ID: 1163399988

View in Genome Browser
Species Human (GRCh38)
Location 19:17086290-17086312
Sequence CCTTGTTCTCAGACCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 181}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163399980_1163399988 4 Left 1163399980 19:17086263-17086285 CCTTGGACCCACCGGCCACACTG No data
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399978_1163399988 11 Left 1163399978 19:17086256-17086278 CCTCCAGCCTTGGACCCACCGGC 0: 1
1: 0
2: 1
3: 17
4: 216
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399979_1163399988 8 Left 1163399979 19:17086259-17086281 CCAGCCTTGGACCCACCGGCCAC 0: 1
1: 0
2: 1
3: 16
4: 177
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399985_1163399988 -7 Left 1163399985 19:17086274-17086296 CCGGCCACACTGGGCTCCTTGTT 0: 1
1: 5
2: 51
3: 299
4: 952
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399976_1163399988 15 Left 1163399976 19:17086252-17086274 CCGGCCTCCAGCCTTGGACCCAC 0: 1
1: 0
2: 2
3: 51
4: 598
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399984_1163399988 -4 Left 1163399984 19:17086271-17086293 CCACCGGCCACACTGGGCTCCTT 0: 1
1: 2
2: 9
3: 73
4: 356
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399983_1163399988 -3 Left 1163399983 19:17086270-17086292 CCCACCGGCCACACTGGGCTCCT 0: 1
1: 0
2: 4
3: 44
4: 346
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181
1163399975_1163399988 16 Left 1163399975 19:17086251-17086273 CCCGGCCTCCAGCCTTGGACCCA 0: 1
1: 0
2: 2
3: 42
4: 520
Right 1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG 0: 1
1: 0
2: 2
3: 7
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163399988 Original CRISPR CCTTGTTCTCAGACCCACTC TGG Intronic
900633436 1:3650880-3650902 CCTCGTTCTCACCCCCACTCCGG + Intronic
901528725 1:9840558-9840580 CCTTGTTGTCAGCACCACTTTGG + Intergenic
902466425 1:16621336-16621358 CCCTGTTCTGAGGGCCACTCTGG + Intergenic
904036153 1:27559823-27559845 CCTGGTTCCCAGACCCCCTCTGG - Intronic
907612745 1:55889014-55889036 CCTTCTTCACAGACCCAATGTGG + Intergenic
912300234 1:108508567-108508589 TATTGTCCTCAGAGCCACTCAGG + Intergenic
912778689 1:112524187-112524209 CCAAATTCTCAGACCCACTCAGG + Exonic
912953074 1:114133971-114133993 CCTTGTTCCCACCCCCACCCTGG - Intronic
912964337 1:114224393-114224415 CCTCGCTCTCAGACCCTCTTTGG - Intergenic
913069079 1:115283725-115283747 CCTGGCTTTCAGACCCACCCGGG - Intergenic
915123846 1:153649641-153649663 CCTTCTTCTAAGCCCCACCCAGG + Intergenic
915622494 1:157094330-157094352 CCTTCTTCTCTGTCTCACTCTGG + Intronic
916248544 1:162712355-162712377 CCTTTTTCTGAGACACATTCAGG - Intronic
918400462 1:184157540-184157562 TCTTCTTCTCAGTCCCACACTGG - Intergenic
919828561 1:201521910-201521932 CCTTGTTCTGATGCCCAGTCTGG + Intergenic
920293156 1:204938333-204938355 CTTTGAGCTCAAACCCACTCAGG + Intronic
921179396 1:212619727-212619749 CCCTGGTCCAAGACCCACTCTGG - Exonic
922754698 1:228089231-228089253 CCTAGTTCTCACACACACGCTGG - Intronic
