ID: 1163398526

View in Genome Browser
Species Human (GRCh38)
Location 19:17077759-17077781
Sequence TCGCAGCCAGGAATGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 221}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163398526 Original CRISPR TCGCAGCCAGGAATGGAGAG TGG (reversed) Intronic
900634026 1:3652950-3652972 TCGGAGCCCGGGGTGGAGAGGGG - Intronic
901500356 1:9649182-9649204 TTCCAGCCAGGAAAGGGGAGAGG - Intergenic
901641927 1:10696984-10697006 TGGCAGCCAGCAATGGAGGGAGG + Intronic
902277979 1:15353071-15353093 CCCCAGCCAGGGATGGGGAGAGG - Intronic
902310583 1:15578772-15578794 TGGCAGCCAGGGATTGAGCGGGG - Intronic
902549412 1:17210507-17210529 GCCCAGCCAGGAATGGAGGCTGG - Intronic
902799055 1:18818244-18818266 ACGCAGGCAGGAAGGGAGGGAGG + Intergenic
905801160 1:40843855-40843877 TCCCAGACAGCAACGGAGAGAGG + Intergenic
906682486 1:47738846-47738868 TGGGAGCGAGGAAGGGAGAGAGG + Intergenic
910852422 1:91661802-91661824 TGGTAACAAGGAATGGAGAGGGG + Intergenic
914880358 1:151541660-151541682 GCCCAGGCAGAAATGGAGAGGGG - Intronic
917356972 1:174135825-174135847 TAGCAACCAGGAATGAAGGGTGG + Intergenic
917698982 1:177561034-177561056 ACGAAGCCAGGAATAGAGATGGG + Intergenic
919117917 1:193304550-193304572 TGGCAGACAGGACTGAAGAGGGG - Intergenic
920736229 1:208535294-208535316 TAGAAGTAAGGAATGGAGAGTGG + Intergenic
921217856 1:212951942-212951964 TGGCAGGAAGGAATGGGGAGAGG - Intronic
921383808 1:214550883-214550905 ACGCAGAAGGGAATGGAGAGAGG + Intronic
922064141 1:222120255-222120277 TTGGGGCCAGGCATGGAGAGAGG + Intergenic
923671156 1:236042401-236042423 CTGCAGCTAGGACTGGAGAGTGG + Intronic
1063101381 10:2952887-2952909 ACGCATCCCGGAAGGGAGAGGGG + Intergenic
1067046454 10:42988079-42988101 GCCCAGCCATAAATGGAGAGAGG - Intergenic
1067982060 10:51097790-51097812 CCGCAGGCAGGAATGGACAGAGG + Intronic
1068209083 10:53897015-53897037 TCACAGACAGGAGTGCAGAGGGG - Intronic
1069607890 10:69751573-69751595 CTGCAGGCAGGAAGGGAGAGGGG + Intergenic
1069676878 10:70254964-70254986 TCCCAGGCTGGAATGGTGAGGGG + Exonic
1069842314 10:71347515-71347537 TTCCACCCAGGAAGGGAGAGTGG - Intronic
1070776675 10:79113793-79113815 TAGGAGCCATCAATGGAGAGGGG - Intronic
1071156015 10:82690431-82690453 ATGCAGGCAGGAGTGGAGAGTGG + Intronic
1072721274 10:97782395-97782417 CCCCAGCCAGGAGAGGAGAGGGG + Intergenic
1073456478 10:103639869-103639891 TGGCAGTCAGGGAAGGAGAGTGG + Intronic
1073519305 10:104111675-104111697 TTGAAGCCAGGGATGGAGATAGG - Intergenic
1074301907 10:112240733-112240755 TGGGAGCCAGGAGTGGAGAGAGG + Intergenic
1074535592 10:114326282-114326304 TTGCCCCCAGGAATGGGGAGGGG - Intronic
1075682800 10:124344335-124344357 TCACAGCCAGCAACGGTGAGTGG + Intergenic
1076288023 10:129320437-129320459 TGGCTGCCAGGAATGGGGATGGG - Intergenic
1076435067 10:130434967-130434989 TCACAGTCAGGAACGGAGAGGGG - Intergenic
1076608788 10:131707409-131707431 TGGCAGACAGGAATGCAGAGAGG + Intergenic
