ID: 1163398120

View in Genome Browser
Species Human (GRCh38)
Location 19:17075871-17075893
Sequence GAGGCTGCCTGGTACTCACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 203}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163398120_1163398126 11 Left 1163398120 19:17075871-17075893 CCAGGTGAGTACCAGGCAGCCTC 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1163398126 19:17075905-17075927 TCGAGCTCGAAGCCTGCCTTTGG 0: 1
1: 0
2: 0
3: 1
4: 35
1163398120_1163398129 14 Left 1163398120 19:17075871-17075893 CCAGGTGAGTACCAGGCAGCCTC 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1163398129 19:17075908-17075930 AGCTCGAAGCCTGCCTTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 76
1163398120_1163398128 13 Left 1163398120 19:17075871-17075893 CCAGGTGAGTACCAGGCAGCCTC 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1163398128 19:17075907-17075929 GAGCTCGAAGCCTGCCTTTGGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1163398120_1163398133 29 Left 1163398120 19:17075871-17075893 CCAGGTGAGTACCAGGCAGCCTC 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1163398133 19:17075923-17075945 TTTGGGGGCTGCGCAGAAGAGGG 0: 1
1: 0
2: 1
3: 18
4: 209
1163398120_1163398127 12 Left 1163398120 19:17075871-17075893 CCAGGTGAGTACCAGGCAGCCTC 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1163398127 19:17075906-17075928 CGAGCTCGAAGCCTGCCTTTGGG 0: 1
1: 0
2: 0
3: 3
4: 44
1163398120_1163398132 28 Left 1163398120 19:17075871-17075893 CCAGGTGAGTACCAGGCAGCCTC 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1163398132 19:17075922-17075944 CTTTGGGGGCTGCGCAGAAGAGG 0: 1
1: 0
2: 2
3: 20
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163398120 Original CRISPR GAGGCTGCCTGGTACTCACC TGG (reversed) Exonic
900439831 1:2648965-2648987 CAGGCTGTCAGATACTCACCTGG - Intronic
900441768 1:2659189-2659211 CAGGCTGTCTGATGCTCACCTGG - Intronic
900442661 1:2663805-2663827 CAGGCTGTCTGATGCTCACCTGG - Intronic
900443554 1:2668421-2668443 CAGGCTGTCTGATGCTCACCTGG - Intronic
900444556 1:2673599-2673621 CAGGCTGTCTGATGCTCACCTGG - Intronic
900446164 1:2681988-2682010 CAGGCTGTCTGATGCTCACCTGG - Intronic
900448235 1:2692386-2692408 CAGGCTGCCAGATGCTCACCTGG - Intronic
900449332 1:2697809-2697831 CAGGCTGTCTGATCCTCACCCGG - Intronic
900449447 1:2698409-2698431 CAGGCTGTCGGATACTCACCTGG - Intronic
900449477 1:2698530-2698552 CAGGCTGCCCGATGCTCACCTGG - Intronic
900449844 1:2700375-2700397 CAGGCTGTCAGATACTCACCTGG - Intronic
900450006 1:2701222-2701244 CAGGCTGCCAGATGCTCACCTGG - Intronic
900450238 1:2702388-2702410 CAGGCTGTCAGATACTCACCTGG - Intronic
900452800 1:2758760-2758782 CAGGCTGTCTGATCCTCACCCGG - Intronic
900452915 1:2759360-2759382 CAGGCTGTCGGATACTCACCTGG - Intronic
900452946 1:2759481-2759503 CAGGCTGCCCGATGCTCACCTGG - Intronic
