3:2758998-2759020 TAGTGGTTATCAGGTCTGGAAGG - Intronic
949675620 3:6449735-6449757 TAGTGGTTCTCAGCCAGGCGTGG + Intergenic
950575078 3:13827483-13827505 GTGGGGTTCTCAGGCCTGGGAGG + Intronic
950590353 3:13932431-13932453 CAGTGGTTCTCAAACCTGGAGGG + Intergenic
950755934 3:15172555-15172577 CAGTGGTTCTCAGCCAAGAGTGG + Intergenic
952930752 3:38359293-38359315 GAGTGGTTTTCCGCCCTGGATGG + Intronic
952964228 3:38611105-38611127 GAGTGCCTCTGAGCCCTGGGTGG - Intronic
953723432 3:45376662-45376684 AAGGGGTTTTCCGCCCTGGGTGG + Intergenic
953942239 3:47110243-47110265 TAGTGGCTGCCAGGCCTGGGAGG + Intronic
954233084 3:49233842-49233864 AAGTGGTTTTCCGCCCTCGGTGG - Intronic
954769290 3:52951760-52951782 AAGCGGTTTTCTGCCCTGGGCGG + Intronic
954872912 3:53781270-53781292 TAGTAGGTCTCAGCTGTGGGAGG + Intronic
955009060 3:54996719-54996741 GACTGGTACTAAGCCCTGGGAGG + Intronic
957600026 3:82321772-82321794 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
957675724 3:83361585-83361607 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
958738881 3:98043748-98043770 AAGTGGTTTTCCGCCCTGAGCGG + Intergenic
959276330 3:104281759-104281781 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
959323884 3:104911440-104911462 TAGTGGTTCTTAGCTGTGGCAGG - Intergenic
960015746 3:112885638-112885660 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
960190471 3:114698563-114698585 TGGTTGTTCTCAGCCATAGGAGG - Intronic
961204002 3:125066471-125066493 CGGTGATTCTCAGCCCTGGCTGG + Intergenic
961265380 3:125637536-125637558 ACGTGGTTTTCCGCCCTGGGCGG + Intergenic
961690029 3:128662745-128662767 AAGCGGTTTTCTGCCCTGGGCGG + Intronic
961859232 3:129901390-129901412 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
962022466 3:131514443-131514465 AAGTGGTTATCCGCCCTGGGCGG - Intergenic
962920321 3:139944433-139944455 GAGTGGTTCTCAGTCTTGGCTGG - Intronic
964275393 3:155004060-155004082 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
965920575 3:173908233-173908255 TAGTGGTTCTTAGCCCAGAATGG + Intronic
966008936 3:175052222-175052244 CAGTGGTTTTCCGCCCTGAGTGG + Intronic
966296042 3:178424554-178424576 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
966816387 3:183893278-183893300 CTGGGGTTCTCGGCCCTGGGAGG - Intergenic
966968498 3:185019633-185019655 AAGTGGTTTTCCACCCTGGGTGG + Intronic
966978812 3:185110692-185110714 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
967227505 3:187306028-187306050 TAGTGTGTCTCAACCCTGGTTGG + Intergenic
968127610 3:196171365-196171387 AAGTGGTTGTCAGGGCTGGGAGG + Intergenic
969500694 4:7550907-7550929 AGCTGGTTCACAGCCCTGGGAGG - Intronic
969608035 4:8212002-8212024 TCGTGGTTCTGAGCCTTGGCGGG - Intronic
970391924 4:15620785-15620807 AAGTGGTTTTCCGCCCTGGGCGG - Intronic
970422279 4:15916558-15916580 AAGTGGTTTTCCGCCCTGGGCGG + Intergenic
971298348 4:25421605-25421627 TAATGGTTCTCAACCTTGGTGGG - Intergenic
971298663 4:25424139-25424161 TAGTGCTCCTCACACCTGGGAGG + Intergenic
971871486 4:32245748-32245770 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
971917536 4:32892770-32892792 AAGCAGTTTTCAGCCCTGGGTGG - Intergenic
971976752 4:33699608-33699630 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