1077005926 11:356085-356107 GCGCGGCCAGGAATGGATGGGGG + Intergenic
1077231033 11:1458308-1458330 TCCGGGGCAGGAATGGAGAGGGG - Intronic
1077472086 11:2768828-2768850 CCGCAGCCTGCAGTGGAGAGAGG - Exonic
1079851287 11:25538787-25538809 TTGCAACCAGGAAAGGATAGAGG - Intergenic
1083395572 11:62389326-62389348 ACGCAGCAAGAAACGGAGAGGGG - Intronic
1084674815 11:70628214-70628236 TCTCAGCCAGGCATGGTGGGAGG - Intronic
1085941545 11:81211617-81211639 TAGCAGCCAGGAAGGGAGGTAGG + Intergenic
1086916353 11:92534089-92534111 TGGCATCCAAGAATGGAGAGAGG - Intronic
1088755830 11:112884477-112884499 TTGGAGCCTGGAATAGAGAGGGG + Intergenic
1089985554 11:122809630-122809652 TTGCAGTCAGAAATGGATAGTGG - Intronic
1091029616 11:132173736-132173758 TTGTGCCCAGGAATGGAGAGTGG + Intronic
1092625672 12:10325529-10325551 TGGTTGCCAGGAATGGAGAGAGG - Intergenic
1094148800 12:27258974-27258996 TCTCAGAAAGAAATGGAGAGTGG + Intronic
1095351029 12:41212947-41212969 TCTCAGCAAGGATTGGAGAGTGG + Intronic
1100697224 12:97108232-97108254 TGGTAGCCAGGAATTGATAGAGG + Intergenic
1102397297 12:112597627-112597649 TCCCAGCCAGGATTGGGGATAGG - Intronic
1102945873 12:116987480-116987502 ACGCAGTCAGGACTGGGGAGCGG + Intronic
1104906442 12:132215846-132215868 TCACAGCAGGGGATGGAGAGGGG + Intronic
1105931912 13:25060512-25060534 TCACACACAGGAATGGACAGAGG - Intergenic
1106339447 13:28815151-28815173 TGGGAGCCAGGATTGGACAGAGG - Intergenic
1108264913 13:48696944-48696966 TGGCAGCCAGGCTTGGGGAGGGG + Intronic
1110338051 13:74355032-74355054 TTGCAGAGAGGGATGGAGAGGGG + Intergenic
1110944172 13:81391972-81391994 TGGGGGCCAGGAATGGAGACAGG - Intergenic
1111853604 13:93607892-93607914 TGGCAGCCAGGATTGCAGGGAGG - Intronic
1113305100 13:109068968-109068990 TCACAGCCTTGAATGTAGAGTGG - Intronic
1115201174 14:30855807-30855829 TCCCAGCCTGCAGTGGAGAGTGG + Intergenic
1116599308 14:46899040-46899062 TCGCAGCCGCTAATGGAAAGGGG + Intronic
1121032801 14:90673930-90673952 TGGGAGTGAGGAATGGAGAGTGG + Intronic
1121565826 14:94908477-94908499 TCTCACCCAGGAAAGGAAAGTGG - Intergenic
1122641888 14:103164889-103164911 CCCCAGCCAGGAAGGGAGGGGGG - Intergenic
1122886050 14:104710908-104710930 GGGCAGCCAGGGCTGGAGAGGGG - Intronic
1123910221 15:24958452-24958474 TAGCATCCAGAAATGGAGAGAGG - Intronic
1124578118 15:30927310-30927332 TCCCAGCCAGGAGTGGAGCTAGG - Intronic
1127982399 15:64044958-64044980 TCAAAGCCTGGAATGTAGAGAGG - Intronic
1129160642 15:73745912-73745934 GCTCAGCCAGGGCTGGAGAGAGG - Intronic
1129683704 15:77672483-77672505 TGGCAGGCAGGGATGCAGAGTGG + Intronic
1132681422 16:1144019-1144041 TCGCAGCCAGGCAGGGAGACAGG + Intergenic
1132681442 16:1144097-1144119 TCACAGCCAGGCAGGGAGACAGG + Intergenic
1132681452 16:1144138-1144160 TCGCAGCCAGGCGGGGAGATGGG + Intergenic
1132768656 16:1548379-1548401 CCGCAGGAAGGAAAGGAGAGGGG + Intronic
1132903243 16:2269549-2269571 TGGCAGCAAGGAAGGGAGAAGGG + Intergenic