900453302 1:2761326-2761348 CAGGCTGTCAGATACTCACCTGG - Intronic
900453493 1:2762333-2762355 CAGGCTGCCAGATGCTCACCTGG - Intronic
900453722 1:2763499-2763521 CAGGCTGTCAGATACTCACCTGG - Intronic
900453921 1:2764504-2764526 CAGGCTGCCAGATGCTCACCTGG - Intronic
900454206 1:2765918-2765940 CAGGCTGCCAGATGCTCACCTGG - Intronic
900454435 1:2767084-2767106 CAGGCTGTCAGATACTCACCTGG - Intronic
900454651 1:2768248-2768270 CAGGCTGCCAGATCCTCACCTGG + Intronic
900454741 1:2768703-2768725 CAGGCTGCCAGATGCTCACCTGG - Intronic
900454871 1:2769348-2769370 CAGGCTGTCAGGTGCTCACCTGG - Intronic
900455167 1:2770761-2770783 CAGGCTGTCAGATACTCACCTGG - Intronic
900455368 1:2771766-2771788 CAGGCTGCCAGATGCTCACCTGG - Intronic
900455685 1:2773340-2773362 CAGGCTGCCAGATGCTCACCTGG - Intronic
900455913 1:2774506-2774528 CAGGCTGTCAGATACTCACCTGG - Intronic
900456168 1:2775873-2775895 CAGGCTGCCAGATCCTCACCTGG + Intronic
900456256 1:2776328-2776350 CAGGCTGCCAGATGCTCACCTGG - Intronic
900456279 1:2776447-2776469 CAGGCTGCCAGATGCTCACCTGG - Intronic
900456409 1:2777092-2777114 CAGGCTGTCAGGTGCTCACCTGG - Intronic
900788654 1:4665645-4665667 CACGCTGCCTGGCTCTCACCTGG - Intronic
900971090 1:5992785-5992807 GGGTCTCCCCGGTACTCACCTGG - Intronic
901641000 1:10693091-10693113 CAGGAGGCCTGGTGCTCACCTGG - Intronic
902117982 1:14137421-14137443 CAGGCTGGCTGGGACTCACAGGG + Intergenic
902383032 1:16061521-16061543 GAGGCTACCTAGTCCTCCCCAGG + Intronic
902734476 1:18391120-18391142 TAGGCTGCCTGGCACCCACCTGG - Intergenic
903045691 1:20562796-20562818 GAGGCTGATTGGTGGTCACCTGG + Intergenic
904829032 1:33295012-33295034 GAGGCAGGCAGGCACTCACCTGG - Exonic
905016133 1:34780175-34780197 GAGGCTCCCTTGTACTCACTGGG - Intronic
905884592 1:41484892-41484914 GAGGCTCCCTGGCAGTCCCCAGG + Intergenic
906127611 1:43437197-43437219 GTGGCTGCCAGGTACCCACGGGG - Exonic
906672648 1:47667742-47667764 GGGTCTACCTGGCACTCACCTGG + Intergenic
907288206 1:53395722-53395744 GAGGCTTCCTGGAGCTCAGCTGG - Intergenic
910251133 1:85200705-85200727 GAGGCGGCTTGGCACCCACCCGG + Exonic
910851234 1:91651504-91651526 GAGAGTGCCTGGTACACAGCTGG + Intergenic
913019869 1:114778490-114778512 GAAGCTGCCTGGTAAACACTTGG - Intronic
920740264 1:208575313-208575335 GATGCTGCCTGGTTCTTCCCAGG + Intergenic
921599336 1:217089942-217089964 GAGGCTGCCAGGTTCTCCTCGGG + Intronic
922100773 1:222475566-222475588 GAGGCTGCCAGCTGCTCAGCAGG + Intergenic
1066577029 10:36837255-36837277 GCTCCTGCCTGGCACTCACCTGG + Intergenic
1067723025 10:48743878-48743900 GAGGCTGCCTGGCACACCCAGGG - Intronic
1069955198 10:72046040-72046062 GAGGCTGCCAGGTGTTCCCCTGG - Intergenic
1070311243 10:75275653-75275675 CAGGCAGCCTGGGCCTCACCTGG + Intergenic
1072224833 10:93359554-93359576 TAGCCTGCCTGGGAATCACCTGG + Intronic
