ID: 1163398175

View in Genome Browser
Species Human (GRCh38)
Location 19:17076081-17076103
Sequence GTGAGGGAGTTCGAGGGCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163398175 Original CRISPR GTGAGGGAGTTCGAGGGCGT GGG Intronic
900103810 1:973863-973885 GGGAGTGGGCTCGAGGGCGTGGG - Exonic
902404532 1:16175533-16175555 GTGAGGGGGTGGGAGGGGGTGGG + Intergenic
903141492 1:21341923-21341945 GTGAGGGAGTCCGGGGGCAGTGG - Intronic
905734876 1:40317818-40317840 GTGAGGAAGTTCGGGGGTGGGGG - Intergenic
905866000 1:41377143-41377165 GTGAGTGAGATGGAGGGTGTCGG + Intronic
906208673 1:44000402-44000424 GGGAGGGTGTTCCAGGGCCTTGG - Intronic
906465046 1:46071091-46071113 GTGAGGGAGAAGGAGGGCCTGGG - Intronic
907971927 1:59391349-59391371 GTGGGGGAGTCGGAGGGAGTAGG + Intronic
910087613 1:83421836-83421858 GAGAGGGATTTCAAGGGCTTGGG + Intergenic
910451541 1:87351622-87351644 GTGAGGGAGTTTAAGGGGCTGGG + Intergenic
916897008 1:169174841-169174863 GTGAGTGAGTGTGAGGGCCTAGG + Intronic
924743821 1:246814124-246814146 GGGAGTGAGGTCCAGGGCGTTGG + Intergenic
1066660730 10:37736606-37736628 GGGAGAGAGTTCGAGGGGGAGGG + Intergenic
1067103806 10:43351558-43351580 GTGAGGGAGGCCCTGGGCGTGGG - Intergenic
1073944067 10:108730262-108730284 GGGAGGGAGTTGGAGGGAGGTGG + Intergenic
1075344192 10:121670333-121670355 TTGAGGTGGTTCGAGGGTGTGGG + Intergenic
1075700352 10:124465257-124465279 CTTGGCGAGTTCGAGGGCGTGGG + Intronic
1081298508 11:41421868-41421890 AGGAAGGAGTTCGAGGGTGTAGG + Intronic
1082018986 11:47515263-47515285 GTGAGGGAGGTGGAGGGAGTGGG + Intronic
1091280310 11:134378023-134378045 GTGAGGGATGTGGTGGGCGTGGG - Intronic
1091628874 12:2143345-2143367 GTGAGTGAATTTGAGGGCCTAGG - Intronic
1091848797 12:3678646-3678668 GTGAGGAAGGTAGAGGGGGTGGG + Intronic
1098571128 12:71988498-71988520 GAGAGAGAGTTGGAGGGTGTGGG + Intronic
1102825958 12:115948176-115948198 GTGAGGGAGTGCCAGGGGCTGGG + Intergenic
1103252726 12:119514772-119514794 GTGAGTGAATTCGAAGGCCTAGG - Intronic
1105937934 13:25119102-25119124 CTGAGCGAGCTCGTGGGCGTCGG - Intergenic
1108453709 13:50592021-50592043 GTGAGTGATTTTGAGGGCTTAGG + Intronic
1113593931 13:111518266-111518288 GTGAGGGAGCTGGAGGGGGAAGG - Intergenic
1113656899 13:112073027-112073049 GTGCGGGAGTCAGAGGGCGGTGG - Intergenic
1114664145 14:24368537-24368559 GTGAGGGAGTCAGAGGTCGAAGG + Intronic
1115946279 14:38665083-38665105 GTATGGCAGTTCGAGGGCATGGG - Intergenic
1116266930 14:42704148-42704170 GTGAGGGAGGTCAAGTGGGTAGG + Intergenic
1123054571 14:105563006-105563028 GTGAGGGTGTATGAGGGTGTGGG + Intergenic
1123054769 14:105564096-105564118 GTGAGGGTGTGTGAGGGAGTGGG + Intergenic
1123079202 14:105683629-105683651 GTGAGGGTGTGTGAGGGAGTGGG + Intergenic
1128005574 15:64237123-64237145 GTGAGGGAGTGGGAGGGGGAAGG + Intronic
1130530318 15:84742460-84742482 GTCAGTGATTTTGAGGGCGTGGG + Intergenic