972253891 4:37333143-37333165 AAGTTGTCCTCAGCCCTGGCAGG - Intronic
972460650 4:39299066-39299088 AAGCGGTTTTCTGCCCTGGGCGG - Intronic
972655470 4:41059544-41059566 AAGCGGTTTTCCGCCCTGGGCGG - Intronic
973009028 4:45048666-45048688 AAGAGGTTTTCCGCCCTGGGTGG - Intergenic
973195042 4:47429951-47429973 TGGTGGTCCTCAGCTTTGGGTGG + Intergenic
973621510 4:52731088-52731110 TAGTGATTCCCAGGGCTGGGGGG - Intronic
974109607 4:57511242-57511264 TGGTTGTTCTCTGCCTTGGGTGG + Intergenic
974376849 4:61089111-61089133 TAGAGTTTCTCAGACCTTGGTGG - Intergenic
974535071 4:63164148-63164170 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
974566128 4:63579952-63579974 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
974635755 4:64562786-64562808 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
974767069 4:66360602-66360624 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
975092995 4:70425123-70425145 AAGTGGTTTTCTGCCTTGGGCGG - Intergenic
975225204 4:71863688-71863710 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
975412456 4:74069885-74069907 AAGTGGTTGTCTGCCCTGGGTGG + Intergenic
975580058 4:75898155-75898177 AAGCGGTTTTCTGCCCTGGGCGG + Intronic
975681050 4:76876438-76876460 TAATAGTTTTCAGCCCGGGGCGG - Intergenic
976556886 4:86460675-86460697 AAGTGGTTTTCTGCCTTGGGTGG - Intronic
976977330 4:91181018-91181040 AAGTGGTTTTCCGCCCTGGGAGG + Intronic
977642519 4:99372774-99372796 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
977851906 4:101840522-101840544 AAGTGGTTTTCCGCCCTGAGTGG - Intronic
979591861 4:122490366-122490388 TGGTAGTCTTCAGCCCTGGGAGG + Intergenic
979893505 4:126130890-126130912 AAGTGGTTTTCAGCCCTGGGTGG - Intergenic
979893976 4:126134776-126134798 TAGTGGTTTTCCGCCCTGGATGG - Intergenic
980450180 4:132959478-132959500 AAGTGGTTTTCGACCCTGGGCGG - Intergenic
980667759 4:135960850-135960872 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
980762651 4:137255925-137255947 AAGTGGCTTTCTGCCCTGGGTGG + Intergenic
981197822 4:141941446-141941468 AAGCAGTTTTCAGCCCTGGGTGG + Intergenic
981843173 4:149135903-149135925 TAGTGCTTGGCTGCCCTGGGAGG - Intergenic
982211127 4:153037359-153037381 TAGTGGTTATTACCTCTGGGAGG - Intergenic
982281580 4:153688702-153688724 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
982519324 4:156393289-156393311 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
982882380 4:160735461-160735483 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
983089359 4:163485912-163485934 TAGTGCTTCACAACACTGGGAGG - Intergenic
983972589 4:173893101-173893123 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
984110732 4:175610284-175610306 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
984148205 4:176090973-176090995 AAGTGGTTTTCCACCCTGGGTGG + Intronic
984964018 4:185125731-185125753 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
985050024 4:185980663-185980685 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
985374712 4:189322868-189322890 TAGTGCCTATCACCCCTGGGAGG + Intergenic
985952066 5:3229872-3229894 TGGTGGTTCTCCGACCTGAGGGG - Intergenic
986313063 5:6568867-6568889 TAGTGGTTCTCCACCCTGGCTGG - Intergenic