1073079233 10:100847351-100847373 GAGGCAGCCTGGGAGTCAACAGG + Intergenic
1073870121 10:107853699-107853721 GAGGCTTCCTGGTGCTCAGATGG - Intergenic
1074986495 10:118664418-118664440 GGGGCTACCTAGTACTCACAGGG - Intergenic
1075668121 10:124245046-124245068 GAGCCTGCCTGGGAGTCGCCAGG - Intergenic
1076040315 10:127241965-127241987 GAGGGTGCCAGGTACTCAGGAGG - Intronic
1076867330 10:133174468-133174490 GACACTGCCTGATACACACCCGG - Intronic
1076905074 10:133357496-133357518 GAGGCTGTCGGGTGCTGACCAGG + Intronic
1077555156 11:3222450-3222472 GTGGCTGCCTGGGCCTGACCGGG - Intergenic
1083222152 11:61259429-61259451 GGAGCTGGCTGGTCCTCACCAGG - Intronic
1083330642 11:61896878-61896900 GAGGCTGCCTGTTGCTCAGTGGG - Intergenic
1089051829 11:115552351-115552373 CAAGCTGCCTGGAATTCACCAGG + Intergenic
1089161997 11:116445479-116445501 GAGGCTGCCAAGGACTCATCAGG + Intergenic
1091305026 11:134531328-134531350 GAGCCTGCCTGGTCCTGCCCTGG + Intergenic
1091660300 12:2378276-2378298 TAGGATGCCTGGAACTCTCCTGG - Intronic
1092283568 12:7115487-7115509 GGGCCTGGCTGGTCCTCACCTGG + Intergenic
1096003742 12:48151546-48151568 GAGGCTGCCAGATGGTCACCTGG + Intronic
1096542104 12:52313701-52313723 AAGGCTGCCAGGTACTCAGGAGG + Intergenic
1096876173 12:54632132-54632154 GAGTCTACCTGCTTCTCACCAGG + Intronic
1099301016 12:80894305-80894327 GAGGCTGCCAGGTAAGCACAAGG + Intronic
1103604298 12:122075830-122075852 GATGCTGCCCGCTACTCAGCAGG + Intergenic
1103623329 12:122201582-122201604 GGGGCTGCCTGGGGCTCATCTGG + Intronic
1104604898 12:130180679-130180701 GAGGCTGCCGTGTACACTCCAGG - Intergenic
1106076289 13:26464099-26464121 GAGGCAGCCTGGGGCTCCCCAGG - Intergenic
1111979569 13:95002566-95002588 GATGCTGCCTGGTTCCCTCCTGG - Intergenic
1113907894 13:113828824-113828846 GAGGCCACCTGATCCTCACCTGG + Intronic
1113907971 13:113829100-113829122 GAGGCCACCTGATCCTCACCTGG + Intronic
1113908021 13:113829284-113829306 GAGGCCACCTGATCCTCACCTGG + Intronic
1113908149 13:113829788-113829810 GAGGCCACCTGATCCTCACCTGG + Intronic
1113937109 13:114000283-114000305 GAGGAAGCCTGGGACCCACCTGG + Intronic
1118842429 14:69523261-69523283 GAGGCTGCCTCAGAATCACCTGG - Intronic
1119732942 14:76962628-76962650 GAGGCTGGCTGGAGCTCACAGGG + Intergenic
1121001374 14:90454160-90454182 GAGGCAGCCTGGTACCCAGGAGG - Intergenic
1121100075 14:91244496-91244518 GCAGCTGCCTGCTCCTCACCTGG - Exonic
1121254564 14:92521631-92521653 GAGGCTTCCTGAGCCTCACCAGG + Intronic
1122883245 14:104699459-104699481 GAGGCTGCCTGGGAGGGACCCGG + Intronic
1202921232 14_KI270723v1_random:31885-31907 GAGGCTCCCAGTCACTCACCAGG + Intergenic
1202923676 14_KI270724v1_random:5695-5717 GAGGCTCCCAGTCACTCACCGGG - Intergenic
1126351055 15:47745198-47745220 CAGGCTTCCTGGTACTCACCTGG + Intronic
1128223260 15:65983231-65983253 AAGGCTGCCTGTTACTTCCCAGG - Intronic
