ID: 1163400339

View in Genome Browser
Species Human (GRCh38)
Location 19:17088319-17088341
Sequence CAGTTAAGATCAGGTTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 1, 2: 5, 3: 85, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163400339_1163400345 11 Left 1163400339 19:17088319-17088341 CCAGTACAACCTGATCTTAACTG 0: 1
1: 1
2: 5
3: 85
4: 412
Right 1163400345 19:17088353-17088375 AAAGGCCTTATTTCCAAACAAGG 0: 1
1: 10
2: 125
3: 718
4: 1778
1163400339_1163400348 24 Left 1163400339 19:17088319-17088341 CCAGTACAACCTGATCTTAACTG 0: 1
1: 1
2: 5
3: 85
4: 412
Right 1163400348 19:17088366-17088388 CCAAACAAGGTCACATTCTGAGG 0: 26
1: 399
2: 962
3: 1964
4: 2738
1163400339_1163400341 -7 Left 1163400339 19:17088319-17088341 CCAGTACAACCTGATCTTAACTG 0: 1
1: 1
2: 5
3: 85
4: 412
Right 1163400341 19:17088335-17088357 TTAACTGACTACATCCCCAAAGG 0: 1
1: 0
2: 1
3: 15
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163400339 Original CRISPR CAGTTAAGATCAGGTTGTAC TGG (reversed) Intronic
904696121 1:32332531-32332553 CTGTTGAGAACAGGTTGGACTGG - Intronic
905444515 1:38017427-38017449 CAGTTAATTTCAGGTTCCACTGG + Intronic
907258898 1:53201266-53201288 TAGTTAAGATGAGGTCCTACTGG + Intronic
907557732 1:55359310-55359332 TAGTTAAGATGAGGTCATACTGG + Intergenic
907782074 1:57576376-57576398 AAGTTGAGATGAGGTTATACTGG + Intronic
907882594 1:58565171-58565193 AAGTTAAGATCAGTTCATACTGG + Intergenic
908618279 1:65947572-65947594 TAGTTAAGATGAGGTCATACTGG + Intronic
908711933 1:67025105-67025127 TAGTTAGGATCAGGTCATACGGG - Intronic
909700027 1:78512050-78512072 CAGTGAAGACCAGGTTGAAGAGG - Intronic
910483545 1:87684559-87684581 CAGTTAAGATAAGCATGTAATGG - Intergenic
911944355 1:104087231-104087253 CAGTTAAGATGAGGCCATACTGG - Intergenic
912255427 1:108053441-108053463 CAGTTAAGATGAGGAAGTAGAGG + Intergenic
913711405 1:121487575-121487597 TAGCTAAGATGAGGTTATACTGG - Intergenic
914690809 1:150025082-150025104 CAGTTCAGATAAGGTTGTGGTGG - Intergenic
914700374 1:150126983-150127005 CAGTTGACATCAGGTGGTTCTGG - Intronic
916593273 1:166214492-166214514 CATTTAGGAGCAGGTTGTTCAGG + Intergenic
917475983 1:175369502-175369524 GAGTTAAGATGAGGTCATACTGG - Intronic
918745429 1:188193042-188193064 TAGTTAAGATGAGGTCATACTGG - Intergenic
918994498 1:191739376-191739398 CAGTGAAGTTCTGGTTGTAAGGG + Intergenic
920706767 1:208256974-208256996 AAGTTAAGATGAGGTTATACTGG - Intergenic
920838374 1:209533206-209533228 CAGTTAAGATGAGGTCATTCTGG - Intergenic
920989585 1:210923920-210923942 TAGTTAAGATGAGGTCATACTGG + Intronic
921498358 1:215868652-215868674 AAGTTAAGATGAGGTCATACTGG + Intronic
923338910 1:232991570-232991592 TAGTTAAGATGAGGTCATACTGG + Intronic
923435961 1:233968302-233968324 TAGTTAAGATAAGGTCATACCGG - Intronic
1063133873 10:3199938-3199960 CAGTTATGATCAGATGGGACAGG - Intergenic
1065474171 10:26116441-26116463 TAGTTAAGATAAGGTCATACTGG - Intronic
1066177787 10:32927413-32927435 AAGATGAGATCAGGCTGTACGGG + Intronic
1067460225 10:46452703-46452725 TAGTTAAGATGAGGTCATACTGG - Intergenic
1067626965 10:47931900-47931922 TAGTTAAGATGAGGTCATACTGG + Intergenic
1068251819 10:54452970-54452992 TAGTTAAGATGAGGTCGTACTGG + Intronic
1069914360 10:71778236-71778258 CAGTGACGATCAGGGTGTAGCGG - Intronic
1071745616 10:88415844-88415866 AAGTTAAGATCAGGTGGTGGAGG + Intronic
1074970153 10:118529526-118529548 AAGTTAAGATGAGGTCATACTGG + Intergenic
