ID: 1163398273

View in Genome Browser
Species Human (GRCh38)
Location 19:17076473-17076495
Sequence AACTGAGGGTAGGCTTAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163398273 Original CRISPR AACTGAGGGTAGGCTTAGGG AGG Intronic
900254096 1:1688052-1688074 AACTCAGGGTTGGCCGAGGGAGG + Intronic
905025438 1:34846378-34846400 AGCTGAGGGTTGACTAAGGGTGG - Intronic
905781678 1:40716302-40716324 AACTGGGTGTAGACTCAGGGAGG + Intronic
908115333 1:60934835-60934857 AGCTGTGGGAAGGCTTAGGCAGG + Intronic
908299259 1:62745989-62746011 AACTGAGGGAAGGATTAGACAGG + Intergenic
909555450 1:76948813-76948835 AAATGAGGATAAGCTTAGTGAGG - Intronic
910395822 1:86792878-86792900 AGCTGAGGGAAGCTTTAGGGTGG + Intergenic
912467780 1:109885977-109885999 CCCTCAGGGTAGGCTCAGGGGGG - Intergenic
913080441 1:115380162-115380184 ACCTGAGGGTAGTCCTAGGAAGG - Intergenic
914853321 1:151331198-151331220 ACCTGTGGGAAGGCTTAGGCAGG + Intergenic
916831917 1:168502223-168502245 AAATGAGGGTAGTCTTGTGGGGG - Intergenic
919432509 1:197513897-197513919 AACTGAGGGTAAGCTTCCAGAGG - Intronic
920039554 1:203086414-203086436 AAGGAAGGGTAGGCTTAGGCTGG + Intergenic
920301595 1:204992310-204992332 ATCTGAGGGTTGGCTTATGAAGG + Intronic
921202495 1:212820980-212821002 AACTGAGGGAAGTATTAGGGAGG + Intergenic
922991328 1:229914823-229914845 CACTGAGGGTGGGCAAAGGGTGG - Intergenic
1063421343 10:5915051-5915073 ATAGGAGGGTAGGGTTAGGGAGG - Intronic
1063780357 10:9315562-9315584 GAGTGGGGGTAGGTTTAGGGAGG - Intergenic
1065326625 10:24555359-24555381 AACTGAGGAAGGGCTGAGGGTGG - Intergenic
1065682904 10:28255355-28255377 CACTTTGGGTAGGCTGAGGGTGG - Intronic
1069964592 10:72103791-72103813 AACTGAGGGGAGGCTTAGCAAGG - Intronic
1070168192 10:73913506-73913528 AACAGAGGGATGTCTTAGGGAGG - Intronic
1072661691 10:97367229-97367251 AGCTGAGGGGAGGGTTAGCGCGG + Intronic
1074763298 10:116683515-116683537 ATCTGAGGGTAGCCTGAGAGCGG - Intronic
1075966405 10:126615606-126615628 AACTGAAAGAAAGCTTAGGGGGG - Intronic
1078659398 11:13275011-13275033 CACTGAGGGTAGGATAAGGCAGG + Intergenic
1079675577 11:23222325-23222347 AGTTGAGGGGAGGCTCAGGGAGG + Intergenic
1083021633 11:59513411-59513433 AACTGAAGGGAGCCTAAGGGAGG - Intergenic
1083185056 11:61012701-61012723 AGCAGAGGGGAGGCTGAGGGAGG + Intronic
1083545423 11:63545692-63545714 AGCTGAGGGGAGACTTAGGGAGG - Intronic
1084377211 11:68785637-68785659 TACTGAGGAGAGGCTTAGGGAGG - Intronic
1086504947 11:87495165-87495187 AACTGGTGCTAGGCTTAGGTAGG - Intergenic
1086833225 11:91592212-91592234 AACTGGGGGTGGGGTTGGGGGGG + Intergenic
1090351760 11:126112452-126112474 GACTAAGGGGAGGCTTAGGGTGG + Intergenic
1091694948 12:2622193-2622215 AACTGAGGACAGGCAGAGGGAGG + Intronic
1094157077 12:27348344-27348366 TACTTTGGGGAGGCTTAGGGAGG + Intronic
1104361559 12:128137940-128137962 AACAGTGGGAAAGCTTAGGGTGG - Intergenic
1107614112 13:42146820-42146842 AGCTGGGGGCAGGCTTAGGAGGG + Intronic
1107984230 13:45761144-45761166 ATCTGAGGCTAGGCATAGAGAGG + Intergenic
1108844392 13:54660134-54660156 GACTGAGGGAGGGCTGAGGGTGG - Intergenic