986467235 5:8037867-8037889 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
987573977 5:19702863-19702885 AAGTGGTTTTCTGCCCTGGGTGG - Intronic
987995764 5:25276412-25276434 TAGTGCTTTTCAGCTCTGGGAGG - Intergenic
988344084 5:30014361-30014383 AAGCGGTTTTCCGCCCTGGGCGG + Intergenic
988443259 5:31256423-31256445 AAGTGGTTCTTATCTCTGGGTGG - Intronic
989332312 5:40274498-40274520 TAGTCGTTTTCAGACCTGGGAGG - Intergenic
989345549 5:40425415-40425437 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
989480944 5:41929359-41929381 TAAAGGTTCTCAACCCTAGGAGG - Intronic
989742399 5:44788732-44788754 AAGTGGTTTTCTGTCCTGGGTGG - Intergenic
990306482 5:54498555-54498577 AAGTTGTTTTCCGCCCTGGGTGG + Intergenic
990307215 5:54505253-54505275 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
990856695 5:60275222-60275244 CAGTGGTTCTCAACCTTGGCTGG - Intronic
990886423 5:60599654-60599676 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
992250320 5:74869575-74869597 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
992254542 5:74908485-74908507 AAGTGGTTTTCCGCTCTGGGTGG + Intergenic
992430989 5:76711623-76711645 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
992633310 5:78702423-78702445 TAGTGTTTCTAAGTCCTAGGGGG - Intronic
993222073 5:85111572-85111594 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
993405767 5:87510485-87510507 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
993913627 5:93713947-93713969 TAGTGATCCTCAGCCCTCAGGGG + Intronic
994305907 5:98203873-98203895 AAGCGGTTTTCCGCCCTGGGCGG - Intergenic
995008612 5:107232045-107232067 TAGTGGTTGTCAGGTATGGGGGG + Intergenic
995108478 5:108401453-108401475 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
995665699 5:114539577-114539599 AAGTGGTTTTCTGCCCTGGGCGG - Intergenic
996175513 5:120351200-120351222 AAGTGGTTTTCTGCCCTGGATGG - Intergenic
996230886 5:121061854-121061876 TTGTGATTCTCATGCCTGGGAGG + Intergenic
996270416 5:121597479-121597501 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
996934465 5:128932513-128932535 AAGTGGTTTTCTGCCCTGGGTGG + Intronic
997393420 5:133535392-133535414 AAGCGGTTTTCCGCCCTGGGCGG - Intronic
998073587 5:139218280-139218302 AAGTGGTTTTCTGTCCTGGGTGG + Intronic
999505342 5:152188916-152188938 CAGTAATTCTCAGCCCTGCGAGG - Intergenic
1001212793 5:169826403-169826425 TGGTGGCTCTCATCTCTGGGGGG + Intronic
1002406827 5:179040749-179040771 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
1002715766 5:181226020-181226042 TAGGGTTTCTCAGCTCTGAGTGG + Intronic
1002964621 6:1951074-1951096 TAGTGGTTCTCAACTAGGGGTGG - Intronic
1003196155 6:3916869-3916891 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1003355670 6:5367487-5367509 GAGTGGTTCACAGCCCTTTGCGG + Intronic
1003364390 6:5458366-5458388 CAGTGCTCCTCAGCCCTGGCAGG - Intronic
1003433955 6:6068422-6068444 AAGCGGTTATCTGCCCTGGGTGG + Intergenic
1003761609 6:9184842-9184864 AAGTGGTTTTCTGCCCTGAGTGG - Intergenic
1004197196 6:13515730-13515752 CCGTGGTTCTCAGCCACGGGGGG - Intergenic
1004199229 6:13532541-13532563 AAGTGGGAATCAGCCCTGGGAGG - Intergenic