1133465215 16:6020924-6020946 TGGCAGCAAGGAATGGAGCTGGG - Intronic
1135397078 16:22139356-22139378 TCTCAGCCACGACTGGAGTGTGG - Intronic
1138119682 16:54389608-54389630 CTGGAGCCAGGAATGCAGAGAGG - Intergenic
1138584274 16:57960295-57960317 TCCCAGCCTGGACTGGGGAGGGG + Intronic
1139340873 16:66267146-66267168 TTGCAGCCAGGCATGGACCGTGG + Intergenic
1141557704 16:84846791-84846813 TCCCAGACAGGGAAGGAGAGGGG - Intronic
1142928383 17:3260788-3260810 ACGCAGCCAGGAAATGACAGGGG + Intergenic
1143462875 17:7115025-7115047 TCGGAGGCAGGAAGTGAGAGGGG - Intronic
1144653868 17:17023187-17023209 TCGCAGACAGGAATGATGTGTGG + Intergenic
1145267775 17:21388749-21388771 TCCCAGCCAGGCAAGGAGTGGGG + Intronic
1147613055 17:41812743-41812765 TCGCAGCCAGGGATGGAGATGGG + Intronic
1147814664 17:43200406-43200428 TCACAGCCAGGCCTGGAGCGAGG + Exonic
1147872411 17:43596934-43596956 TAGCAGACAGGAATGAGGAGTGG - Intergenic
1148062461 17:44846268-44846290 TTGAAGTCAGGGATGGAGAGGGG - Intergenic
1149119044 17:53138756-53138778 TGGCAGCCAGCAGTGCAGAGAGG - Intergenic
1149851604 17:60039593-60039615 TCGGAGCCTGGCATAGAGAGAGG - Intergenic
1150308882 17:64111100-64111122 TCCCAGGCAGGAATGGACAAGGG + Intronic
1150682189 17:67293072-67293094 TCCCAGCCAGGAACTCAGAGTGG - Intergenic
1151990649 17:77571904-77571926 TCGCCTCCAGGAAGGGGGAGGGG - Intergenic
1152546820 17:81004320-81004342 CCGCAGCCAGGAAGGGCGGGGGG - Intronic
1153105857 18:1525297-1525319 TGGAAGCCAGGGAAGGAGAGTGG + Intergenic
1155672325 18:28387404-28387426 TCTTAGAAAGGAATGGAGAGTGG + Intergenic
1157006504 18:43589994-43590016 TGGGTGCCAGGAATGGGGAGAGG + Intergenic
1158517121 18:58139844-58139866 GGGCAGGCAGGAGTGGAGAGAGG + Intronic
1159339812 18:67119865-67119887 CCGCTGCCAGGGATGGGGAGGGG + Intergenic
1161076040 19:2286257-2286279 TTGAAACCAGGCATGGAGAGAGG + Intronic
1161253540 19:3293937-3293959 TCGGAACCAGGAGTGGAGCGTGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1162827800 19:13264324-13264346 TGGCACCCAGGAATGGATGGCGG - Intronic
1163398526 19:17077759-17077781 TCGCAGCCAGGAATGGAGAGTGG - Intronic
1163495251 19:17642787-17642809 GGGCAGGCAGGAATGGTGAGTGG + Intronic
1163521549 19:17794938-17794960 TGGCAGCCGGGACCGGAGAGGGG + Intronic
1164635734 19:29790009-29790031 TCACAGGAAGGAAAGGAGAGGGG + Intergenic
1165308623 19:35017579-35017601 GGGCAGCCAGGTATGGAGAGGGG - Intronic
1165863945 19:38924606-38924628 TCACAGCCAGGAAGTGGGAGAGG - Intronic
1166414056 19:42579391-42579413 TCACAGCCAGCAATGGTTAGTGG - Intergenic
1166663816 19:44665054-44665076 ACAGAGCCAGGAATGGAGAGTGG + Intronic
1166772771 19:45294317-45294339 ACACAGCCAGGAAGGGAGTGAGG - Intronic
1167441639 19:49512717-49512739 CCGCAGGCAGGAAGGGAGCGAGG + Exonic
925457576 2:4029109-4029131 TTTGAGCCAGGAATTGAGAGAGG + Intergenic
926275458 2:11400032-11400054 TTGCAGCCAGGAAAGGAGATGGG + Intergenic
926323199 2:11763217-11763239 GCCCAGCAAGGAGTGGAGAGAGG + Intronic
