ID: 1163394059

View in Genome Browser
Species Human (GRCh38)
Location 19:17048772-17048794
Sequence CTGGAGCCCTTTAATATTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163394059_1163394065 27 Left 1163394059 19:17048772-17048794 CCCTCAATATTAAAGGGCTCCAG No data
Right 1163394065 19:17048822-17048844 GCAGAAATTTTAAAAGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163394059 Original CRISPR CTGGAGCCCTTTAATATTGA GGG (reversed) Intergenic
No off target data available for this crispr