1004482874 6:16037773-16037795 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1004778817 6:18882017-18882039 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1005780563 6:29187195-29187217 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1005865922 6:29936500-29936522 AAGTGGTTTTCCACCCTGGGCGG + Intergenic
1005999631 6:30955237-30955259 GAGTGTCTCTCTGCCCTGGGAGG + Intergenic
1006497061 6:34431469-34431491 AAGCGGTTTTCTGCCCTGGGCGG + Intergenic
1006674765 6:35754554-35754576 GTCTGGATCTCAGCCCTGGGTGG - Intergenic
1007219808 6:40269472-40269494 TAGTGGTTCTCAGCCAGGTTTGG - Intergenic
1007266481 6:40600077-40600099 CAGTGGTTCTCAGACCAGCGTGG + Intergenic
1007826556 6:44605349-44605371 CAGTGGTTCTCAACCATGGCTGG + Intergenic
1007887022 6:45241349-45241371 AAGTGGTTTTCTGCCCTGGGTGG - Intronic
1008093198 6:47313019-47313041 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1008093635 6:47316600-47316622 AAGCGGTTTTCCGCCCTGGGCGG + Intergenic
1008190679 6:48453288-48453310 AAGTGGTTTTCGGCCCTGGGTGG + Intergenic
1008587650 6:52963719-52963741 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1009640700 6:66331602-66331624 AAGAGGTTTTCCGCCCTGGGCGG + Intergenic
1010796028 6:80117618-80117640 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
1010872820 6:81063160-81063182 AAGTGGTTTTCCGCCCTGGGAGG - Intergenic
1011495750 6:87935491-87935513 CTGTGGTTCTCAACCCTGGCTGG - Intergenic
1012048641 6:94310767-94310789 TAGTGGTCCTCAGACCTTGGTGG + Intergenic
1012342672 6:98147169-98147191 TAGTGGTTACCAGGCGTGGGGGG + Intergenic
1013255902 6:108385343-108385365 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
1013475052 6:110499327-110499349 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1013592251 6:111629110-111629132 GTCTGGATCTCAGCCCTGGGGGG - Intergenic
1014719628 6:124900485-124900507 AAGCGGTTTTCCGCCCTGGGCGG + Intergenic
1015581492 6:134730181-134730203 TGGTGCCTATCAGCCCTGGGGGG - Intergenic
1015839050 6:137456624-137456646 AAGTGGTTTTCCGCCCTGGGCGG - Intergenic
1016346688 6:143120917-143120939 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
1016849435 6:148601840-148601862 TAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1017373306 6:153737867-153737889 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1017835818 6:158176958-158176980 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1018085952 6:160301210-160301232 TAATGGTTTTCTGCCCTGGTGGG - Intergenic
1018594504 6:165463820-165463842 AAGTGGTTTTCCGCCCTGGGCGG - Intronic
1018713964 6:166517414-166517436 AAGTGGTTTTCCGCCCTGGGTGG - Intronic
1018949162 6:168367577-168367599 CAGAGGCTCTCAGCCCTGGCAGG - Intergenic
1019155725 6:170037679-170037701 TGCTGGTTCTGGGCCCTGGGAGG - Intergenic
1019233934 6:170593415-170593437 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1020845669 7:13278852-13278874 TAGTGGTGGTCAGCACTTGGGGG - Intergenic
1022390375 7:29938570-29938592 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
1022537257 7:31105981-31106003 TAATGGTTCTCAACCCTGACTGG + Intronic
1023100387 7:36711877-36711899 TCATGGTTCTCAGCCTTTGGAGG - Intronic
1023145413 7:37146163-37146185 AAGTGGTTCTCAACCTTGGAAGG - Intronic
1023358298 7:39389914-39389936 AAGTGGTTCTCAGCAGTAGGTGG - Intronic