926774320 2:16407082-16407104 AAGCAGCCAGGAAGGGGGAGAGG + Intergenic
927346387 2:22048032-22048054 TTGCTGCCAGGAGTGTAGAGTGG + Intergenic
929586406 2:43117641-43117663 TTGAAGCCAGGAATAGAGATGGG - Intergenic
929613891 2:43293041-43293063 CGGCAGCCAAGAGTGGAGAGCGG - Exonic
930121395 2:47763775-47763797 TCCCAGGCAGGAATGGAGACTGG + Intronic
931326375 2:61229548-61229570 TTGCAGCCAGGAATGGAAGATGG - Exonic
932120911 2:69099122-69099144 TGGCTGCCAGGACTGGAGGGAGG - Intronic
932479725 2:72031932-72031954 GCACAGCCAGGTCTGGAGAGCGG - Intergenic
932800732 2:74740404-74740426 TGGCAGCCTGGAATATAGAGGGG + Intergenic
932935406 2:76096363-76096385 TGGCAGCCAGGTTGGGAGAGGGG - Intergenic
935657102 2:105432892-105432914 TCCCAGCCAGGATTGCAGAAGGG + Intronic
936025734 2:109029698-109029720 TTCCAGCCAGGAAAGGAGAGGGG - Intergenic
936096499 2:109534234-109534256 TCTCAGCCTGGTATGGAGACAGG + Intergenic
937904381 2:127045822-127045844 TTGGAGCCAGGACTGGAGAGAGG - Intergenic
940475260 2:154153642-154153664 TGGCAGCCAGGCTGGGAGAGGGG - Intronic
940641557 2:156349824-156349846 TTACTGCCAGCAATGGAGAGTGG - Intergenic
943731389 2:191306723-191306745 TCCCAGCCAGGAATTGTGACTGG - Intronic
944275739 2:197835467-197835489 TGGTTGCCAGGAATGGGGAGGGG - Intronic
944442601 2:199757631-199757653 TTGCAGCCAGGATTTGAGGGAGG - Intergenic
945844037 2:214921770-214921792 TTAAAGCCAGGAAGGGAGAGAGG + Intergenic
947339894 2:229127215-229127237 TCCCAGCCAGCAAGAGAGAGGGG - Intronic
947528015 2:230891286-230891308 TAGCAGCCAGGAGTGGAGGATGG + Intergenic
948770679 2:240250033-240250055 TCGCAGCCTGGGAGGGAGGGAGG - Intergenic
1170657092 20:18298073-18298095 TTACAGCCAGTAATGGAGACAGG - Intronic
1171036309 20:21715027-21715049 TCGGAGCAAGGAAAAGAGAGTGG - Exonic
1171380813 20:24732714-24732736 TGGCAGCCTGGAATGCAGGGTGG - Intergenic
1171412893 20:24958535-24958557 CCGACCCCAGGAATGGAGAGGGG + Intronic
1172708945 20:36905083-36905105 TCTCATCCAGGAAGTGAGAGTGG - Intronic
1172964316 20:38823277-38823299 TCTCAGACAGGAGAGGAGAGAGG + Intronic
1174377845 20:50138381-50138403 TCGCACCCAGGTATGGAGAATGG + Intronic
1175679814 20:60977685-60977707 GAGGAGCCAGGAATGGAGGGGGG - Intergenic
1175871293 20:62210671-62210693 CTGCAGCCAGGCAGGGAGAGTGG + Intergenic
1178826484 21:36021250-36021272 TCAAAGCCAGTGATGGAGAGAGG + Intergenic
1179027235 21:37689616-37689638 TGGCAGGAATGAATGGAGAGAGG - Intronic
1179305843 21:40153479-40153501 AGACACCCAGGAATGGAGAGAGG + Intronic
1180675003 22:17580953-17580975 ATGCAGCCAGGAATGGGCAGGGG - Intronic
1180931949 22:19598270-19598292 TGGCATCCAGGAACAGAGAGTGG + Intergenic
1181625537 22:24119899-24119921 TCACAGCCAGGAATGGAGGGAGG + Intronic
1183529380 22:38344782-38344804 TCCCAGCCCAGAATGGTGAGAGG + Intronic
1183810867 22:40256055-40256077 TGTTAGCCAGGAATTGAGAGAGG + Intronic
1184486378 22:44782504-44782526 TGGATGCCAGGAATGGAGGGAGG - Intronic
1185078633 22:48696724-48696746 TCTCAGCCAGGAAATGAGGGTGG + Intronic
