ID: 1163397613

View in Genome Browser
Species Human (GRCh38)
Location 19:17073240-17073262
Sequence CAGGATCTCTTTAAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163397613_1163397617 15 Left 1163397613 19:17073240-17073262 CCATGTTCCTTAAAGAGATCCTG 0: 1
1: 0
2: 0
3: 11
4: 189
Right 1163397617 19:17073278-17073300 AACTCTTTTATCCTTCTTCTTGG 0: 1
1: 0
2: 1
3: 33
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163397613 Original CRISPR CAGGATCTCTTTAAGGAACA TGG (reversed) Intronic
900584493 1:3425896-3425918 GAGGTTCTCTTTAATGACCACGG - Intronic
901362825 1:8718285-8718307 CAAGATTTCTTTAAAAAACAGGG + Intronic
902632082 1:17710967-17710989 CAGGATCTCTTAAAGGACACAGG - Intergenic
907772441 1:57479195-57479217 CAGGACATCTGTAAGGAATAGGG + Intronic
910234491 1:85021559-85021581 CAAGGTCTCTTTAAGGTAAAGGG - Intronic
910411061 1:86945119-86945141 GAAGTTCTCTTGAAGGAACATGG + Intronic
910471196 1:87554591-87554613 CAGGAACTGTGTAAGGAACTGGG + Intergenic
912173460 1:107128782-107128804 CAGGATCTTAATATGGAACAAGG + Intergenic
916007404 1:160674980-160675002 ATGGCTTTCTTTAAGGAACAGGG - Intergenic
917164056 1:172091599-172091621 CTGGAACTCTTCAGGGAACAAGG + Intronic
919847878 1:201652754-201652776 CAGGCTCTCTTTAAGCCACTTGG - Intronic
921157264 1:212448342-212448364 CAGAATTTCTTTAAATAACAAGG + Intergenic
921934295 1:220782207-220782229 CAGAATATCATTAAGGAATAGGG + Intronic
922129227 1:222760315-222760337 TAAGATATCTTTAAGGAGCAGGG - Intergenic
924106458 1:240654194-240654216 CAGGAGCTCTTTAGGGTCCAGGG + Intergenic
924849235 1:247808261-247808283 CAGGGACTCTTTAAGGAAGGAGG + Intergenic
1064377276 10:14808602-14808624 CCGGATTTCTGTAAGCAACAAGG + Intergenic
1065261285 10:23926163-23926185 CTGAATCTAATTAAGGAACAGGG - Intronic
1065788656 10:29239934-29239956 CAGGAACTCTAAAAGTAACAGGG - Intergenic
1066542239 10:36459775-36459797 CAAGTTATTTTTAAGGAACAGGG + Intergenic
1068800574 10:61135712-61135734 AGGGATATCTTTAAGCAACAGGG - Intergenic
1068842006 10:61626052-61626074 CAGGCTCTGTTCAAGGAACCAGG - Intergenic
1071458547 10:85869948-85869970 CAGGAGCTCTTTCCAGAACAGGG + Intronic
1075527202 10:123196989-123197011 CAGGATCTCTTTCTGCAGCAGGG + Intergenic
1075894162 10:125980009-125980031 CAGGGGTTCTTTAAGCAACAGGG + Intronic
1076548316 10:131260724-131260746 CAGTTTCTCTTTAAGGCACCCGG - Intronic
1077127268 11:946414-946436 CAGTCTCTCTTTCAGAAACAGGG - Intronic
1081802922 11:45872001-45872023 CAGCAGCTCTTTAGGGGACAGGG - Intronic
1083673450 11:64312863-64312885 CAGGGCCTGTTTGAGGAACATGG + Intronic
1088524465 11:110738025-110738047 CAGGCTCTTTTTCAGGACCAAGG - Intergenic
1092653296 12:10657243-10657265 GAGGAGCCCTTTGAGGAACAGGG - Intronic
1093185209 12:16012460-16012482 GAATATCTCTTTAAGGGACAGGG - Intronic
1097874326 12:64629512-64629534 TAGGATCTGTTTAATGAAAAGGG - Intronic
1099948033 12:89267216-89267238 CAGGGTCTTTCTAAGGAAAAAGG + Intergenic