923443794 1:234048714-234048736 CCTGCCTCTCAGACCCACTGGGG - Intronic
1062829462 10:596022-596044 GCCTGTGCTCAGACCCACTAAGG + Intronic
1063178765 10:3577162-3577184 CCTCATTCTCACACTCACTCAGG - Intergenic
1064681584 10:17815656-17815678 CCTTGTGGTCAGACCCATACTGG + Intronic
1066001111 10:31104667-31104689 ACTTGATCCCAGACCCAATCTGG - Intergenic
1069266427 10:66463967-66463989 GCTTGGTCTCAGGACCACTCAGG + Intronic
1069911986 10:71765489-71765511 CCTTGTTCACAGGGACACTCAGG - Intronic
1070989582 10:80719572-80719594 CACTGTTCTCAGACACACTCGGG + Intergenic
1073190180 10:101645470-101645492 CCTTTTCCTCAGACACACACAGG + Intronic
1073838546 10:107471690-107471712 CCTGGTTCTTAGACCCAGGCTGG - Intergenic
1074767003 10:116706919-116706941 CCTTCTTCTGTGACCCACCCAGG + Intronic
1075916985 10:126176088-126176110 CCTGGTTCTCTGACCCCCTGAGG - Intronic
1077405742 11:2381790-2381812 CCTTGTTCCCAGCACCCCTCTGG + Intronic
1080186180 11:29489806-29489828 CCTTGTGCTCATACCCACCAAGG + Intergenic
1083453470 11:62762163-62762185 CCTTGTTCTGAGCCCAACACGGG - Intronic
1084175397 11:67420050-67420072 CCCTGTGCTCAGCCCCACGCTGG + Intronic
1085852355 11:80137005-80137027 TCTTGTTCTCAGAGGCTCTCAGG + Intergenic
1086160238 11:83713986-83714008 GTATGTTTTCAGACCCACTCTGG - Intronic
1090120437 11:124021583-124021605 CCATGTTCTCAGAACCACATAGG + Intergenic
1090121009 11:124028232-124028254 CCATGTTCTCAGAACCACATAGG + Intergenic
1091757732 12:3066067-3066089 TCTTGTTCTGTCACCCACTCTGG - Intergenic
1095487487 12:42699994-42700016 CCTGGTTATCAGACCCACTCAGG + Intergenic
1096865545 12:54560696-54560718 CCTGGTCCTCAGACCCCTTCTGG + Intronic
1100988143 12:100224550-100224572 CCTTGTTCTCTCACCCAGGCTGG + Intronic
1101233798 12:102767829-102767851 CCTTGTTCTAAGAATCACTAAGG + Intergenic
1103067599 12:117913120-117913142 CCTTCTTCTGAGGCCAACTCGGG - Intronic
1104044197 12:125150249-125150271 CTGTCTTCTCAGCCCCACTCCGG + Intergenic
1104246277 12:127044819-127044841 CCTTGGTCTCTGACCCAGACTGG + Intergenic
1107023498 13:35775806-35775828 CTTTGTTCTCAGAACCAGGCTGG - Intronic
1113790917 13:113027713-113027735 CCTGGTTCTCAGCCACACTGTGG + Intronic
1114484227 14:23053560-23053582 CCTTGTTCTCAGGCACTGTCAGG + Exonic
1116660313 14:47701614-47701636 CTTTGTTCTCAGAGGCCCTCGGG - Intergenic
1120306749 14:82780655-82780677 CCTTGTTCTTGGACCCACATGGG + Intergenic
1121114904 14:91336742-91336764 TCTGTTCCTCAGACCCACTCAGG - Intronic
1121698464 14:95932433-95932455 CCTTGTTCTCCTTCCCACTTTGG - Intergenic
1124604053 15:31157737-31157759 CCTTGGTCTTAGACCAACTGGGG - Intronic
1128568755 15:68718369-68718391 CCTTGCCCTCTGACCCTCTCTGG + Intronic
1130413464 15:83667676-83667698 GCTTTTTCCAAGACCCACTCAGG - Intronic
1130819526 15:87479764-87479786 CTTCTTTCTCTGACCCACTCTGG + Intergenic
1131020214 15:89091152-89091174 CCTATTTGTCAGACCCACGCAGG - Intronic
1132229988 15:100174713-100174735 ACTTGTCCTCAAACCCTCTCTGG + Intronic
1133089967 16:3396479-3396501 CTCTGATCACAGACCCACTCAGG + Intronic
1133228385 16:4354435-4354457 CCTTTATCTCAGCCTCACTCTGG - Intronic