1023804232 7:43860020-43860042 AAGTGGTTTTCTGTCCTGGGTGG + Intergenic
1024101664 7:46038523-46038545 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1024102350 7:46044976-46044998 AAGTGGTTTTCTGCCCTGGGCGG + Intergenic
1024138380 7:46433985-46434007 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1024495698 7:50043048-50043070 AAGCGGTTTTCTGCCCTGGGTGG - Intronic
1025803197 7:64807011-64807033 AAGTGGTTTTCCACCCTGGGTGG - Intronic
1025816307 7:64915592-64915614 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1026005110 7:66594169-66594191 TTCTGGTTTTCCGCCCTGGGTGG - Intergenic
1026014582 7:66663045-66663067 AAGCGGTTTTCCGCCCTGGGCGG - Intronic
1026268096 7:68812999-68813021 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
1026328339 7:69330463-69330485 AAGTGGTTTTCTGCCCTGGGCGG - Intergenic
1026388229 7:69873326-69873348 TGGTGGTTCTCAGCCCTTATTGG + Intronic
1027344721 7:77246119-77246141 AGGTGGTTCTCAGCCCTGACTGG + Intronic
1028780421 7:94729135-94729157 GAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1029024979 7:97406915-97406937 CAGTGGTTCTCAGACTTGAGTGG - Intergenic
1030277578 7:107736997-107737019 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1030292322 7:107885069-107885091 AAGTGGTTTTCCGCCCTGGGCGG + Intergenic
1031308799 7:120167727-120167749 AAGCGGTTTTCCGCCCTGGGAGG - Intergenic
1031795758 7:126172836-126172858 GAGTGGTTTTCCGCCCTGGGTGG - Intergenic
1032442181 7:131950290-131950312 TATTGGTTCTCTGCCTTGGGAGG + Intergenic
1032723914 7:134573778-134573800 TAGTGGTTCTCAACGTTGGCTGG + Intronic
1032725713 7:134588553-134588575 ACGTGGTTTTCTGCCCTGGGCGG + Intergenic
1033142573 7:138840656-138840678 TAGGGCTGCACAGCCCTGGGTGG - Intronic
1034012339 7:147543301-147543323 AAGCGGTTTTCTGCCCTGGGCGG + Intronic
1034403891 7:150888447-150888469 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1034942975 7:155244011-155244033 AAGTGGTTTTCCACCCTGGGCGG + Intergenic
1035283787 7:157793805-157793827 TACTGCTTCTAAGCCATGGGAGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1036307128 8:7610842-7610864 AAGTGGGGCTCAGCGCTGGGTGG - Intergenic
1036308185 8:7616970-7616992 AAGTGGGGCTCAGCGCTGGGTGG - Intergenic
1036310491 8:7681134-7681156 CAGTGGGGCTCAGCTCTGGGTGG + Intergenic
1036311540 8:7687252-7687274 CAGTGGGGCTCAGCTCTGGGTGG + Intergenic
1036357973 8:8058829-8058851 AAGTGGGGCTCAGCGCTGGGTGG - Intergenic
1036359041 8:8064971-8064993 CAGTGGGGCTCAGCGCTGGGTGG - Intergenic
1036830384 8:12015656-12015678 CAGTGGGGCTCAGCGCTGGGTGG + Intergenic
1036891917 8:12601981-12602003 CAGTGGGGCTCAGCGCTGGGTGG + Intergenic
1036892976 8:12608117-12608139 AAGTGGGGCTCAGCGCTGGGTGG + Intergenic
1036899464 8:12659956-12659978 CAGTGGGGCTCAGCGCTGGGTGG + Intergenic
1037963929 8:23118852-23118874 TGTTGGGTCTCAGCACTGGGTGG + Intergenic
1039036673 8:33367260-33367282 AAGCGGTTTTCTGCCCTGGGCGG - Intergenic
1039692177 8:39875646-39875668 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1040645388 8:49391012-49391034 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1040782439 8:51125782-51125804 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1040988808 8:53326866-53326888 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1041356243 8:57003641-57003663 AAGTGGTTTTCCACCCTGGGTGG - Intergenic