1099982644 12:89624749-89624771 CAGTTTCTCTTTAAGCATCAGGG - Intronic
1103248022 12:119474934-119474956 CAGGACCTCTTTAAAGCCCAGGG + Intronic
1103515270 12:121503758-121503780 CTGAATTACTTTAAGGAACAAGG - Intronic
1104200817 12:126586871-126586893 CAGGGCTTCTTTAAGGAAAAGGG + Intergenic
1104512389 12:129392469-129392491 CAGAATCTCTTTGAGGAGGAAGG - Intronic
1105057888 12:133119623-133119645 AAAGATTTCTTTGAGGAACAGGG + Exonic
1106582882 13:31032774-31032796 CAGGAGCTCCTTGAGGAGCATGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1107300505 13:38961168-38961190 AATGATCTCATTAAGGGACAAGG - Intergenic
1107753526 13:43594834-43594856 CAGAGTCTCTTGAAGGAAAATGG - Intronic
1108821495 13:54356248-54356270 CAGCACCTCTTAAAGAAACATGG + Intergenic
1110904201 13:80864712-80864734 CAGTATTTCTTCAAGGAAGATGG - Intergenic
1110957761 13:81576915-81576937 CATGATTCCTTTAAGGATCACGG - Intergenic
1111392503 13:87615430-87615452 CAAGATCTCTTTTAGAGACAGGG + Intergenic
1112314561 13:98350011-98350033 GAGGAGCTTTTTGAGGAACATGG + Intronic
1112412203 13:99174183-99174205 CATGATCTTCTTAAGGAAGATGG - Intergenic
1112693623 13:101922211-101922233 AAGGATCTCTTTAGGTACCATGG - Intronic
1113587448 13:111474983-111475005 CAGGATTTGTTGCAGGAACAGGG + Intergenic
1118542041 14:66839129-66839151 CAGCATCTTTTGAAGGAACTTGG - Intronic
1119528201 14:75339968-75339990 CACGATGTCTGTCAGGAACACGG + Intergenic
1119682989 14:76606768-76606790 CAGGAGTTGTTTAAGGAAGAGGG + Intergenic
1120485685 14:85111153-85111175 CAGTATATCTCTAGGGAACAGGG - Intergenic
1121620901 14:95347684-95347706 CAAGATTTCTTCAAGGAGCAGGG + Intergenic
1124350370 15:28950958-28950980 AGGGATCTCTCTAAGGGACATGG - Intronic
1125095424 15:35844763-35844785 CAGTTTCCCTTTAAGGAACTGGG + Intergenic
1125953672 15:43775350-43775372 CAGGTTCTCTGTTTGGAACATGG + Exonic
1126952451 15:53896619-53896641 CTGGTTCCCTTTAAGGAAGAGGG - Intergenic
1127482593 15:59391170-59391192 CAGAATCTCTTGCTGGAACATGG + Intronic
1128880143 15:71235344-71235366 AAGGCTCTCTTTAAGCCACATGG + Intronic
1129580465 15:76803638-76803660 GATGATCTTTATAAGGAACAGGG - Intronic
1130845931 15:87745709-87745731 CAGGCTATCTTTAAAGACCAAGG + Intergenic
1132323574 15:100946214-100946236 CAGGATTTCTTTTTGGAACATGG + Intronic
1137035447 16:35565836-35565858 CATGATCTCTCCAGGGAACAGGG + Intergenic
1137592802 16:49704058-49704080 CAGGCCCTCTTTGAAGAACAGGG - Intronic
1137679760 16:50330264-50330286 AGGGAGCCCTTTAAGGAACAGGG - Intronic
1138345514 16:56317830-56317852 CAGGATCTTTTTGAGGAACCAGG + Intronic
1142395641 16:89829679-89829701 CAGGACCTGGTGAAGGAACAAGG - Intronic
1142760072 17:2036890-2036912 CAGGATCTCTCCAGGGGACAGGG - Exonic
1146324199 17:31871545-31871567 CAAGATCAGTTTAAGCAACAAGG + Intronic
1149370309 17:55987530-55987552 AACAATCTCTTGAAGGAACATGG + Intergenic
1150227204 17:63530628-63530650 CAGGATCTCTTTATCGGCCAAGG - Intronic
1150725802 17:67650400-67650422 CAGGATGCCTTTTAGGAACTGGG - Intronic