1136054535 16:27678633-27678655 CCTGGTTCTCCAACCCACACGGG + Intronic
1136162989 16:28433059-28433081 CCTTGTTCTCTCACCCAGGCTGG - Intergenic
1136199976 16:28681929-28681951 CCTTGTTCTCTCACCCAGGCTGG + Intergenic
1136216324 16:28796104-28796126 CCTTGTTCTCTCACCCAGGCTGG + Intergenic
1137363363 16:47840259-47840281 CCTTCTCCTCACACCCAGTCTGG + Intergenic
1138065659 16:53938725-53938747 GCAAGTTCTCTGACCCACTCAGG + Intronic
1138155470 16:54698911-54698933 CCTTGGGCCCAGACCAACTCAGG + Intergenic
1138187376 16:54987040-54987062 CCTTCTCCCCAGACCCACTGGGG - Intergenic
1140485947 16:75293458-75293480 GCTTGTTCTCATTTCCACTCGGG - Intergenic
1141089100 16:81117670-81117692 CCTTGTGCACAGACCCATTGAGG + Intergenic
1143017635 17:3899422-3899444 CCTGGGTCTCAGACCCCTTCAGG - Intronic
1145312759 17:21709352-21709374 TCTTGTTCTCAGCCCCTCCCCGG + Intergenic
1145781567 17:27567216-27567238 CCAGGTCCTGAGACCCACTCAGG - Intronic
1148075935 17:44935215-44935237 CCTTGTTCTCACAACCACCCGGG - Intronic
1148214555 17:45827326-45827348 CCTTGTTCACAGGCCCAGGCTGG - Intronic
1151436743 17:74102436-74102458 CCTTTTCCTCAGGTCCACTCGGG + Intergenic
1151497501 17:74467360-74467382 CCTGGTTCTCAGGCCCATGCAGG - Intronic
1157451669 18:47793848-47793870 CTTTGTTCCCCAACCCACTCTGG - Intergenic
1158397808 18:57093347-57093369 CTTTGCTCTCAGACCCCCACTGG + Intergenic
1159573943 18:70152957-70152979 CCTACTTTTCAGACCCAATCTGG + Intronic
1159747299 18:72254175-72254197 CCTGTTTCTCAGACCCTGTCAGG - Intergenic
1162910113 19:13843658-13843680 CCTTGCTCCCAGAGCTACTCCGG - Intergenic
1163339955 19:16699238-16699260 CCAAGTTCTCACACCCACACTGG - Intergenic
1163399988 19:17086290-17086312 CCTTGTTCTCAGACCCACTCTGG + Intronic
1164615842 19:29666278-29666300 CCTTGGCCTCTGACCCTCTCTGG - Intronic
1165862205 19:38915241-38915263 CCTTGTTCACAGATCCACAGAGG + Intergenic
1166209880 19:41299529-41299551 TCTTATTTTCAGATCCACTCTGG + Intronic
1166509135 19:43392500-43392522 CCTTGTCCTGAGACCCCCACAGG + Intergenic
1166685641 19:44794428-44794450 CCTTGTTTTCATTCCCCCTCTGG + Intronic
1167505555 19:49869320-49869342 ACTTGTTCCCTGACCCCCTCAGG - Exonic
928417623 2:31109395-31109417 CCTTGTTCTCAGATGAATTCAGG + Intronic
930246004 2:48983952-48983974 TTTTGTTTTCAGATCCACTCAGG - Intronic
931189913 2:59990382-59990404 CATTGTTTCCAGACCCACGCCGG + Intergenic
931347540 2:61460380-61460402 CCTGGTTATCAGATCCACTGTGG + Intronic
932413449 2:71560378-71560400 CCCCGCTCTCAGGCCCACTCAGG + Intronic
933915444 2:86987642-86987664 CTTTGCTTTCAGATCCACTCTGG - Exonic
934007549 2:87782259-87782281 CTTTGCTTTCAGATCCACTCTGG + Exonic
934581343 2:95442700-95442722 TCTTGTTCTCAGTCCTAATCTGG + Intergenic
934598107 2:95634014-95634036 TCTTGTTCTCAGTCCTAATCTGG - Intergenic
934618196 2:95788235-95788257 CCTCGGTCCCAGACCCAATCTGG + Intergenic
934642697 2:96036324-96036346 CCTCGGTCCCAGACCCAATCTGG - Intronic
935771188 2:106423178-106423200 CTTTGCTTTCAGATCCACTCTGG + Exonic
935908890 2:107872771-107872793 CTTTGCTTTCAGATCCACTCTGG - Exonic