1108856781 13:54802505-54802527 AAATGAGGGTTGGGGTAGGGAGG + Intergenic
1112627384 13:101121099-101121121 AACTGAGGGTCAGATTAGTGAGG + Intronic
1112714971 13:102173811-102173833 AGCTGAGGGTAGGGGTAGGGGGG + Intronic
1114551984 14:23537974-23537996 AGCAGCTGGTAGGCTTAGGGAGG - Intronic
1115908812 14:38232357-38232379 AACTGAGGCTAGGGTTTTGGAGG + Intergenic
1119739677 14:77006241-77006263 AGCTGGTGGAAGGCTTAGGGAGG - Intergenic
1119880031 14:78092533-78092555 AGATGGGGGTAGGCCTAGGGAGG - Intergenic
1120976076 14:90249282-90249304 ACCTGAGGGGAGGCTGAGGCAGG - Intergenic
1122367267 14:101201538-101201560 AACTGAGAGGAGGCATGGGGAGG + Intergenic
1128682452 15:69661837-69661859 AACTGATGATAGGATGAGGGTGG + Intergenic
1128713092 15:69886605-69886627 AGCTGAGGGTAGGCATAGAGTGG - Intergenic
1128798872 15:70484411-70484433 ATCTGAGGTTGGGCTCAGGGTGG - Intergenic
1129253411 15:74320723-74320745 CACAGAGGGCAGGGTTAGGGAGG - Intronic
1131198230 15:90374198-90374220 AACTGACTGGAGTCTTAGGGAGG + Intergenic
1133494096 16:6299687-6299709 AACTGAGTTTAGGCTTTGGCAGG - Intronic
1137630670 16:49941562-49941584 AAGTGAGGGGAGGCTGAGGCAGG + Intergenic
1139655091 16:68382632-68382654 AACTGAGAGTGGACTCAGGGAGG + Intronic
1142223113 16:88864939-88864961 AACTGAGGGGAGGGGCAGGGAGG + Exonic
1143301616 17:5914798-5914820 AACACAGGGGAGGCTTTGGGGGG + Intronic
1144070182 17:11664477-11664499 AAGTGAGGGTAGGCAGAGGAAGG - Intronic
1144310218 17:14006931-14006953 CACTGAGGCAAGGCATAGGGAGG + Intergenic
1147008716 17:37426083-37426105 TACTCAGGGCAGGCTGAGGGAGG - Intronic
1149577918 17:57727117-57727139 AATGGAGGGTAGGATGAGGGAGG + Intergenic
1150201568 17:63362562-63362584 GGCTGAGGGTAGGCTGAGGGTGG - Intronic
1151347396 17:73510412-73510434 ACCTGAGGGTGGCCTCAGGGTGG + Intronic
1151436525 17:74100924-74100946 AACTGAGGATGGGTTTAGTGAGG - Intergenic
1152856651 17:82668493-82668515 AGCTGAGGGAGGGCTGAGGGTGG - Intronic
1153533100 18:6069530-6069552 AAGTGAGGGCAGGGTTAGGCGGG + Intronic
1153845142 18:9042843-9042865 AAGGGAAGGTAGGCTTAGTGAGG - Intergenic
1155329841 18:24703919-24703941 ACCTGAGGGGAGACTGAGGGAGG + Intergenic
1157356637 18:46941212-46941234 TACTGGGGGTAGGGGTAGGGGGG + Intronic
1160008724 18:75088197-75088219 AACTGGGGGTGGGCTGAAGGTGG - Intergenic
1161816526 19:6502663-6502685 AACTGAGGCAAGGCCTGGGGCGG - Intronic
1163398273 19:17076473-17076495 AACTGAGGGTAGGCTTAGGGAGG + Intronic
1163448594 19:17362215-17362237 AACTGAGGGTGGGTTTAGGATGG - Intronic
1163465869 19:17468478-17468500 AACTGAGGGCAGGCTGGGCGTGG - Intergenic
1163797750 19:19347022-19347044 TTCTGAGGGTAGGATTGGGGTGG + Intronic
1164863582 19:31583391-31583413 AACTGATGGTATTCTTTGGGAGG + Intergenic
1164961975 19:32440901-32440923 AAGTGAGGGTAGAATTTGGGTGG + Intronic
1167248968 19:48390858-48390880 ACCTGAGGTGAGGCCTAGGGAGG + Intronic
925870121 2:8263054-8263076 AATTGAGGGTAGGTTTGGGGTGG - Intergenic
927188519 2:20499844-20499866 AACTGAGGGGAGGCTGAGCAAGG + Intergenic
936503661 2:113087022-113087044 AACTGAGAGGAGTCTAAGGGTGG + Intergenic
942606341 2:177695624-177695646 AACTGAGGAGAGGCACAGGGTGG - Intronic
