ID: 1163399980

View in Genome Browser
Species Human (GRCh38)
Location 19:17086263-17086285
Sequence CAGTGTGGCCGGTGGGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163399980_1163399988 4 Left 1163399980 19:17086263-17086285 CCTTGGACCCACCGGCCACACTG No data
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163399980 Original CRISPR CAGTGTGGCCGGTGGGTCCA AGG (reversed) Intronic
No off target data available for this crispr