1041493481 8:58460861-58460883 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1041786887 8:61644844-61644866 TGGTGGTTGTCAGCCTTGTGGGG - Intronic
1042599098 8:70480328-70480350 TAGTGGGCCTCACTCCTGGGAGG + Intergenic
1042607972 8:70565558-70565580 TAGTGGTTCTCAGGCCAATGGGG - Intergenic
1043024568 8:75049750-75049772 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1044016283 8:87051713-87051735 AAGTGGTTTTCCACCCTGGGTGG + Intronic
1044586665 8:93875001-93875023 AAGTGGTTTTCTGCCCTGGGCGG + Intronic
1045174323 8:99705047-99705069 TAGTGGTACTCAGTCCTGGGAGG - Intronic
1046001068 8:108421445-108421467 AAGCGGTTTTCTGCCCTGGGTGG + Intronic
1046479496 8:114797188-114797210 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1046641725 8:116739115-116739137 AAGCGGTTTTCTGCCCTGGGTGG - Intronic
1048368888 8:133759746-133759768 GAGTTGTCCTCAGCCCTGGCTGG - Intergenic
1049460579 8:142725857-142725879 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1049857381 8:144871205-144871227 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1049911712 9:275425-275447 TAAGGGTTCTCAGCCCTGACTGG + Intronic
1050129229 9:2392889-2392911 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1050791598 9:9477958-9477980 CAGTGGTTATCAATCCTGGGTGG - Intronic
1052606446 9:30708381-30708403 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1053539594 9:38959610-38959632 AAGTGGTTTTCTGCCCTGGGCGG + Intergenic
1054626547 9:67404308-67404330 AAGTGGTTTTCTGCCCTGGGCGG - Intergenic
1054871590 9:70051960-70051982 GAATGGTTCTCAGCCCTGGCTGG + Intronic
1055318324 9:75056212-75056234 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1055408366 9:75999613-75999635 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1056383181 9:86074144-86074166 TGGTGATTCTCAGCCATGGGAGG - Intronic
1056540775 9:87569084-87569106 CAGTGGTTCTCAGCCTTGGCTGG + Intronic
1057168462 9:92946536-92946558 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1057625158 9:96670040-96670062 AAGCGGTTTTCTGCCCTGGGTGG - Intergenic
1057627824 9:96693380-96693402 AAGCGGTTTTCTGCCCTGGGCGG + Intergenic
1057634164 9:96747398-96747420 TAGTGGTTGTAAGAACTGGGGGG - Intergenic
1058226235 9:102368031-102368053 AAGTGGTTTTCTGCCCAGGGTGG - Intergenic
1058335619 9:103824778-103824800 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1058911991 9:109529397-109529419 CAGTGGTTCTCAGACTTGAGTGG - Intergenic
1061602493 9:131680527-131680549 TAGTGGTTTTCTGCCCTGGGTGG - Intronic
1061698117 9:132393390-132393412 AAGCGGTTTTCCGCCCTGGGTGG - Intronic
1185932754 X:4221257-4221279 TAGTGGTTGTCAGGGCTGGAGGG - Intergenic
1186095765 X:6100195-6100217 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1187046273 X:15650179-15650201 CAGTGGTTCTCAACACTTGGTGG - Intronic
1187479052 X:19638444-19638466 CAGTGGTTCTCAGGCTTGAGTGG + Intronic
1187700740 X:21962518-21962540 TAGTGGTTCTCAACTGTGGCTGG + Intronic
1188038172 X:25341446-25341468 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1188481350 X:30639932-30639954 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1188673216 X:32905920-32905942 CAGTGATTCTCAACTCTGGGTGG - Intronic