943759644 2:191593785-191593807 AACTCAGGGTGGACTCAGGGTGG + Intergenic
944028222 2:195198287-195198309 AACTGAAGGTGGGATTGGGGAGG - Intergenic
945268081 2:207910988-207911010 AACTGAGGGCAGGCTTCCAGGGG + Intronic
945925987 2:215805083-215805105 AATTCAGGGTAGTGTTAGGGAGG - Intergenic
946650089 2:221883975-221883997 AACTGGTGGTGGGCTTGGGGCGG - Intergenic
946858029 2:223972661-223972683 TACTGAGAGTCGGCTTTGGGAGG - Intergenic
1168908062 20:1422798-1422820 AGCAGAGGGAAGGCTTAGGCAGG - Intergenic
1170383271 20:15785529-15785551 AAAAGAGGGTAAGTTTAGGGAGG + Intronic
1170819217 20:19742032-19742054 GCCTGAGGGTAGGCTTAGCTAGG - Intergenic
1170990143 20:21293715-21293737 ACCTGAGGCTAGGGCTAGGGAGG + Intergenic
1171723079 20:28585133-28585155 AACAAAGAGTAGGATTAGGGAGG + Intergenic
1171787680 20:29484574-29484596 AACAAAGAGTAGGATTAGGGAGG + Intergenic
1171860273 20:30394805-30394827 AACAAAGAGTAGGATTAGGGAGG - Intronic
1180296634 22:10943804-10943826 AACAAAGAGTAGGATTAGGGAGG + Intergenic
1181976216 22:26732179-26732201 AACTCAGGGAAGGCTCAGGGAGG + Intergenic
949888456 3:8714388-8714410 GACTGAGGGTGGGCTGAGGGAGG - Intronic
952655387 3:35779561-35779583 AAATGAATGTAGGCTTAGTGAGG + Intronic
953431771 3:42845979-42846001 AACTGGGTGGAGGCTGAGGGTGG + Intronic
954129146 3:48550933-48550955 AACTGTGGGCAGGATCAGGGAGG + Intronic
955084514 3:55689679-55689701 AAATGAGGGGAGGCTGAGGCAGG + Intronic
955317176 3:57948600-57948622 AACAGAGGGAGAGCTTAGGGAGG - Intergenic
956003946 3:64759469-64759491 AACTGTGTGCAGGCTTAGAGAGG - Intergenic
964468978 3:157031370-157031392 AATTAAGGGTATACTTAGGGGGG + Intronic
969110615 4:4841823-4841845 AAAGGAGGGTAGGCTGAGGTGGG + Intergenic
971296582 4:25398910-25398932 ATGTGAGGGCAGGTTTAGGGAGG + Intronic
972647041 4:40978678-40978700 AACTGAGGATAGGGATAGGAAGG - Intronic
975892955 4:79050811-79050833 AACTGAGTGTAGGCTCAGAGAGG - Intergenic
977036769 4:91963214-91963236 ATCTAAAGGTAGGCTGAGGGAGG + Intergenic
977475779 4:97507556-97507578 AAATGAGGGCAGTCTTATGGAGG - Intronic
978462025 4:108966601-108966623 CACTCAGGGTAGGCTGAGGTAGG + Intronic
979577679 4:122314643-122314665 CACTAAGGCTAGGCTTGGGGAGG - Intronic
983512432 4:168622942-168622964 CACTGAGGGTTTACTTAGGGAGG - Intronic
984573724 4:181423355-181423377 AAGTGAGGGGAGGCTGAGGTAGG + Intergenic
984765253 4:183395574-183395596 AACTGAAGATAAGCTTCGGGGGG + Intergenic
990188535 5:53232625-53232647 AACTGAGGGCTGGCCAAGGGTGG - Intergenic
1003458718 6:6309315-6309337 AACTGAGGGGAGTATCAGGGAGG + Intronic
1003529994 6:6929199-6929221 AACTTGGGGGAGGCTGAGGGTGG - Intergenic
1004091621 6:12508659-12508681 AACTGAAGGTAAGATTTGGGTGG - Intergenic
1005531633 6:26712964-26712986 AACCTAGGGTAGGTATAGGGTGG - Intergenic
1005539162 6:26788701-26788723 AACCTAGGGTAGGTATAGGGTGG + Intergenic
1005821542 6:29603526-29603548 AAGTGAGGGTAGGGTGAGGGAGG - Exonic
1009009996 6:57830927-57830949 AACCTAGGGTAGGTATAGGGTGG + Intergenic
1011354942 6:86464423-86464445 AACTGACGGTAAGATTTGGGTGG - Intergenic
1013978518 6:116103004-116103026 AACTGAAGGTGGGCTTAGAATGG - Intronic