935995574 2:108768231-108768253 CTTTGCTTTCAGATCCACTCTGG - Exonic
936130672 2:109837885-109837907 CTTTGCTTTCAGATCCACTCTGG - Exonic
936214025 2:110533600-110533622 CTTTGCTTTCAGATCCACTCTGG + Exonic
936423162 2:112388159-112388181 CTTTGCTTTCAGATCCACTCTGG + Exonic
938479398 2:131647007-131647029 CCTAGTTCTCAGCCCCGCCCCGG + Intergenic
938936524 2:136132328-136132350 CTTATTTCTCACACCCACTCTGG + Intergenic
941625404 2:167825645-167825667 CCCTTTTCTCTGACCCACCCAGG + Intergenic
943133376 2:183884985-183885007 CATTGCTCTCAGAACCACTTAGG - Intergenic
948822864 2:240558671-240558693 CCCTGTTCTCAGAGGCAGTCTGG - Intronic
1171469797 20:25361177-25361199 CCATGTTGCCAGACTCACTCAGG + Intronic
1172637949 20:36422654-36422676 CCATGCTCACAGGCCCACTCTGG + Intronic
1172702082 20:36859918-36859940 CCCTGCTCTGGGACCCACTCTGG + Intronic
1173659729 20:44724935-44724957 CCTTGGCCGCACACCCACTCAGG - Exonic
1173692822 20:44977968-44977990 CTTTGTTTTCAGACACACCCGGG + Intronic
1175267820 20:57713268-57713290 CCTTGATCTCACCCCAACTCTGG - Intergenic
1176260755 20:64178344-64178366 TCTGGTCCTCAGACCCATTCAGG + Intronic
1178880349 21:36445024-36445046 CCTTGCCCTCAGACCCAGGCTGG + Intergenic
1179488542 21:41726291-41726313 CCCTGTTCTCAGAGCCAGGCAGG + Intergenic
1182258513 22:29055363-29055385 CCTTGTTCTCCTACCCACAGGGG - Exonic
1182269172 22:29142718-29142740 TCTTATTCTCAGACCCTCCCAGG - Intronic
1182548089 22:31087033-31087055 TCTGGTTATCAGACCCACACTGG + Intronic
1183499398 22:38169358-38169380 ACTTGTTCTCTAACCCATTCCGG - Exonic
1184255627 22:43285324-43285346 CCTTGTTCCCAGACCCATCCTGG + Intronic
1184534887 22:45079744-45079766 CTTTCTTCTCACAGCCACTCTGG + Intergenic
1184959933 22:47921493-47921515 CCCTGCTCTCAGAACCTCTCAGG - Intergenic
949759592 3:7454857-7454879 CATTGCTCTCAGGCCCTCTCAGG - Intronic
950011399 3:9726742-9726764 CTTAGTTCTTAGTCCCACTCAGG - Intronic
956626976 3:71276272-71276294 CCTTGTACTCAGAACGACTTAGG - Intronic
960337245 3:116433801-116433823 CCTTCTTCTCAGAGCTACCCAGG + Intronic
966850157 3:184159792-184159814 CCTTGTTCTCAGAGAGACTATGG - Intronic
967933515 3:194707945-194707967 GCTTGTCCTCACAGCCACTCAGG - Intergenic
969124512 4:4936455-4936477 CCTTGTTCTCTCACCCAGGCTGG - Intergenic
970151311 4:13093412-13093434 CCTGGCTCTCAGGCCCACTAAGG + Intergenic
972768126 4:42170424-42170446 CCTTGTTCTCTCATCCACGCTGG - Intergenic
973728984 4:53805012-53805034 CCATCTTCTCAAATCCACTCAGG - Intronic
974630050 4:64477849-64477871 CCTTGTTCTCAGTCCTAATAAGG + Intergenic
977564901 4:98570899-98570921 CCCTGTTCTCAGGCCTTCTCAGG - Intronic
983739702 4:171114090-171114112 GCGTGTTCTCTAACCCACTCTGG - Intergenic
986955471 5:13145237-13145259 CCTTGTCCTCAGATGCACACAGG + Intergenic
987089770 5:14500409-14500431 CCTTATTCTCAGTCCAGCTCTGG + Intronic
990630569 5:57664318-57664340 ACTTGTTCTCAGACCCAGAGTGG + Intergenic
995540968 5:113185978-113186000 CCTTGTTTTCAGATCTCCTCAGG - Intronic
997426752 5:133808454-133808476 TCTTGTCCTCAAACCCACCCAGG + Intergenic
999892414 5:155993368-155993390 CCTTGCTCTGACACCCACCCAGG + Intronic