1188894118 X:35645514-35645536 AAGCGGTTTTCTGCCCTGGGCGG + Intergenic
1189670319 X:43401203-43401225 AAGTGGTTTTGTGCCCTGGGTGG - Intergenic
1190165037 X:48066511-48066533 CAGTGGTTTTCAGTCCAGGGTGG - Intronic
1190383392 X:49861335-49861357 TAGTGGAGCTCAGCTGTGGGTGG + Intergenic
1190852807 X:54263125-54263147 TAGTGGTTCTCAGCCCCAGAAGG + Intronic
1191703319 X:64066091-64066113 AAGCGGTTTTCCGCCCTGGGTGG + Intergenic
1191833351 X:65438765-65438787 AAGCGGTTTTCCGCCCTGGGCGG + Intronic
1191919429 X:66238987-66239009 AAGTGGTTTTCTGCCCTGGGTGG + Intronic
1191949119 X:66569470-66569492 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1192687789 X:73324962-73324984 AAGTGGTTTTCCACCCTGGGCGG + Intergenic
1192884572 X:75323346-75323368 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1192885208 X:75329511-75329533 AAGTGGTTTTCCGCCCTGGGTGG - Intergenic
1193313962 X:80042779-80042801 AAGTGGTTTTCAGCCCTGGGTGG - Intergenic
1193360902 X:80577161-80577183 TAGGTGTGCTCAGCTCTGGGTGG + Intergenic
1193396373 X:80988592-80988614 AAGTGGTTTTCCGCCCTGGGTGG + Intergenic
1193787275 X:85774604-85774626 AAGTGGTTTCCTGCCCTGGGTGG + Intergenic
1194122148 X:89974942-89974964 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1194309419 X:92286020-92286042 AAGTGGTTTTCCGCCCCGGGTGG + Intronic
1194537936 X:95130525-95130547 AAGTTGTTTTCATCCCTGGGTGG + Intergenic
1194913251 X:99673370-99673392 AAGTGGTTTTCCGCTCTGGGTGG + Intergenic
1195307183 X:103595306-103595328 AAGCGGTTTTCCGCCCTGGGTGG - Intergenic
1195322249 X:103729308-103729330 TAGTGGCCCTCAGCCCTGGATGG + Intergenic
1195751398 X:108164402-108164424 CAGTGGTCTTCAGTCCTGGGAGG + Intronic
1196298792 X:114030689-114030711 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1196390913 X:115206444-115206466 AAGCGGTTGTCTGCCCTGGGTGG - Intronic
1197479266 X:126962592-126962614 AAGTGGTTTTCCACCCTGGGCGG - Intergenic
1199008309 X:142729099-142729121 AAGCGGTTTTCTGCCCTGGGCGG + Intergenic
1199029222 X:142976863-142976885 TAGCGGTTATCAGGCCTAGGAGG + Intergenic
1199784681 X:151094079-151094101 TAGTGGTTGTCAGGGCTGGAGGG - Intergenic
1199940736 X:152625220-152625242 TAGTGGTTGACAGGGCTGGGGGG + Intergenic
1200311199 X:155079528-155079550 TATTAGTTCTCAGTCTTGGGTGG + Intronic
1200412254 Y:2872495-2872517 CAGCGGTTTTCCGCCCTGGGTGG + Intronic
1200475003 Y:3632376-3632398 AAGCGGTTTTCTGCCCTGGGTGG + Intergenic
1200617713 Y:5400267-5400289 AAGCGGTTTTCCGCCCTGGGTGG + Intronic
1200663601 Y:5991990-5992012 AAGCGGTTTTCGGCCCTGGGTGG + Intergenic
1200906187 Y:8485251-8485273 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
1201363205 Y:13175670-13175692 AAGTGGTTTTCCACCCTGGGTGG + Intergenic
1201857041 Y:18556185-18556207 AAGCGGTTTTCTGCCCTGGGTGG + Intronic
1201876280 Y:18764195-18764217 AAGCGGTTTTCTGCCCTGGGTGG - Intronic
1202170212 Y:22035441-22035463 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1202221154 Y:22550932-22550954 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic
1202321959 Y:23644730-23644752 AAGTGGTTTTCTGCCCTGGGTGG - Intergenic
1202548808 Y:26025326-26025348 AAGTGGTTTTCTGCCCTGGGTGG + Intergenic