1150760952 17:67961114-67961136 CAGAATTTCTTTAAATAACAAGG + Intronic
1154466688 18:14651333-14651355 AAAGATCTCTTCAAGGAAAATGG + Intergenic
1156154209 18:34282092-34282114 CAGGATATTATTAAGGAACCTGG + Intergenic
1157648182 18:49299478-49299500 AAGGAACTGTTTTAGGAACAGGG - Intronic
1159647196 18:70933164-70933186 CAGGACCTCCTTAAGGACTAGGG - Intergenic
1161380969 19:3964682-3964704 CAGGATCTGCTTGAGGAACTGGG + Exonic
1163178595 19:15583379-15583401 CAGGCTCTCCTTCAGGCACATGG - Intergenic
1163184458 19:15628331-15628353 CAGGCTCTCCTTCAGGCACATGG - Exonic
1163188473 19:15658293-15658315 CAGGCTCTCCTTAATGCACATGG - Exonic
1163220502 19:15914844-15914866 CAGGCTCTCCTTAATGCACATGG + Exonic
1163346915 19:16749199-16749221 TTGGATCTCTCTAAGGAAGACGG - Exonic
1163397613 19:17073240-17073262 CAGGATCTCTTTAAGGAACATGG - Intronic
1166277119 19:41761761-41761783 CAGGATGTCCTTAAGGCTCAGGG + Intronic
1167212815 19:48144041-48144063 CAGGCTCTGTTCAAGGCACACGG + Intronic
1168314975 19:55481113-55481135 CACGGGCTCTTTAAGGGACAGGG - Intronic
1168532296 19:57139392-57139414 CAGGATGTCTTAAAGAAAAATGG - Intronic
925816259 2:7753847-7753869 GAGGATTTCTTTAAGAAACATGG + Intergenic
926634149 2:15162904-15162926 CAGGCTCTCTCCAAAGAACAGGG + Intergenic
927102456 2:19798670-19798692 AAGGGACTCTTGAAGGAACATGG - Intergenic
927204437 2:20598329-20598351 CAAGATCTCTTGAATGAGCAAGG + Intronic
931986359 2:67746107-67746129 CAGGATCTCTGTCACCAACATGG + Intergenic
934656383 2:96118571-96118593 CAGCATCCCTTGAAGGAAGATGG - Intergenic
934723996 2:96603254-96603276 AAGGTTCTCTTAAAGGAAAAGGG + Intronic
937438866 2:121900438-121900460 CAGGATCTCCATTAGGAACTGGG + Intergenic
937442102 2:121924961-121924983 TATGATATATTTAAGGAACAAGG - Intergenic
938724194 2:134092316-134092338 CAGGATCTCATGAAGGCACTGGG - Intergenic
939196443 2:138978996-138979018 CAGAGTCTCTCTAGGGAACATGG - Intergenic
939522596 2:143249133-143249155 CAAAATCTCTTTAAGGAGCATGG + Intronic
946706164 2:222460737-222460759 CAGGTACTGTTTCAGGAACACGG + Intronic
1169634171 20:7668980-7669002 CAGGTCCACGTTAAGGAACATGG - Intergenic
1169780278 20:9301997-9302019 CACCTTCTCTTTGAGGAACACGG - Intronic
1171176652 20:23055454-23055476 CAGGCTTTCTTAAAGAAACAGGG + Intergenic
1172026152 20:31950227-31950249 CCTGATCTCTATCAGGAACAAGG + Intronic
1172345511 20:34195459-34195481 AGGGATCTCATTAAGGATCAGGG + Intronic
1173960515 20:47068118-47068140 CAGTTTCTCTGTATGGAACATGG + Intronic
1174728995 20:52896044-52896066 CAGCAGCTCTTCAAGCAACACGG - Intergenic
1175186756 20:57184068-57184090 CAGGTACTGTTTAAGGAACTTGG + Intronic
1176725017 21:10424297-10424319 TATGATCTCTTTAACGTACATGG + Intergenic
1176807829 21:13506339-13506361 AAAGATCTCTTCAAGGAAAACGG - Intergenic
1178115347 21:29411367-29411389 AAGGAACTCTTTAAGGAAGCTGG + Intronic
1181724911 22:24805038-24805060 CAGGGGCTCTTGATGGAACAAGG + Intergenic
1183174755 22:36214752-36214774 GTGGAGCCCTTTAAGGAACAGGG + Intergenic
