ID: 1163398602

View in Genome Browser
Species Human (GRCh38)
Location 19:17078263-17078285
Sequence AAGCTGGGCCGCGGTGGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163398590_1163398602 24 Left 1163398590 19:17078216-17078238 CCCGCCCCCGACAACTTTGCACT No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data
1163398591_1163398602 23 Left 1163398591 19:17078217-17078239 CCGCCCCCGACAACTTTGCACTT No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data
1163398595_1163398602 17 Left 1163398595 19:17078223-17078245 CCGACAACTTTGCACTTCCTCTT No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data
1163398593_1163398602 19 Left 1163398593 19:17078221-17078243 CCCCGACAACTTTGCACTTCCTC No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data
1163398592_1163398602 20 Left 1163398592 19:17078220-17078242 CCCCCGACAACTTTGCACTTCCT No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data
1163398597_1163398602 0 Left 1163398597 19:17078240-17078262 CCTCTTCAGAAAGAATGGAGTTC No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data
1163398594_1163398602 18 Left 1163398594 19:17078222-17078244 CCCGACAACTTTGCACTTCCTCT No data
Right 1163398602 19:17078263-17078285 AAGCTGGGCCGCGGTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163398602 Original CRISPR AAGCTGGGCCGCGGTGGCTC AGG Intronic