1075117674 10:119640559-119640581 TAGTTAAGATGAGGTCATACTGG + Intergenic
1075126342 10:119703033-119703055 AAGTTAAGATGAGGTTTTACTGG + Intergenic
1075148904 10:119908471-119908493 TAGTTAAGGTGAGGTTTTACTGG + Intronic
1075330345 10:121569621-121569643 CAGTTTTGATCTGGTTTTACTGG - Intronic
1075832264 10:125421592-125421614 CACTTAAGATGAGGTCATACTGG - Intergenic
1076087107 10:127642922-127642944 TAGTTAAGATGAAGTTGTACTGG - Intergenic
1076194209 10:128503836-128503858 AAGTTAAGATGAGGTTATAGTGG - Intergenic
1077274322 11:1696557-1696579 AAGTTAAGATGAGGTTGTACTGG + Intergenic
1077810234 11:5629325-5629347 AAGTTAAGATGAGGTCATACTGG - Intronic
1078273994 11:9825134-9825156 TAGTTAAGATGAGGTCATACTGG + Intronic
1078642815 11:13112144-13112166 CACTCAAGATCAAGTCGTACTGG + Intergenic
1079271272 11:18988156-18988178 CAGTTCACATCAGGGTGTCCAGG - Intergenic
1079756943 11:24275762-24275784 AAGTTAAGATTGAGTTGTACTGG - Intergenic
1079936028 11:26617297-26617319 AACTTAAGAGCAAGTTGTACTGG - Intronic
1080087335 11:28300019-28300041 AAGTTAAGATTAGGATATACTGG - Intronic
1080295520 11:30722959-30722981 AAGTTAAGATGAGGTCATACTGG + Intergenic
1080848041 11:36043548-36043570 TAGTTAAGATGAGGTTGTACTGG + Intronic
1081109043 11:39109049-39109071 TAGTTAAGATGAGGTAATACTGG - Intergenic
1081121808 11:39276087-39276109 TAGTTAAGATGAGGTCATACTGG + Intergenic
1083700689 11:64475844-64475866 CAGTTAAGATTAGGTCATACTGG - Intergenic
1085707648 11:78800980-78801002 TAGCTAAGATAAGGTTGTAAAGG + Intronic
1086184281 11:83995029-83995051 AAGTTAAGATGAGGTCGTACTGG - Intronic
1087022684 11:93618946-93618968 AAGTTAAGATGAGGTCATACTGG - Intergenic
1087249235 11:95877610-95877632 TAGTTAAGATGAGGTCATACTGG + Intronic
1087957596 11:104307999-104308021 AAGTTAAAATGAGTTTGTACAGG + Intergenic
1088715493 11:112545574-112545596 CAGTCATGTTCAGGTTGTACAGG - Intergenic
1088801298 11:113309734-113309756 CAGTTAACATTAGGTTTGACTGG + Intergenic
1091854912 12:3731712-3731734 GAGTTAAGATGAGGTCATACTGG + Intronic
1092318880 12:7449777-7449799 CAGTTAAAATGAGGCTATACTGG - Intronic
1093023734 12:14227022-14227044 CAGTTAACATCATATTGAACAGG - Intergenic
1093099418 12:15009773-15009795 TAGTTAAGATGAGGTTTTGCTGG - Intergenic
1093195966 12:16129888-16129910 AAGTTAAGATGAAGTCGTACTGG + Intergenic
1093196150 12:16131710-16131732 TAGTTAAGATGAGGTCATACTGG - Intergenic
1093731661 12:22572219-22572241 TAGTTAAGATGAGGTAATACTGG - Intergenic
1094318718 12:29160835-29160857 TAGTTAAGATGAGGTCATACTGG - Intronic
1095396416 12:41767331-41767353 CAGTTAAGACAAGGATGTAGAGG + Intergenic
1096415388 12:51408092-51408114 CAGTTAAGATGAGGTCATACTGG - Intronic
1096856966 12:54490179-54490201 CATTTAAGATCAGGTAGTCTTGG + Intergenic
1097350041 12:58538699-58538721 CAGTTAAGATGAGGTCATACTGG + Intergenic
1097495094 12:60321975-60321997 TAGTTAAGATGAGGTCATACTGG + Intergenic
1097523565 12:60700874-60700896 AAGTTAAGATCAGGTTACACTGG - Intergenic
1099501858 12:83423063-83423085 AAGTTAAGATGAGGTCTTACTGG + Intergenic
1099669025 12:85667297-85667319 AAGTTAAGATGAGGTCATACTGG + Intergenic
1100171368 12:91978465-91978487 TAGTTAAGATGAGGTCATACTGG - Intergenic
1101315919 12:103628742-103628764 GAGTTAAGATGAGGTCATACTGG - Intronic
1101322137 12:103681940-103681962 TAGTTAAGATGAGGTCATACTGG - Intronic
1101421839 12:104557060-104557082 AAGTTAAGATAAGGTCATACTGG - Intronic
1101795919 12:107973552-107973574 TAGTTAAGATGAGGTTATACTGG - Intergenic