1128400899 15:67279869-67279891 GTGGGCGCCTGGTACTCGCCTGG + Intronic
1129323527 15:74787721-74787743 GAGGCTGCTTGGTGCCCCCCTGG + Intronic
1130652103 15:85767998-85768020 TGGGCTGCCAGGGACTCACCTGG + Exonic
1132592569 16:732548-732570 GAGGCTGCCTGGTCCTGCCCAGG + Intronic
1133435167 16:5772975-5772997 AAGGCTTCCTGGAACACACCAGG - Intergenic
1134105777 16:11485186-11485208 CAGGCTCCCTGGTGCCCACCTGG + Intronic
1136117147 16:28101704-28101726 GGGGCTGGCTGCTGCTCACCTGG - Intronic
1142187628 16:88701942-88701964 GAGGCTGGGTGGCAGTCACCAGG + Intronic
1148871176 17:50659483-50659505 GAGGCTGCCAAGAAATCACCTGG - Intronic
1151467770 17:74298722-74298744 GAGGCTGCCTGCTACTCGGGAGG - Intronic
1152028166 17:77825103-77825125 GAGCCTGCCTGGTGCCCTCCAGG + Intergenic
1154134220 18:11761599-11761621 GAGGGTGCCTGGAACTCCCCTGG + Intronic
1155886134 18:31211037-31211059 GAGGCTGCCTCCCTCTCACCAGG - Intergenic
1161232204 19:3179980-3180002 GGGCCTGCCTGGCACGCACCCGG - Exonic
1161569659 19:5023578-5023600 GAGGCCGGCTGGGACTCACTGGG + Intronic
1161729500 19:5950572-5950594 AAGGCTGCCTGGTGCTCAGGCGG + Intronic
1162740784 19:12772491-12772513 GACTCTGCCTGGAACTCAGCTGG - Intronic
1163398120 19:17075871-17075893 GAGGCTGCCTGGTACTCACCTGG - Exonic
1163536214 19:17878090-17878112 GAGCCTGGGTGGGACTCACCTGG - Exonic
1163800485 19:19362020-19362042 AAGGCTGCCTGGTGCTGAACTGG - Intergenic
1165064467 19:33220984-33221006 GAGGCTACCTGGGTCTCCCCGGG - Intronic
1165882473 19:39053586-39053608 GGAGCTGCCTGGTACTGCCCAGG - Intergenic
1166977983 19:46616190-46616212 GAGGCTGCCTCGTGCCCACTGGG - Intergenic
925047101 2:780772-780794 GCGGGTGCCTGGTCCTCACTGGG - Intergenic
926094777 2:10073959-10073981 GAGGCTGCCCGCTCCTCCCCCGG + Intronic
926105431 2:10146698-10146720 GAGGGTGCCTGGTAAGCCCCGGG + Intronic
928800249 2:35080588-35080610 GAGGCTCCCAGGTTCTCAACCGG + Intergenic
929488530 2:42376015-42376037 GAGGCTGCTTGTTATTCTCCAGG - Intronic
931450745 2:62365814-62365836 GAGGCAGCCTGGTGCTGTCCAGG - Intergenic
932015210 2:68019020-68019042 AAGGCTGCTTTGTACTCACATGG + Intergenic
933213261 2:79596207-79596229 GACGCTGCCTGGAACTTAGCAGG + Intronic
933723031 2:85410233-85410255 GCGGCTGGCTGGTACCCTCCTGG - Intronic
934588827 2:95528555-95528577 GGGGCTGCCTGGTCCACTCCAGG - Intergenic
936093191 2:109513945-109513967 GAGGCTGCCTGGGCTCCACCCGG - Intergenic
938092319 2:128441719-128441741 ACGGCTCCCTGGGACTCACCAGG - Intergenic
944370145 2:198973407-198973429 CAGGCTGCCTGGTACACAGCTGG + Intergenic
947723368 2:232382090-232382112 GAGCCTGCCTGGTACCCACTGGG - Exonic
947752949 2:232542188-232542210 GAGGCTGCAGGGCCCTCACCTGG - Intronic
948829199 2:240589533-240589555 AAGGCCTCCTGGTACTCAGCAGG - Intronic
1171426223 20:25050438-25050460 GAGGCTGGTTGGGACTCAGCAGG - Intronic
1172223778 20:33290913-33290935 GAGCTTGCCTGGTGCTCACATGG + Intronic