1001612170 5:173011640-173011662 ACTTGATCTCAGATCCATTCCGG + Intronic
1002946974 6:1771335-1771357 CCTGGGCCTCAGACACACTCTGG + Intronic
1003343058 6:5240202-5240224 GCTTGTTCCCTGACTCACTCTGG + Intronic
1004000837 6:11595493-11595515 CCTTGTTCTCAGGCAAACACTGG + Intergenic
1004691371 6:17995116-17995138 CTTTGATGTCAGACCCACTGTGG + Intergenic
1004886881 6:20059749-20059771 AGTTATTCACAGACCCACTCAGG - Intergenic
1006739008 6:36294132-36294154 CAGAGTTCTCAGCCCCACTCGGG - Intronic
1008304763 6:49887713-49887735 CCTTGTGTTCACACCCCCTCAGG - Intergenic
1009491996 6:64302896-64302918 GCTTGTTTTCACACCCCCTCAGG + Intronic
1011449317 6:87476031-87476053 CCTTATTCCCAGACCTGCTCGGG - Intronic
1011834437 6:91413644-91413666 CCTTTTTCTAAGACCCACAGGGG - Intergenic
1018376818 6:163220443-163220465 CCTTGTTCTCAGGTCTACTATGG - Intronic
1019314242 7:377211-377233 CCTTGTCCTCTGCCACACTCAGG - Intergenic
1020354139 7:7258427-7258449 TCTTATACTTAGACCCACTCAGG + Intergenic
1021277676 7:18674577-18674599 CATTGTTCCTAGAGCCACTCAGG + Intronic
1021643405 7:22763082-22763104 GCTTGTTCTCACCCCCACCCTGG + Intergenic
1023816593 7:43955169-43955191 CCTTGTTTTAAGAGCCACTGTGG + Exonic
1024559381 7:50630480-50630502 CCTTGTTCCCAGATCCACGGTGG - Intronic
1026568461 7:71509444-71509466 ACTTGTGCTCAGCCCCATTCTGG + Intronic
1026868964 7:73839381-73839403 CCTTGATCTCCAACCCACTGGGG - Intronic
1029285209 7:99461024-99461046 CCTTGTTCTCAGACTCCCATTGG - Intronic
1032539685 7:132692833-132692855 TCTTGTTCTCAGACTCAGGCAGG - Intronic
1035642425 8:1194204-1194226 CCTTGTTCTCAGCCCGACTCAGG + Intergenic
1036550301 8:9809888-9809910 GCTTGTGCTCACACCCCCTCAGG + Intergenic
1038765346 8:30423014-30423036 CCTGGTTCTCAACCCCACTTGGG - Intronic
1038981110 8:32760686-32760708 CCATGGGCTCAGACCCACTCGGG + Intronic
1041587070 8:59533320-59533342 CCTTGTTTTCAGAGCTTCTCTGG + Intergenic
1041647288 8:60265951-60265973 CCGTGTGCTCAGAACCACGCTGG + Exonic
1042467932 8:69149530-69149552 CCTTGTTCTGGGCCACACTCTGG - Intergenic
1048987072 8:139740428-139740450 CCTCGTTCTCAGCCCCACGGTGG - Intronic
1050353829 9:4764494-4764516 CATTGATCTCAGGCCCTCTCAGG - Intergenic
1051111951 9:13649325-13649347 CATTGTTCTCAGATGCACACAGG - Intergenic
1052812423 9:33073365-33073387 TCTTGTTCTGTTACCCACTCTGG - Intronic
1060475404 9:123983060-123983082 CCCTGTGCTCACTCCCACTCAGG + Intergenic
1060921134 9:127421321-127421343 CCTTTTGCTCAGAGCCACACTGG - Intergenic
1061843051 9:133371248-133371270 CCTTGTTCAAAGCCCAACTCAGG + Intronic
1062254326 9:135613990-135614012 CCCTCTTCTCAGCCCCCCTCAGG + Intergenic
1062340654 9:136092600-136092622 CCTTGTCCTCAGAACCACAATGG + Intronic
1185612577 X:1401520-1401542 CCTTTTTCTGAGACAGACTCTGG - Intergenic
1189710611 X:43807967-43807989 CCTTGAACCCAGACCCACTATGG + Intronic
1191174450 X:57484528-57484550 CCTGGCTCTCAGACACACTGTGG - Intronic
1197807030 X:130407280-130407302 CCTTGCTCTGACACCCACGCTGG + Intronic
1200065647 X:153503070-153503092 GCTTGTGCTCAGACCCAACCTGG + Intronic