1185329536 22:50245957-50245979 TTGCAGCCAGGAGTGCAGCGTGG + Exonic
950722956 3:14897916-14897938 CTGCAGCCAGGAATGGGGATGGG - Intronic
951614851 3:24531042-24531064 TCACAGCCAGGAATGAACACTGG + Intergenic
953855798 3:46498479-46498501 GAGCAGCCAGGAAAGGGGAGGGG + Intronic
954582467 3:51710532-51710554 TCTCTGCCTGGATTGGAGAGGGG + Intronic
956346794 3:68288115-68288137 TCTCAGCCATGAAAAGAGAGGGG - Intronic
960026446 3:113016363-113016385 TGGCAGCCAGAACTGAAGAGGGG + Intronic
962806135 3:138929106-138929128 TCGCAGGGAGGAATGGTGGGTGG - Intergenic
963108121 3:141664053-141664075 ACTCAGTCAGGAATGCAGAGTGG - Intergenic
965386531 3:168053055-168053077 ATGCAACCAGGAATGGAAAGAGG + Intronic
965566042 3:170118696-170118718 AGGCAGCCAGGCATGGTGAGTGG - Intronic
967612724 3:191526885-191526907 TAGCAGGCAAAAATGGAGAGGGG - Intergenic
968790208 4:2655098-2655120 TCGAAGCCAGGACTGGACAAGGG - Intronic
969430078 4:7148780-7148802 TCTCAGCCTGGAAAGGGGAGGGG + Intergenic
970341037 4:15107056-15107078 TCCCACCCAGGAATAGAAAGTGG - Intergenic
970603053 4:17655333-17655355 TTGCCCCCAGGGATGGAGAGAGG - Intronic
972821658 4:42708683-42708705 GGGCAGCCAGGAGTGAAGAGTGG - Intergenic
976348398 4:84031289-84031311 ACTCATCCAGGAATGGAGAGTGG - Intergenic
976634631 4:87275621-87275643 CCACAGCCAGGAATGGTAAGAGG - Intergenic
981785313 4:148471770-148471792 TATAAACCAGGAATGGAGAGCGG - Intergenic
982123314 4:152162490-152162512 CCACAGCCTGGTATGGAGAGTGG - Intergenic
982323516 4:154105550-154105572 TGCCAGACAGAAATGGAGAGAGG - Intergenic
982757259 4:159236013-159236035 ACACAGCCAGGAATGCAGAAAGG - Intronic
983140351 4:164142227-164142249 CCGCAGCCAGGCTTGGGGAGGGG + Intronic
986063309 5:4212114-4212136 TCCCAGCGTGGAGTGGAGAGAGG - Intergenic
986692342 5:10323613-10323635 TGGCAGCCAGAAATGGACAAGGG - Intergenic
990047983 5:51457870-51457892 TCGAAGCCAGCAATGGCCAGTGG - Intergenic
991959891 5:72034081-72034103 TCACAGCCATGATTGCAGAGAGG - Intergenic
992752592 5:79874886-79874908 TGGCAGGCAGGAGAGGAGAGAGG - Intergenic
995897590 5:117032615-117032637 TGGCAGACAGGAAGGCAGAGAGG + Intergenic
997646651 5:135486539-135486561 TCACAGCCAGAAATGGAGCCTGG - Intergenic
997743656 5:136279641-136279663 TTGCTGCCAGGTATGGAGGGTGG - Intronic
997975496 5:138439387-138439409 TGGCACCCAGGACTGGAGGGGGG + Intronic
999175567 5:149629469-149629491 TCTCAAACAGGAAGGGAGAGAGG + Intronic
1000540319 5:162531240-162531262 TGGCAGCCAGGCTGGGAGAGGGG - Intergenic
1002197496 5:177509327-177509349 TCCCACCCAGGTATGGGGAGTGG - Intronic
1002577048 5:180179899-180179921 GCAAAGCCAGGAATGTAGAGAGG - Intronic
1004544199 6:16581521-16581543 AAGCACCCAGGAATGGAGGGAGG + Intronic
1007399647 6:41596504-41596526 GCGCAGCCAGGCCTGGAGACTGG - Intronic
1010990020 6:82469940-82469962 TGGCAGCAAGGCAGGGAGAGGGG + Intergenic
1011547818 6:88500044-88500066 TCTCAGGCAGGAAGTGAGAGTGG - Intergenic
1012932314 6:105329993-105330015 CCACAGCCAGGAATGAGGAGAGG + Intronic