1132356420 15:101174424-101174446 GAGAGGGCGCTCGAGGGAGTAGG + Intergenic
1136597767 16:31263484-31263506 GTGAGGGAGTATGAGGAAGTAGG - Intronic
1136670262 16:31850423-31850445 GTGAGAGCCTGCGAGGGCGTGGG + Intergenic
1137381799 16:48006272-48006294 GAGAGGGAGTTGGAGGCAGTTGG + Intergenic
1142148310 16:88501812-88501834 GTGATGGAGGTAGTGGGCGTGGG + Intronic
1142877775 17:2862515-2862537 GGCAGGGAGTTGGGGGGCGTGGG - Intronic
1143616436 17:8053745-8053767 GTGAGGGAATGTGAGGGCCTAGG + Intergenic
1144539511 17:16125889-16125911 GTGAGAGGGTGCGAGGGGGTGGG + Intronic
1147374496 17:40015801-40015823 GTGAGGAAGATCCAGGGCGATGG + Exonic
1151980275 17:77504406-77504428 GAGAGGGAGTAGGAGGGCGATGG - Intergenic
1161978170 19:7617513-7617535 GTGAGGCAGTGGGAGGGGGTGGG - Intronic
1163398175 19:17076081-17076103 GTGAGGGAGTTCGAGGGCGTGGG + Intronic
1163666292 19:18605612-18605634 GTGCGCGAGTTTGAGGGCGAGGG + Intronic
925373070 2:3361744-3361766 GTGAGGGAGTCCAAGGGCTTGGG - Intronic
925373084 2:3361793-3361815 GTGAGGGAGTCCAAGGGCTTGGG - Intronic
925373098 2:3361842-3361864 GTGAGGGAGTCCAAGGGCTTGGG - Intronic
931285811 2:60830712-60830734 GGGAGGGAGTAAGAGGGCTTAGG + Intergenic
933647031 2:84821299-84821321 GTGGGGGGGTTGGGGGGCGTGGG - Intergenic
936662681 2:114559667-114559689 GAGAGGGAGTTCTAGAGTGTGGG + Intronic
937168632 2:119844152-119844174 GGGAGGGAGGTGGGGGGCGTCGG - Intronic
937286692 2:120758492-120758514 GTGAGGGAGTGCTGGGGCCTAGG + Intronic
937315300 2:120928239-120928261 GTGAGGGGGCTGGAGGGTGTGGG - Intronic
937858580 2:126690634-126690656 GTGAGGGAGGTTGAGGGTGGAGG + Intronic
938776288 2:134544297-134544319 GTGCTGGAGATGGAGGGCGTGGG - Intronic
942493478 2:176513278-176513300 GTGAGGGACTACGAGGGCCTAGG + Intergenic
946045724 2:216819389-216819411 GTGAGGCAGTTAGAGGAGGTGGG + Intergenic
947817731 2:233049150-233049172 GTGAGGGAGTTGAGGGGCATGGG + Intergenic
948815336 2:240507508-240507530 GTGAGGGGGTTTGAGGGTGGTGG - Intronic
1174276704 20:49409371-49409393 GGGAGGGAGTTAGTGGGCGATGG + Intronic
1180992099 22:19942793-19942815 GTGAGGGAGTGGGAAGGGGTGGG + Intronic
1184357887 22:43994671-43994693 GTGAGGGAGGGAGAGAGCGTGGG + Intronic
956825930 3:72996939-72996961 GCGAGGGAGGGGGAGGGCGTCGG + Exonic
960641335 3:119826562-119826584 TTGAGGGAGATCCAGGGGGTGGG - Intronic
962470064 3:135698931-135698953 TTGAGGGAGTTCTAGGGCACTGG - Intergenic
968050511 3:195651714-195651736 GCGAGGGAGTGGGAGGACGTCGG - Intergenic
968096811 3:195937145-195937167 GCGAGGGAGTGGGAGGACGTCGG + Intergenic
968105314 3:195996640-195996662 GCGAGGGAGTGGGAGGACGTCGG + Intergenic
968285240 3:197504750-197504772 GGGAGGGAATTGGAGGGCCTCGG + Intergenic
968775052 4:2535717-2535739 GTGCGTGAGTGCGAGGGTGTGGG + Intronic
972420024 4:38878302-38878324 GAGAGGGGGCTCCAGGGCGTTGG - Exonic
985507257 5:290397-290419 GCGAGGGAGTGGGAGGACGTCGG - Intronic