1101855193 12:108436356-108436378 AAGTTAAGATGAGGTCATACTGG + Intergenic
1102823645 12:115928056-115928078 AAGTTAAGATGAGTTTGCACTGG + Intergenic
1103230434 12:119325981-119326003 CAGTTAAGATGACGTTATCCTGG - Intergenic
1103583987 12:121937371-121937393 TAGTTAAGATGAGGTTGTGCTGG - Intronic
1103746920 12:123131187-123131209 TAGTTAAGGTGAGGTTGCACTGG + Intronic
1103791652 12:123476486-123476508 TAGTTAAGATGAGGTTATGCTGG + Intronic
1103845955 12:123902222-123902244 TAGTTAAGATTAGGTCATACGGG - Intronic
1103870079 12:124085135-124085157 GAGTTAAGATGGGGTTGTATGGG + Intronic
1103895110 12:124267947-124267969 CAGTTAAGGTGAGGTTGTACTGG + Intronic
1104653663 12:130557061-130557083 GAGTTAAGATGAGGTCATACTGG + Intronic
1105641381 13:22268559-22268581 AAGTTAAGATAAGGTCATACTGG - Intergenic
1105713042 13:23031729-23031751 CAGTTAAGATGAGGTCATACCGG + Intergenic
1105914768 13:24903294-24903316 CAGTTAAGATGACGTTATACTGG + Intronic
1105944295 13:25176504-25176526 AAGTTAAGATGAGGTCATACTGG - Intergenic
1106453578 13:29907120-29907142 AAGTTAAGATGAGGTTATACTGG - Intergenic
1107783468 13:43930070-43930092 AAGTTAAGATGAGGTCATACTGG + Intergenic
1108716216 13:53080797-53080819 CAGTTAAGATGAGGTCATACTGG + Intergenic
1109303049 13:60609234-60609256 TAGTTAAGATGAGATTGTACTGG - Intergenic
1111850854 13:93572945-93572967 CAGTTAAGATGAAATTGTCCTGG + Intronic
1111850959 13:93574233-93574255 TAGTTAAGATGAGGTTATACTGG + Intronic
1112174707 13:97010583-97010605 AAGTTAAGATAAGGTTATACTGG - Intergenic
1112374673 13:98827976-98827998 TAGTTAAGATGAGGTCATACTGG + Intronic
1112378047 13:98862336-98862358 AAGTTAAGATGAGGTTATACTGG + Intronic
1112790762 13:103000130-103000152 AAGGTAAGATGAGGTTGTACTGG + Intergenic
1113263301 13:108590564-108590586 TAGTTAAGATCAAGTCATACTGG + Intergenic
1113334221 13:109362856-109362878 TAGTTAAGATGAGGTCATACTGG - Intergenic
1115321708 14:32087245-32087267 CAGTTTTGATCTGGTTGTAAGGG + Intronic
1115475329 14:33807954-33807976 TAGTTAAGATCAGGTCATGCTGG - Intergenic
1115527993 14:34300508-34300530 TAGTTAAGATGAGGTCATACTGG + Intronic
1115962353 14:38849892-38849914 AAGTTTAGATAAGGTTATACTGG + Intergenic
1116459268 14:45152948-45152970 CAGTTAAGATCTAGTTCAACAGG - Intronic
1117100869 14:52345486-52345508 TAATTAAAATCAGGTTGTATTGG + Intergenic
1118138305 14:63051825-63051847 CAGTTCAGGTCAGGTTTTATTGG - Intronic
1118426857 14:65674790-65674812 CAGCAAAGATCTGGTTGTGCAGG + Intronic
1118987546 14:70769831-70769853 AAGTTAAGATGAGGTCATACTGG - Intronic
1119851469 14:77869486-77869508 TAGTTAAGATGAGGTCATACTGG - Intronic
1120486947 14:85126056-85126078 TAGTTAAGATAAGGTCATACTGG + Intergenic
1121378539 14:93437868-93437890 AAGTTAAGATAAGGTCATACTGG - Intronic
1121392765 14:93590162-93590184 CAGTTAAGATGAGTTCCTACTGG - Intronic
1121918751 14:97860665-97860687 CAGTTAAGATGAAGTCATACTGG + Intergenic
1121984140 14:98484608-98484630 AAGTTTAGATGAGGTTGTAAGGG - Intergenic
1122646274 14:103196523-103196545 TAGTTAAGATGAGGTCATACTGG - Intergenic
1122757491 14:103993739-103993761 TAGTTAAGATGAAGTTATACTGG - Intronic
1123879585 15:24664526-24664548 AAGTTAAGATGAAGTTGTCCTGG - Intergenic
1124010203 15:25831985-25832007 TAGTTAAGATAAGGTTATACTGG + Intronic
1128832457 15:70781890-70781912 TAGTTAAGATAAGGTCATACTGG - Intergenic
1130193024 15:81754401-81754423 TAGTTAAGATGAGGTCATACTGG + Intergenic
1130638958 15:85652918-85652940 TAGTTAAGATGAGGTTATACTGG - Intronic