950468330 3:13169003-13169025 CAGGAACTCTATAAGGAATATGG - Intergenic
953808623 3:46093213-46093235 GAGGATTTCTTTGAGGAAAAAGG - Intergenic
954459672 3:50619212-50619234 CAGGACTTATTTAAGGCACAAGG + Intronic
954688597 3:52383973-52383995 TGGGATCTCATTGAGGAACACGG - Exonic
961193997 3:124986083-124986105 CAGTTTCTCTGTAAGGAGCAAGG + Intronic
961970801 3:130965078-130965100 CAGTATCCCTTTAAGAAACTTGG + Intronic
962165127 3:133039780-133039802 CAGGATGTCTCCAAGGGACAAGG - Intronic
962429545 3:135306680-135306702 CAGGAGCTCTGTAAGGAGCTTGG - Intergenic
962886554 3:139633095-139633117 CAGGACCTCTAGAAGGAACGCGG + Intronic
964285873 3:155117783-155117805 CAGGATCACCTTGAGGACCAGGG + Intronic
964453746 3:156838175-156838197 CAGGTGATCTTTAAGCAACATGG + Intronic
967316641 3:188156205-188156227 CAGGCTCTCTGTAAGCAGCATGG + Intronic
967678884 3:192335742-192335764 GAGGATCATTTTAAGGATCAGGG - Intronic
968181306 3:196597438-196597460 AAGGATCTCTTGTAGGAAGATGG + Intergenic
970144580 4:13021626-13021648 CTGGATCTCTGAAAGGTACAAGG - Intergenic
970304107 4:14713445-14713467 CAGGTTATTTTTAAGGAACTTGG + Intergenic
972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG + Intergenic
974062330 4:57046654-57046676 CTGGAGCTCTTAATGGAACAAGG - Intronic
978713331 4:111811613-111811635 CAGGATATTTTTAAGACACAAGG - Intergenic
979104336 4:116664986-116665008 GTGGAGCCCTTTAAGGAACAGGG - Intergenic
979976463 4:127202487-127202509 CAGGATGCCTTTAAGGAAGCAGG + Intergenic
980168301 4:129254736-129254758 TAGACTCTCTTTAAAGAACAGGG - Intergenic
980512116 4:133806592-133806614 GAGAATCTATTTGAGGAACATGG + Intergenic
980536127 4:134126493-134126515 CAGGGTCTCTTTAATAAGCATGG - Intergenic
980846016 4:138326020-138326042 CAGCATCTCCTTTCGGAACACGG + Intergenic
981278136 4:142926143-142926165 CAGGATCTATTCTAGGAGCATGG - Intergenic
983396858 4:167209553-167209575 CAGGAGCTCTTTAAGGAAAGTGG - Intronic
986339860 5:6779666-6779688 GATGATCTCTTTAATGAAAAGGG + Intergenic
988229704 5:28459556-28459578 CAGTAGCTCTTTTAGGACCATGG - Intergenic
988384942 5:30550879-30550901 CAGAATCTCTTTAAGAAAAAAGG - Intergenic
988485673 5:31666317-31666339 CAGGATCTTGTAAAGGAGCATGG + Intronic
988790698 5:34604775-34604797 CAGGGTTGCTTTAAGGAAGACGG + Intergenic
990980741 5:61600617-61600639 CAGGAACTCTAAAAGTAACAGGG - Intergenic
994938119 5:106282946-106282968 CAGGATCTCTGTATTCAACAAGG + Intergenic
995738331 5:115327647-115327669 AACCATCTCTTCAAGGAACAGGG + Intergenic
996687707 5:126301998-126302020 AAGCATTTCTTTAAGGGACAGGG + Intergenic
997554657 5:134785039-134785061 CAGCTTCTCTCTTAGGAACACGG + Intronic
998234404 5:140385824-140385846 GAGGATCTAGTGAAGGAACATGG - Intergenic
998981885 5:147712950-147712972 CAGGGTTCCTTTAAGGAATATGG + Intronic
999209405 5:149874795-149874817 TAGGATCTCTGTCAGGAACCAGG + Intronic
1001219293 5:169885386-169885408 CAGGCTCTCTTTAATTCACAAGG - Intronic
1003216319 6:4116415-4116437 CAGGATTTATTAAATGAACATGG - Intronic