1014597434 6:123362146-123362168 AACTGATGATAAGCTTTGGGAGG - Intronic
1016389034 6:143556996-143557018 AACTGAGGCTGGGGTTAGGGAGG - Intronic
1017394711 6:153984393-153984415 AACTGATGGGAGGCTGAGGCAGG + Intergenic
1023227116 7:37982390-37982412 AACTGTGGGAAGGATTTGGGTGG + Intronic
1023530804 7:41151709-41151731 AACTGAGGGGAATATTAGGGTGG + Intergenic
1023982995 7:45080466-45080488 AGCTGAGGGAAGGCGTAGGATGG + Exonic
1026079256 7:67202682-67202704 AATTGAGGCTGGGCTTACGGTGG - Intronic
1027226500 7:76247208-76247230 AACTGAGACTGGGCTTAGGGTGG + Intronic
1030547136 7:110910047-110910069 GCCTAAGGTTAGGCTTAGGGAGG + Intronic
1032189046 7:129752352-129752374 AACTGAGAGTAGTCTGGGGGTGG + Intronic
1032519955 7:132536396-132536418 AGGTGGAGGTAGGCTTAGGGAGG - Intronic
1033928829 7:146498345-146498367 AAATTAGGGCAGGCTTATGGTGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034154137 7:148940789-148940811 AAAAGAGGGTAGACTTATGGGGG + Intergenic
1037804507 8:22051546-22051568 AGCTGAGGGCAGGCCGAGGGGGG - Intronic
1037926094 8:22845211-22845233 GAGTGAGGGTGGGGTTAGGGAGG + Intronic
1038459466 8:27703604-27703626 AACTGAGACTAGGGTTGGGGGGG + Intergenic
1041150050 8:54922743-54922765 TGCTGGGGGTAGGCTGAGGGAGG + Intergenic
1041886923 8:62820469-62820491 AACTTAGAGTAGGCTTGGGGAGG + Intronic
1044331542 8:90926006-90926028 AACTTAGGATAGGCTTAGGGAGG - Intronic
1044951437 8:97439185-97439207 AAGTGAGAGTAGTCTTACGGAGG + Intergenic
1048521331 8:135158177-135158199 AAGTGAGTGTAGGCCCAGGGTGG - Intergenic
1050555099 9:6783000-6783022 AAGAGAGGGTAGGCTTGGGAAGG + Intronic
1051591215 9:18777847-18777869 AGCTGATGGTAGGCCTTGGGTGG - Exonic
1051815015 9:21095045-21095067 AACTGAGGGGGGACTTAGGAAGG - Intergenic
1053180388 9:35962982-35963004 ACCTGAGGGAAAGCTCAGGGGGG - Intergenic
1053747456 9:41213965-41213987 AACAAAGAGTAGGATTAGGGAGG - Intergenic
1054338926 9:63836557-63836579 AACAAAGAGTAGGATTAGGGAGG + Intergenic
1054479830 9:65651403-65651425 AACAAAGAGTAGGGTTAGGGAGG + Intergenic
1057758721 9:97855802-97855824 AACAGCGGCTAGGCTTTGGGTGG - Exonic
1058208691 9:102139820-102139842 ATCTGAGGTTTGGCTTGGGGAGG + Intergenic
1058339918 9:103882133-103882155 TACTGAGGGTTGGGTTGGGGTGG - Intergenic
1058510717 9:105713553-105713575 AACTGAGGGGTGGCTGAGGGTGG + Intronic
1059866331 9:118518650-118518672 AAGAGAGGGTAGGGGTAGGGTGG - Intergenic
1060657925 9:125385529-125385551 AACTGAGGGTAGGCTGGGTGCGG - Intergenic
1202783588 9_KI270718v1_random:24736-24758 AACAAAGAGTAGGGTTAGGGAGG - Intergenic
1202803499 9_KI270720v1_random:24943-24965 AACAAAGAGTAGGATTAGGGAGG + Intergenic
1203448284 Un_GL000219v1:82052-82074 AACAAAGAGTAGGATTAGGGAGG + Intergenic
1186261201 X:7781766-7781788 ATGTGAGGGTAGGCTGAGGCAGG - Intergenic
1186323063 X:8451600-8451622 AGCTGAGGGCAGTCTTGGGGAGG + Intergenic
1187885553 X:23885742-23885764 GTATCAGGGTAGGCTTAGGGAGG - Intronic
1187935734 X:24334196-24334218 AACTGAGGGTAGTCTTGTTGGGG - Intergenic
1188473324 X:30564045-30564067 AACTTAGGGTAGGGTGAAGGAGG + Intronic
1192196751 X:69033851-69033873 AGCTGAGGGTAGGAACAGGGTGG + Intergenic