1130717437 15:86348934-86348956 AAGATAAGATGAGGTTATACTGG + Intronic
1130760817 15:86817822-86817844 TAGTTAAGATGAGGTCATACTGG + Intronic
1131017026 15:89066455-89066477 AAGTTAAGATGAGGTCATACTGG - Intergenic
1131489325 15:92848973-92848995 TAGTTAAGATGAGGTCATACTGG + Intergenic
1131586745 15:93703770-93703792 AAGGTAAGGTGAGGTTGTACTGG + Intergenic
1132661092 16:1061851-1061873 GAGTTAAGATGAGGTCGGACGGG + Intergenic
1133403816 16:5507644-5507666 CAGTTAAGATGAGGTCATACTGG + Intergenic
1133517615 16:6524913-6524935 TAGTTAAGATGAGGTCATACTGG - Intronic
1133612754 16:7448842-7448864 TAGTTAAGATGAGATTATACCGG - Intronic
1133935276 16:10264377-10264399 AAGGTAAGATGAGGTTATACGGG + Intergenic
1134759179 16:16698406-16698428 TAGTGAAGATGAGGTTGTACTGG + Intergenic
1134986894 16:18660778-18660800 TAGTGAAGATGAGGTTGTACTGG - Intergenic
1135052903 16:19206815-19206837 GAGTCAAGATGAGGTCGTACAGG - Intronic
1135603145 16:23800538-23800560 TAGTTAAGATGAGGCTGTACAGG + Intergenic
1136244041 16:28963167-28963189 CAATCAAGTTGAGGTTGTACTGG - Intronic
1136469246 16:30467858-30467880 CAGTTAAGATCAGATAATTCAGG - Intergenic
1137631330 16:49947885-49947907 TAGTTAAGATGAGGATATACTGG + Intergenic
1137762708 16:50953449-50953471 TAGTTAAGATGAGGTCATACTGG + Intergenic
1137810087 16:51344314-51344336 CAGGTAAGAACATGTTGTAAGGG - Intergenic
1137890159 16:52152274-52152296 AAGTTAAGATGAGGTCGTACTGG + Intergenic
1137903478 16:52294455-52294477 CAGTTACGATTAGGTCATACTGG - Intergenic
1138304881 16:55965475-55965497 CAGTTAAGATGAGGTCATACTGG - Intergenic
1138896006 16:61205614-61205636 TAGTTAAGACGAGGTTATACTGG - Intergenic
1139011446 16:62639538-62639560 TAGTTAAGATTAGGTCGTATGGG - Intergenic
1139910364 16:70393888-70393910 CAGTTAAGACCAGGTTTCCCAGG - Intronic
1140692123 16:77494575-77494597 AAGTTAAGATGAGGTCATACTGG - Intergenic
1140948300 16:79791819-79791841 AAGTTAAGATAAGATTGTACTGG - Intergenic
1141809873 16:86368661-86368683 TAGTTGAGATGAGGTTATACCGG - Intergenic
1142022437 16:87792063-87792085 TAGTTAAGATGAGGTCGTGCTGG - Intergenic
1144187732 17:12811910-12811932 TAGTTAAGAGAAGGTTGTAGTGG - Intronic
1145178963 17:20728116-20728138 CAGTGAAGATGAGGTCCTACTGG - Intergenic
1147530255 17:41269623-41269645 TAGTTAAGATCAGGTCATATTGG + Intergenic
1150474479 17:65464280-65464302 AAGTTGAGATGAGGCTGTACTGG - Intergenic
1150805242 17:68313536-68313558 AAGTTAAGATGAGGTCATACTGG - Intronic
1151235602 17:72717652-72717674 TAGTTAAGATCAGCTCGTACTGG - Intronic
1151243611 17:72777432-72777454 CAGTCAAGATGAGGTCATACTGG + Intronic
1151250525 17:72830560-72830582 GAGTGAAGATAAGGTTGTAAAGG - Intronic
1151382277 17:73734167-73734189 TAATTAAGATGAGGTTATACTGG - Intergenic
1151991518 17:77577994-77578016 AAGTTAAGATGAGGTCCTACTGG - Intergenic
1152579938 17:81161401-81161423 AAGTTAAGATGAGGTCGGACCGG - Intronic
1153435270 18:5062170-5062192 CAGTTAAAATCAGGTTGTTATGG - Intergenic
1153824446 18:8862633-8862655 CAAGTAGGATCAGTTTGTACAGG - Intergenic
1156177406 18:34563148-34563170 CAGTTAGGATGAGGTCATACTGG + Intronic
1156287919 18:35717182-35717204 CAGTTAAGATAAGGTCATAATGG - Intergenic
1156400081 18:36731980-36732002 AAGTTAAGATGAGGTCATACTGG + Intronic
1156722401 18:40086030-40086052 TAGTTAAGATGAGGTCATACTGG + Intergenic
1157174904 18:45442581-45442603 GAGTTAAGATAAGGTTATAATGG - Intronic
1158033771 18:52999872-52999894 TAGTTAAGATAAGGTAATACTGG + Intronic
1158048695 18:53188940-53188962 TAGTTAAGACAAGGTTATACTGG - Intronic