1003365403 6:5469592-5469614 CGGCATCTCTTAAAGGAACTGGG + Intronic
1006196917 6:32249517-32249539 GTGGAGCCCTTTAAGGAACAGGG - Intergenic
1007665793 6:43512308-43512330 CAGGATCCCTGGAAGGAAGATGG + Exonic
1009949394 6:70378416-70378438 GAGGATGTCTGTAAGGCACATGG - Intergenic
1019024065 6:168942684-168942706 CAGGGTTTCTCTAAGGGACAAGG - Intergenic
1021140935 7:17023986-17024008 CTGGATATCTTGAAGGACCAGGG + Intergenic
1021327384 7:19291223-19291245 CAGGATTTACTTAAGCAACAAGG + Intergenic
1021878143 7:25067648-25067670 CAGAATTTCTTTAAATAACAAGG - Intergenic
1024712154 7:52027739-52027761 CAGGATCTGTTTATTGAAAAAGG - Intergenic
1028154680 7:87416336-87416358 CAGTATCTCTATAGGGAAGAAGG - Intronic
1030952535 7:115809483-115809505 CAGGATTTTTTTAAGTAATAGGG + Intergenic
1032832292 7:135640460-135640482 GAAGAAATCTTTAAGGAACAGGG - Intronic
1032832323 7:135640759-135640781 CAGGATGTCTTAAAGAAACTGGG + Intronic
1034006578 7:147478749-147478771 CAGGCTTTCTTTAAGTTACATGG - Intronic
1034612783 7:152387126-152387148 TATGATCTCTTTAATGTACATGG - Intronic
1037911402 8:22745760-22745782 CAGGATGTATTTGGGGAACAAGG + Intronic
1040371862 8:46784247-46784269 CAGGATTTCAATAAGAAACATGG - Intergenic
1040800430 8:51333373-51333395 CAGAATCTCTTTAAAGCATAAGG + Intronic
1045480046 8:102584482-102584504 CAGGAACTCTTTCAGAAGCAAGG - Intergenic
1046243504 8:111529314-111529336 GAGGATCTCTTGAATCAACAAGG + Intergenic
1047705570 8:127496039-127496061 CAGGATCTCATTAAGAGAAATGG - Intergenic
1047851414 8:128861541-128861563 CAGGACCTCTTGAAAGGACAGGG + Intergenic
1048028048 8:130604837-130604859 CTGGATCTCTTTTGGGAACATGG + Intergenic
1048866525 8:138765476-138765498 AAAGATCACTGTAAGGAACATGG + Intronic
1048888065 8:138924547-138924569 CTGGTTTTCTTTAGGGAACAGGG + Intergenic
1051710258 9:19924135-19924157 TACAATTTCTTTAAGGAACATGG + Intergenic
1051927515 9:22347136-22347158 AAGGAACTTTTTAAGGAAGATGG - Intergenic
1052850158 9:33373334-33373356 CAGGTTCTCCTTAGGGAACAAGG - Intergenic
1056038427 9:82634589-82634611 TAAGATCTCTTCAAGGAAAAAGG + Intergenic
1060848460 9:126856114-126856136 CAGGTTCTCTGTAAGGTACAGGG + Intergenic
1186209999 X:7240650-7240672 CAGTATCTTTCCAAGGAACAAGG + Intronic
1186777763 X:12882857-12882879 CAGGCTCTCATTTAGGTACATGG + Intronic
1192164722 X:68820855-68820877 CAGGAGCTCATTAGGGAAGATGG - Intergenic
1193741228 X:85219975-85219997 CAGTATTTCTTTCAGTAACATGG - Intergenic
1198127857 X:133663981-133664003 CAGAATTTCTTTAAATAACAAGG - Intronic
1198649473 X:138845937-138845959 CGGGTTCTTTTTAAGCAACAAGG - Intronic
1200800120 Y:7379100-7379122 CATGATGTCTGTAAAGAACAAGG - Intergenic
1200848315 Y:7855440-7855462 CAGGATTTCAATAAGAAACATGG + Intergenic
1202268787 Y:23049367-23049389 TAGGATCTCAATAAGAAACATGG - Intergenic
1202421779 Y:24683107-24683129 TAGGATCTCAATAAGAAACATGG - Intergenic
1202449007 Y:24986971-24986993 TAGGATCTCAATAAGAAACATGG + Intergenic