1173053607 20:39589493-39589515 GAGTGTCCCTGGTCCTCACCTGG - Intergenic
1175964357 20:62653051-62653073 GACGGTGCCTGGTACACAGCTGG + Intronic
1176121647 20:63456795-63456817 GAGGCTGCGTGGGACCCCCCAGG - Intronic
1178408814 21:32347418-32347440 GAGCCTGCCTGAGACACACCTGG - Exonic
1179807479 21:43848972-43848994 GTGGCTGGCTGGCAGTCACCTGG + Intergenic
1180167762 21:46038846-46038868 GAGGCAGCCGGGTGCCCACCTGG - Intergenic
1181846976 22:25718378-25718400 GAGGCTGCCTTAGACTTACCCGG - Exonic
1182125168 22:27810759-27810781 CAGCCTGCCTGGAGCTCACCAGG - Intergenic
1182833239 22:33320853-33320875 GAGGCTGCCAGTGACTCACCGGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1183367078 22:37412576-37412598 TAGCCTGCCTGGTACTGGCCAGG - Intronic
1184550942 22:45203826-45203848 GAGGCCGCCCCGCACTCACCCGG + Exonic
1184726566 22:46350762-46350784 CACACTGCCTGGCACTCACCTGG - Intronic
1185176478 22:49330172-49330194 GAGGCTGACTGGTTCTCTGCTGG + Intergenic
950013455 3:9740005-9740027 GAGGCTGCCAGCTCCTCTCCTGG - Intronic
950024510 3:9810938-9810960 TTGGCTCCCTGGAACTCACCAGG - Intronic
951512911 3:23524394-23524416 TAGCCTGCCTGGCACTCAGCAGG - Intronic
952613868 3:35245615-35245637 GATGCTGCCTGGAACTCCCAGGG + Intergenic
953565609 3:44029265-44029287 GGGCCTGACTGGTACTCTCCAGG + Intergenic
954116264 3:48468490-48468512 GAGGCTGCCTGATCCCCAACAGG + Exonic
954422557 3:50426337-50426359 GAGGCTGCATGGCACTCCCAGGG + Intronic
957080287 3:75631086-75631108 GAGGCTGCCAGTCACTCACCAGG - Intergenic
964383238 3:156119636-156119658 GAGGGTGCCTGGTGCTTAACGGG + Intronic
966319073 3:178680396-178680418 GAGGCTGGTTGTCACTCACCTGG + Intronic
968433394 4:572709-572731 AAGGCTGCCTGGCACTGCCCTGG - Intergenic
968684871 4:1951200-1951222 GATGCTGCCTTCTCCTCACCTGG - Exonic
968737241 4:2303823-2303845 GTGGCTGCCTGGCTCACACCGGG - Intronic
971810301 4:31416685-31416707 TTGGCTGCCTGGAACTCAGCAGG - Intergenic
973271899 4:48270063-48270085 GACGCTCCCTGAAACTCACCGGG - Intergenic
973979584 4:56296771-56296793 GAGGCTGCCAGCTCCTCACAGGG - Intronic
985746663 5:1652064-1652086 CAGGCTGCCTTGTTCTCAGCAGG - Intergenic
985749175 5:1664236-1664258 GAGGCTGTCTCCTGCTCACCAGG - Intergenic
985884041 5:2662512-2662534 GACCCTGCCTGGTTCTGACCAGG + Intergenic
986288429 5:6378325-6378347 GAGGCTGCCGGGGTCTCCCCAGG - Intronic
986741516 5:10709776-10709798 GAGGCTGACAGTTACCCACCTGG + Intronic
986992224 5:13567863-13567885 GAGGCTGCCTGCTATACACAGGG - Intergenic
987541260 5:19259103-19259125 GAGGCTGCCTGGTAATCTAATGG - Intergenic
997382308 5:133446594-133446616 GAGCCTGCCTGGAACACACTGGG + Intronic
997429236 5:133826039-133826061 GAAGTTGCCTGCTTCTCACCTGG - Intergenic
999671252 5:153960654-153960676 GAGGCTGCCGGGCACTCACATGG - Intergenic
1002418978 5:179135692-179135714 GAGTATGCCTAGGACTCACCTGG - Intronic