1158425885 18:57339282-57339304 AAGTTAAGATGAGGTCATACTGG - Intergenic
1158483379 18:57842845-57842867 GAGTTAAGATGAGGTTATACTGG - Intergenic
1158628303 18:59090473-59090495 TAGTTAAGATGAGGTCATACTGG - Intergenic
1158668812 18:59456360-59456382 CAGTTAAGATGAAGTTATACTGG + Intronic
1158889535 18:61859971-61859993 TAGTTAAGATGAGGTTATATTGG + Intronic
1158940372 18:62401868-62401890 AAGTTAAGATGAGGTCATACCGG + Intergenic
1158947242 18:62457678-62457700 TAGTTAAGACGAGGTTATACTGG + Intergenic
1159064566 18:63555580-63555602 AAATTAAGATGAGGTTGTACTGG + Intergenic
1159507096 18:69352406-69352428 TAGTTAAGATGAGGTTATAGTGG - Intergenic
1159644395 18:70900211-70900233 AAGTTAAGATTAGATTATACTGG + Intergenic
1159758997 18:72401574-72401596 AAGTTAAGATGAGGTCATACTGG - Intergenic
1159898811 18:74022793-74022815 CAATTTAGATGAGGTTGCACTGG + Intergenic
1159910666 18:74142707-74142729 TAGTTAAGATGAGGTCATACTGG - Intronic
1159921718 18:74232638-74232660 TAGTTAAGATGAGGTCATACTGG + Intergenic
1160017744 18:75157447-75157469 CAGTTAGGATGAGGTCATACTGG + Intergenic
1160038110 18:75319950-75319972 TAATTAAGATGAGGTCGTACTGG - Intergenic
1160805025 19:988862-988884 AAGTTAAGATGAGGTGGTTCTGG - Intronic
1161232753 19:3183047-3183069 TAGTTAAGATGAGGTCATACTGG - Intergenic
1162077466 19:8197567-8197589 AAGTTAAGATGAGGTTATCCTGG + Intronic
1162840738 19:13354755-13354777 TAGTTAAAATTAGGTTGGACTGG + Intronic
1163048981 19:14666997-14667019 AAGTTAAGATGAGGTCGTACTGG + Intronic
1163400339 19:17088319-17088341 CAGTTAAGATCAGGTTGTACTGG - Intronic
1163496648 19:17649781-17649803 TAGTTAAGATAAGGTCATACTGG + Intronic
1164781297 19:30895757-30895779 CAGTTAAGATGAGGTCGTTAGGG - Intergenic
1166038012 19:40183282-40183304 TAGTTAAGATGAGGTGATACTGG - Intergenic
1168329893 19:55561845-55561867 TAGTTAAGATGAGGCTGTACTGG + Intergenic
925250705 2:2434783-2434805 TAGTTAAGATGAGGTCATACTGG - Intergenic
925265051 2:2561248-2561270 AAGTTAAGATGAGCTTGCACTGG + Intergenic
925748996 2:7070588-7070610 AAGTTAGGATGAGGTTATACTGG + Intergenic
925790033 2:7475338-7475360 TAGTTAAGATGAGGTCATACTGG + Intergenic
926028237 2:9563399-9563421 AAGTTAAGATGAGGTCATACTGG + Intergenic
926820937 2:16851149-16851171 TAGTTAAGATCAGGTCATACTGG + Intergenic
927189949 2:20510699-20510721 TAATTAAGATAAGGTCGTACTGG - Intergenic
927235196 2:20867333-20867355 AAGTTAAGATGAGGTCATACTGG + Intergenic
927327480 2:21821971-21821993 CAGTTAAGAGCAGTTTCTTCTGG + Intergenic
927358541 2:22204466-22204488 TAGTTAAGATGAGGTCATACTGG + Intergenic
927399657 2:22696313-22696335 TAGTTAAGATGAGGTCATACTGG + Intergenic
928308077 2:30187618-30187640 AAGTTAAGATGAGGTCATACTGG + Intergenic
928469396 2:31558635-31558657 TAGTTAAGATGAGGTCATACTGG - Intronic
928518684 2:32066888-32066910 CACTTGAGCTCAGGTTGTTCAGG + Intronic
929403400 2:41611839-41611861 AAGTTGAAATCAGGTTGTAAAGG - Intergenic
930274020 2:49290612-49290634 AAGTTAAGATAAGGTTGTACTGG + Intergenic
931115907 2:59166551-59166573 TAGTTCAGATAAGGTTATACTGG + Intergenic
931687847 2:64809898-64809920 TAATTAAGATCAGGTCATACTGG - Intergenic
932196044 2:69784939-69784961 CAGTTAAGATGAGGTGATACTGG - Intronic
932226948 2:70048962-70048984 AAGTTGAGATGAAGTTGTACTGG - Intergenic
932248624 2:70220052-70220074 TAATTAAGATGAGGTTATACTGG + Intronic
933490803 2:82983919-82983941 TAGTTAAGATGAGGTTTTACTGG - Intergenic
933598739 2:84308489-84308511 CAGTTAAGCTCTGGTTCCACTGG - Intergenic