985740717 5:1614738-1614760 GCGAGGGAGTGGGAGGACGTCGG + Intergenic
988577898 5:32444473-32444495 GTGAGGGAGTGCGAGGCGGGAGG - Intronic
996444993 5:123537428-123537450 GTGAGGGGGTGGGAGGGAGTGGG + Intronic
998077226 5:139246594-139246616 GTGAGGGAGGTGGCGGGGGTGGG - Intronic
1000742552 5:164987503-164987525 GTGAGCGAGTACCAGGGCCTGGG - Intergenic
1002087377 5:176784681-176784703 GGGAGGGAGTTGGGGGGCGCTGG + Intergenic
1004370679 6:15049554-15049576 GTTAGGCTGTTCGAGGGGGTAGG + Intergenic
1009487965 6:64249382-64249404 GTGAGGAAGTTGGAGGGGGGTGG + Intronic
1009837818 6:69026928-69026950 GTGAGTGAGTGTGAGGGTGTAGG + Intronic
1015426158 6:133070233-133070255 GATAGGAAGTTCGAGGGCTTGGG - Intergenic
1018826781 6:167414004-167414026 GTGAGTGAGTACGAGGGCCTCGG - Intergenic
1019293029 7:259635-259657 GAGAGGGAGATCGAGAGAGTGGG - Intronic
1027264116 7:76484556-76484578 GTGAGGGAGTGGGTGGGCCTGGG + Intronic
1027304492 7:76878315-76878337 GAGAGGGATTTCAAGGGCTTGGG + Intergenic
1027315485 7:76982670-76982692 GTGAGGGAGTGGGTGGGCCTGGG + Intergenic
1029737016 7:102470566-102470588 GTGAGGGAGTCAGCGGGCGGAGG + Intronic
1036259649 8:7229453-7229475 GTCAGGGAGTACGGGGGCCTAGG - Intergenic
1036311692 8:7688023-7688045 GTCAGGGAGTACGGGGGCCTAGG - Intergenic
1037248414 8:16863689-16863711 GTGAGTGAATTCGAAGGCCTAGG - Intergenic
1045305314 8:100952383-100952405 GAGAGGGAGAGAGAGGGCGTTGG - Intronic
1049284932 8:141769444-141769466 GTGAGGGTGTGCAAGGGTGTGGG + Intergenic
1049416540 8:142498041-142498063 GTGGGGGAGTAAGAGGGCCTGGG - Intronic
1051091982 9:13420545-13420567 CTGAGGGAGTTTGTGGGCATTGG - Intergenic
1051361063 9:16282105-16282127 GTGAGTGAGTTGGTGGGTGTAGG - Intergenic
1051488123 9:17630795-17630817 GTGGGGGAGTTGGAGGTAGTAGG + Intronic
1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG + Intergenic
1054258360 9:62838039-62838061 CTGAGGGAGATCGGGGCCGTTGG + Intergenic
1054333409 9:63782002-63782024 CTGAGGGAGATCGGGGCCGTTGG - Intergenic
1056766535 9:89447706-89447728 GTGGGGGAGTTTGAGGGGTTGGG - Intronic
1057582337 9:96298595-96298617 GTGAGGGGCTTCAAGGGCGTGGG - Intronic
1057793559 9:98140102-98140124 ATGTGGGAGGTCGAGGGCCTGGG - Intronic
1061900283 9:133668978-133669000 GTGAGGGAGATGGAGGGTGAGGG - Intronic
1061900355 9:133669188-133669210 GTGAGGGAGATGGAGGGTGAGGG - Intronic
1062619178 9:137411741-137411763 GTGGGGGAGTGGGAGGGAGTCGG + Intronic
1202800414 9_KI270719v1_random:170336-170358 CTGAGGGAGATCGGGGCCGTTGG - Intergenic
1185803950 X:3039969-3039991 GTGAGGAACTTCCAGGTCGTAGG - Intergenic
1187403818 X:18984672-18984694 GTGAGGTCGTTCCAGGGCGCGGG - Intergenic
1188118816 X:26279279-26279301 GTGAAGTAGTTCAAGGGAGTGGG - Intergenic
1199773491 X:150990586-150990608 GTGAGGTGGTTAGAGGGAGTAGG - Exonic
1201073322 Y:10169420-10169442 GTGAGGGAGTTGTAGAGCGAGGG - Intergenic