ID: 1163390579

View in Genome Browser
Species Human (GRCh38)
Location 19:17027496-17027518
Sequence CTTCATACAGCAGGGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163390566_1163390579 11 Left 1163390566 19:17027462-17027484 CCTCTCTCGCTGGGCCTCAGAGT No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390565_1163390579 12 Left 1163390565 19:17027461-17027483 CCCTCTCTCGCTGGGCCTCAGAG No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390562_1163390579 18 Left 1163390562 19:17027455-17027477 CCCGTCCCCTCTCTCGCTGGGCC No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390563_1163390579 17 Left 1163390563 19:17027456-17027478 CCGTCCCCTCTCTCGCTGGGCCT No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390558_1163390579 26 Left 1163390558 19:17027447-17027469 CCCTTGGGCCCGTCCCCTCTCTC No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390567_1163390579 -3 Left 1163390567 19:17027476-17027498 CCTCAGAGTCCCCCTTTCCCCTT No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390564_1163390579 13 Left 1163390564 19:17027460-17027482 CCCCTCTCTCGCTGGGCCTCAGA No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data
1163390559_1163390579 25 Left 1163390559 19:17027448-17027470 CCTTGGGCCCGTCCCCTCTCTCG No data
Right 1163390579 19:17027496-17027518 CTTCATACAGCAGGGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163390579 Original CRISPR CTTCATACAGCAGGGGTGGA TGG Intergenic
No off target data available for this crispr