933850811 2:86365121-86365143 TAGTTAAGATGAGGTCATACTGG + Intergenic
935237982 2:101153715-101153737 TAGTTAAGATCAGGTTATTAGGG + Intronic
935285498 2:101560637-101560659 CAGTTAAGATGAGATCATACAGG + Intergenic
935741691 2:106154411-106154433 TAGTTAAGATAAGGTTATACTGG + Intronic
936615110 2:114040453-114040475 TAGTTAAGATGAGGTTACACTGG - Intergenic
939038757 2:137163345-137163367 AAGTTAAGATTAGGTCATACTGG + Intronic
939475354 2:142679883-142679905 TAGTTAAGATGAGGTCATACTGG + Intergenic
939801501 2:146717118-146717140 TAGTTAAGATGAGGTTATCCTGG + Intergenic
940122832 2:150286641-150286663 AAGTTAAGATGAGGTTATACTGG - Intergenic
941298035 2:163764780-163764802 TAGTTAAGATGAGGTCATACTGG - Intergenic
941398607 2:165003286-165003308 CCCTGAAGATCATGTTGTACTGG + Intergenic
941857564 2:170246442-170246464 CACTTAAGATGAGGTTATACTGG + Intronic
941867047 2:170345748-170345770 TAGTTAAGATGAGGTCATACTGG + Intronic
942513959 2:176732107-176732129 TAGTTAAGATGAGGTTGTGCTGG - Intergenic
942758877 2:179374399-179374421 CAGGTTAGATCAGGTTGGCCAGG + Intergenic
943092628 2:183392722-183392744 AAATTAAGATAAGGTTATACTGG + Intergenic
943533954 2:189123434-189123456 TAGTTAAGATGAGGTCATACTGG + Intronic
945588228 2:211694076-211694098 AAGTTAAGATGAGCTTATACTGG - Intronic
945907362 2:215610082-215610104 GAGTTAAGATGAGGTCATACTGG - Intergenic
946030916 2:216704370-216704392 TAGTTAAGATGAGGTCATACTGG - Intergenic
947500456 2:230667417-230667439 GAGTTAAGATGAGGTCATACTGG - Intergenic
947564928 2:231187669-231187691 TAGTTAAGATCTGGTCATACTGG + Intergenic
948111686 2:235461465-235461487 AAGTTAAGATGAGGTGTTACTGG + Intergenic
1169238238 20:3950253-3950275 TAGTTAAGATGAGGTTATATTGG + Intronic
1169475810 20:5930277-5930299 TAGTTAAGATGAGGTCATACTGG - Intergenic
1169681595 20:8220453-8220475 TAGTTAAGATGAGGTTATATTGG + Intronic
1172174616 20:32964733-32964755 CAGTTAAGATGAAGTTATACTGG - Intergenic
1173481178 20:43400681-43400703 TAGTTAAGATCAGGTCATACTGG - Intergenic
1173572195 20:44084663-44084685 TAGTTAAGATGAGGTCATACTGG + Intergenic
1174634917 20:51990703-51990725 CAGTTATATTCAGGTTTTACAGG - Intergenic
1175098510 20:56561147-56561169 CATTTAAGATGAGGTTATACTGG - Intergenic
1176983338 21:15408106-15408128 TAGTTAAGATGAGGTCATACTGG + Intergenic
1177029056 21:15959479-15959501 ATGTTAAGATCAGGTTATAAAGG + Intergenic
1177126707 21:17203213-17203235 AAGTTAAGATAAGGTCATACTGG + Intergenic
1177802016 21:25837135-25837157 AAGTTAAGATGAGGTCGTACTGG - Intergenic
1178055005 21:28788816-28788838 CAGTTAAGATGAGATCATACTGG + Intergenic
1178326664 21:31651980-31652002 TAGTTAAGATAAGGTCATACTGG - Intergenic
1178887355 21:36494594-36494616 CAGTTAAAATGAGTTCGTACGGG + Intronic
1179070218 21:38064274-38064296 TAGGTAAGATGAGGTTCTACTGG - Intronic
1179330018 21:40390798-40390820 TAGTTAAGATGAAGTTGTATTGG - Intronic
1179594399 21:42432409-42432431 CAGTTAAGATTAGGTTGGAGAGG - Intronic
1182049453 22:27301708-27301730 AAATTAAGATCAGGTTGCGCTGG + Intergenic
1182412770 22:30201326-30201348 AAGTCAAGATGAGGTTATACTGG - Intergenic
1182897406 22:33870070-33870092 CAGTTAAGATGAGGTCATAGTGG + Intronic
1182903565 22:33919199-33919221 CATTTAAAATCAGATTGTTCTGG + Intronic
1184416716 22:44356110-44356132 TAGTTAAGATAAGGTCGTACTGG + Intergenic
1184605208 22:45569043-45569065 CAGTTAAGATGAGGTCACACTGG - Intronic
949558047 3:5175900-5175922 TAGTTAAGATAAGGTCATACTGG - Intronic