1005443926 6:25901587-25901609 GAGGCTGCCTGCTAATTACCTGG + Intergenic
1007271101 6:40637653-40637675 GAGGCTGACAGGGTCTCACCTGG + Intergenic
1009624916 6:66126802-66126824 CAGGCTGCCTGGAACCCAGCTGG - Intergenic
1011759255 6:90542846-90542868 AAGACTGCCTGGTACACATCAGG + Intronic
1013289404 6:108707775-108707797 TAGGCTGCCTGGGGCTCACTGGG + Intergenic
1015602678 6:134925934-134925956 GAGGGTGCCTGGTATTTTCCAGG + Intronic
1016348387 6:143140858-143140880 TAGGATGTCTGGTACTCCCCTGG - Intronic
1017722694 6:157255075-157255097 GAGGCTGCTTGCTGATCACCAGG + Intergenic
1017755534 6:157526118-157526140 GAGCCAGTCTTGTACTCACCTGG - Intronic
1018207147 6:161446282-161446304 GAGGCTGCCTGGGGCTGAGCAGG + Intronic
1024594761 7:50922729-50922751 GTGGCTACCTGGATCTCACCTGG + Intergenic
1025854145 7:65263743-65263765 GAGGCTGCCAGTCAGTCACCAGG - Intergenic
1026860852 7:73787544-73787566 GAGCCTGCCTGGGACACACCAGG - Intergenic
1029123016 7:98281263-98281285 GGGGCGGCCTGGGACCCACCCGG + Intronic
1029261068 7:99303235-99303257 CAGGCAGCCTGGTCCTCAGCAGG - Intergenic
1029421309 7:100473054-100473076 CAGGCTGCCTGCTTCTCCCCGGG - Intronic
1031560640 7:123233882-123233904 CAGGCTTCCTGGTCCACACCAGG - Intergenic
1032845595 7:135749064-135749086 GAGCCTGCCTGGCAGACACCAGG + Intergenic
1032854943 7:135826195-135826217 GAGGGTGCCTGGTACATAGCAGG - Intergenic
1034150697 7:148912994-148913016 GGGCCTGCCTGGTCCTCAACCGG + Intergenic
1036498754 8:9294576-9294598 GAGGCTGCCATGGACTCACCTGG + Intergenic
1040287904 8:46109824-46109846 GAGCCTGCCTGGGACAGACCTGG + Intergenic
1041200904 8:55451474-55451496 GAGTCTGCCTGGAACTGGCCTGG + Intronic
1042310575 8:67375138-67375160 GATGGTGCCTGGTACTCTGCAGG + Intergenic
1045506890 8:102785119-102785141 GATGCTGCCAGGGAGTCACCAGG + Intergenic
1048024557 8:130573727-130573749 GTGGTCACCTGGTACTCACCAGG - Intergenic
1049096347 8:140550488-140550510 TAGAGGGCCTGGTACTCACCTGG + Intronic
1049396990 8:142405450-142405472 GGGGTTGCCTGGTCCTCAGCTGG + Intergenic
1057276986 9:93681212-93681234 CAGGCTGCCTGGCACTCAGTGGG - Intergenic
1058795545 9:108494892-108494914 GAGGCTGTCTGGTACCAAGCAGG + Intergenic
1060423791 9:123488049-123488071 GAGGCTGCCCCGTACCCAGCAGG - Intronic
1062031693 9:134364798-134364820 AGGGCTGCCTGGGACTCAGCTGG + Intronic
1062324395 9:136005233-136005255 GAGGGGGCCTGGGACCCACCTGG + Intergenic
1185726399 X:2425535-2425557 GAGCCTGCCAGGGACTCACAGGG - Intronic
1187895127 X:23973535-23973557 GGAGCTGCCTGGGCCTCACCTGG + Intergenic
1187913851 X:24134812-24134834 GGAGCTGCCTGGGCCTCACCTGG + Intergenic
1189325153 X:40107259-40107281 GAGGCTGGATCGTACTCTCCTGG + Intronic
1190119318 X:47647543-47647565 AAGAGTGCCTGGTACTCACAAGG + Intronic
1192209959 X:69121706-69121728 GAGGCTGAGGGGTGCTCACCTGG + Intergenic
1199508138 X:148589444-148589466 GTGCCTGCCTGGAAATCACCTGG + Intronic