1015398748 6:132764583-132764605 TGGCAGCCAGGCATGGAGGCAGG + Intergenic
1018629453 6:165809622-165809644 TTGGAGCCAGGAGTGGAGTGAGG - Intronic
1019634947 7:2070506-2070528 ACACAGCCAGGAAAGAAGAGAGG + Intronic
1019720479 7:2567562-2567584 TCCCAGCCCGGAAAGGAGAGGGG + Intronic
1021946065 7:25728500-25728522 TCACAGCCAGGTCTGGAGAGAGG - Intergenic
1022388442 7:29923365-29923387 AAGGAGCCAGGACTGGAGAGGGG + Intronic
1022652976 7:32293995-32294017 TCTCTGCCAGGGCTGGAGAGTGG + Intronic
1024058475 7:45681578-45681600 TCTCAGCTAGGACAGGAGAGGGG + Intronic
1024284679 7:47746947-47746969 GCGTAGCCAGAAATGGAGTGGGG - Intronic
1028637275 7:93003500-93003522 TCACAGCCCGGAATTTAGAGCGG - Intergenic
1032591381 7:133194868-133194890 ACGAAGCCAGTAATGGAAAGGGG + Intergenic
1033489896 7:141833188-141833210 TCGAAGCCAGGAGTGGAGGGAGG + Intergenic
1033764046 7:144468305-144468327 TTGGAGACAGGGATGGAGAGTGG + Intronic
1035766898 8:2113565-2113587 TTGCAGCCAGGGATGGAGGAAGG + Intronic
1036762463 8:11518777-11518799 GAGCAGCCAGGGATGGTGAGAGG - Intronic
1037274211 8:17159901-17159923 AAGAAGCCAGGAGTGGAGAGAGG - Intronic
1041925310 8:63230143-63230165 TTGAAGCCAGCAAGGGAGAGAGG + Intergenic
1044278839 8:90333661-90333683 TGGCAGCCAGGATGGGGGAGGGG + Intergenic
1044428050 8:92076078-92076100 TCCCAGTCAGAAAAGGAGAGAGG - Intronic
1047583332 8:126241387-126241409 ACTCAGCCTGTAATGGAGAGTGG - Intergenic
1047951426 8:129939227-129939249 TGGGAGCCAGGATTGGGGAGGGG + Intronic
1049018041 8:139935234-139935256 TGGCTGCCAGGGAAGGAGAGGGG + Intronic
1052760170 9:32582067-32582089 CTGCAACCAGGAATGGAGATGGG + Intergenic
1052849592 9:33368885-33368907 TGGCTCCCAGGAGTGGAGAGGGG - Intronic
1053070248 9:35096780-35096802 TCGTAACCATGAATGGACAGTGG - Intergenic
1055777506 9:79782193-79782215 TAATAGCCAGGAAAGGAGAGAGG + Intergenic
1056042012 9:82677960-82677982 GCACAGCCAGCAATGGGGAGAGG - Intergenic
1056365290 9:85898779-85898801 AAGCAGCCAGGGAAGGAGAGCGG + Intergenic
1059442251 9:114314986-114315008 GCGCTGCGAGGAAAGGAGAGAGG + Intergenic
1059680468 9:116580610-116580632 TGGCAGCCAGAAAAAGAGAGCGG - Intronic
1059982347 9:119786998-119787020 ATGCAGCCAGGAGTGGAGTGGGG - Intergenic
1060043702 9:120323846-120323868 TGGCAGGCAGGAAGGGAGTGAGG + Intergenic
1060414248 9:123419442-123419464 ACGTGGCCAGGAATGGAGATGGG + Intronic
1061049408 9:128185652-128185674 TCCCAGCAAGGACTGGCGAGTGG + Exonic
1187464145 X:19514134-19514156 TTGCAGCCAGGAGTGGAAATCGG - Intronic
1187651048 X:21406699-21406721 TGACAGAAAGGAATGGAGAGGGG - Intronic
1189723074 X:43940373-43940395 TCACAGCCAGTAAAGGACAGGGG - Intergenic
1198175242 X:134148384-134148406 TCAGAACCAGCAATGGAGAGTGG - Intergenic
1198314834 X:135454953-135454975 TCACAGGAAGGAATGGAGCGGGG - Intergenic
1199454556 X:148013832-148013854 TCACTGACAGGAATGGAGAAGGG - Intronic
1200123588 X:153802743-153802765 TCCCAGCCATCAGTGGAGAGGGG + Exonic