951145232 3:19218923-19218945 TAGTTAAAATGAGGTTATACTGG - Intronic
951520181 3:23604163-23604185 TAGTTAAGATCAGGTCACACTGG + Intergenic
952498073 3:33933664-33933686 CAGTTCAGATGAGGTCATACTGG + Intergenic
952872756 3:37916452-37916474 TAGTTAAGGTAAGGTCGTACTGG + Intronic
953267892 3:41410931-41410953 TAGTTAAGATGAAGTTATACTGG - Intronic
954195980 3:48997512-48997534 CAGTGAAGGTCAGGTTCTCCAGG - Intronic
955640801 3:61081751-61081773 TAGTTAAGATGAGGTCATACTGG - Intronic
956600061 3:71011073-71011095 GAGTTAAAATCATGTTGTAGAGG + Intronic
957657297 3:83096986-83097008 TACTTAAGATTAGGTCGTACTGG - Intergenic
958106408 3:89079367-89079389 CAGTTAAGAGTAGGAGGTACAGG - Intergenic
958492404 3:94794010-94794032 TAGTTAAGAGAAGGCTGTACTGG + Intergenic
958568154 3:95842551-95842573 CAGCTAACATCATGTTGAACAGG + Intergenic
959312650 3:104759708-104759730 TAGTTAAGATGAGGTCATACTGG + Intergenic
959519128 3:107305896-107305918 TAGTTAAGATGAGGTCATACTGG - Intergenic
961352871 3:126315223-126315245 TATTTAAGATGAGGTTGCACTGG - Intergenic
962313407 3:134342010-134342032 AAGTTAAGATGAGGTCATACAGG + Intergenic
962360108 3:134733522-134733544 CAATTAAGATGAGGTTATACTGG + Intronic
964621100 3:158720856-158720878 AAGTTAAGATGAGGTCATACTGG - Intronic
965410174 3:168320424-168320446 TACTTAAGATGAGGTTGTACTGG + Intergenic
965449471 3:168819812-168819834 TAGTTAAGATGAGGTCATACTGG - Intergenic
965751432 3:171978705-171978727 TAGTTAAGATGAGGTCATACTGG - Intergenic
967102645 3:186228976-186228998 AAGTTAAAATGAGGTTATACCGG + Intronic
967229707 3:187325828-187325850 TAGTTAAGATGAGGTCATACTGG - Intergenic
968937763 4:3621630-3621652 CAGTTAAGATGAGGTCATATTGG + Intergenic
968970094 4:3789221-3789243 CAGGTAAGATGAGTTTATACTGG + Intergenic
969208623 4:5668918-5668940 AAGTTAAGATGAGGTCATACTGG + Intronic
969336854 4:6516038-6516060 TAGTTGAGATCAGGTCATACTGG - Intronic
969359186 4:6650899-6650921 TAGTTAAGATGAGGTTAGACTGG - Intergenic
969681262 4:8644714-8644736 CAGTTAAGAGCAGGTCCTGCTGG - Intergenic
970033238 4:11701685-11701707 TAGTTATGATGGGGTTGTACTGG - Intergenic
970448008 4:16140052-16140074 CAGTTAGAATGAGGTTGTAGTGG + Intergenic
971225814 4:24750618-24750640 TAGTTAAGATGAGGTCGTACTGG + Intergenic
971716113 4:30179170-30179192 TAGTTAAGATGAGGTTATACTGG - Intergenic
971841134 4:31853751-31853773 CAGTTAAGATGAGATCATACTGG + Intergenic
972365721 4:38372584-38372606 TAGTTAAGATGAGGTCATACTGG + Intergenic
973095427 4:46192211-46192233 AAGTTAAGATGAGGTCATACTGG - Intergenic
973621202 4:52727869-52727891 TAGTTAAGATGAGGTCGTACCGG + Intronic
973829445 4:54743490-54743512 TAGTTAAGATGAAGTTGTACTGG - Intergenic
973878956 4:55249594-55249616 TAGTTAAGATGAGGTCATACTGG + Intergenic
973951201 4:56016002-56016024 AAGTTAAGATGAGGTTGTGCTGG + Intronic
974435241 4:61848516-61848538 CAATTAAGATGAGGTCATACTGG - Intronic
974736637 4:65943403-65943425 AAGTTAAGATGAAGTTCTACTGG - Intergenic
976366341 4:84237191-84237213 TAGTTAAGATGAGGTCATACTGG + Intergenic
977048947 4:92102702-92102724 TAGTTAAGATGAGGTTATATTGG - Intergenic
977432107 4:96943306-96943328 TAGTTAAGATGAAGTTATACGGG + Intergenic
977907844 4:102499091-102499113 AAGTTAAGATGAGGTAATACTGG + Intergenic
979357930 4:119727765-119727787 TAGTTAAGATGAGGTCATACTGG - Intergenic
979458460 4:120952847-120952869 TAGTTAAGATCAGGTCATAGTGG - Intergenic
979552827 4:122010189-122010211 TAGTTAAGATGAGGTTGTACTGG - Intergenic
981368831 4:143934917-143934939 CATTTATGATCAGATTGTTCTGG - Intergenic
981767013 4:148262663-148262685 TAGTTAAGATGAGGTCATACTGG + Intronic
983251986 4:165355648-165355670 GAGTTAAGATGAGGTAATACGGG - Intergenic
983288437 4:165769645-165769667 TAGTTAAGATAAGGTAGTGCAGG + Intergenic
983495381 4:168437230-168437252 AAGTTAAGATAAGGTTATTCTGG + Intronic
983653314 4:170055072-170055094 TAGTTAAGATGAGGTCATACTGG + Intergenic
984821841 4:183889219-183889241 TAGTTAAGAGGAGGTTGTACTGG + Intronic
985305793 4:188538243-188538265 TAGCTAAGATGAGGTTGTAGTGG + Intergenic
986284318 5:6348502-6348524 AAGTTAAGATGAGGTTATACTGG - Intergenic
986477151 5:8146221-8146243 TAGTTAAGATGAGGTCATACTGG + Intergenic
986666401 5:10108453-10108475 CAGTTAAGATGAGGGCGTACTGG - Intergenic
986689213 5:10300098-10300120 TAGTTAAGATGAGGTCATACTGG + Intronic
986734947 5:10661715-10661737 AAGTTAGGATGAGGTTGCACTGG - Intergenic
986804118 5:11292298-11292320 TAGTTAAGATGAGGTCATACTGG + Intronic
987213759 5:15711437-15711459 TAGTTAAGATGAAGTTTTACTGG - Intronic
987263695 5:16229338-16229360 AAGTTAAGATAAGGTCATACTGG - Intergenic
987266926 5:16265598-16265620 TAGTTAAGATGAGGTCATACTGG - Intergenic
988288930 5:29259502-29259524 CTGTTAAGATGAGGTTATACTGG + Intergenic
988322123 5:29712451-29712473 TAGTTAAGATGAGGTCATACTGG + Intergenic
988939943 5:36134487-36134509 AAGTTAAGATGAGGTTATACTGG + Intronic
991085062 5:62641098-62641120 TAGTTAAGATGAGGTCATACTGG - Intergenic
991388897 5:66121443-66121465 TAGTTAAGATGAGGTCATACTGG + Intergenic
992364803 5:76081032-76081054 CATTTAAGACCAGGTTGCACTGG - Intergenic
992367207 5:76105057-76105079 TAGTTAAGATGAGGTCATACTGG + Intronic
992830480 5:80588948-80588970 CAGCTAATATCAGGTTGTAATGG - Intergenic
992936134 5:81707339-81707361 CAGTTAAGATGAGGTCATATAGG + Intronic
994196478 5:96928373-96928395 TAGTTAAGATAAGGTCATACTGG + Intronic
994204420 5:97018033-97018055 AAGTTAAGATGAGGTCATACTGG - Intronic
994975089 5:106792879-106792901 CAGTTAGGAGCTGGTTGTAATGG - Intergenic
995154151 5:108890638-108890660 TAGTTAAGATGAGATTATACAGG - Intronic
998022745 5:138784923-138784945 AAGTTACGATGAGGTTATACTGG - Intronic
998637507 5:143972243-143972265 AAGTTAAGATGAGGTCATACTGG - Intergenic
1000841854 5:166230131-166230153 AAGTTAAGATGAGGTCATACTGG + Intergenic
1001720310 5:173851755-173851777 TAGTTAAGATGAGGTCATACTGG + Intergenic
1001772420 5:174306200-174306222 CAGTGAAGATCAGATTGGAGGGG + Intergenic
1002335485 5:178475143-178475165 AAGGTAAGATGAGGTTGTACTGG - Intronic
1003612668 6:7627668-7627690 AAGTTAAGATGAGGTCATACTGG - Intergenic
1003764209 6:9216998-9217020 CATTCAAGAGCAGGTTGTTCAGG - Intergenic
1003939172 6:11007311-11007333 TAGCTAAGATGAGGTTATACTGG + Intronic
1004299828 6:14447125-14447147 TAGTTAAGATGAGGTAATACTGG - Intergenic
1004470170 6:15921972-15921994 AAGTTAAGATGAGGTCCTACTGG + Intergenic
1004675670 6:17839645-17839667 CAGTTAAGATGAGATCATACTGG + Intronic
1005617141 6:27584542-27584564 TAGTTAAGATGAGGTCATACTGG - Intergenic
1005675099 6:28145849-28145871 AAGTTAAGATGAAGTTATACTGG - Intronic
1007375762 6:41455597-41455619 CAGTTAAGATGAGGTCATACTGG + Intergenic
1007666707 6:43517790-43517812 CAGTGAAGTTCAGGATATACAGG + Intronic
1008179967 6:48316218-48316240 CAATTAGGGTCAGGTTATACAGG + Intergenic
1008190112 6:48445722-48445744 CAGAAAAGATCTGGTTGTGCAGG + Intergenic
1008526541 6:52412973-52412995 CAGTTAAGATGAGGTCATACTGG + Intergenic
1010274792 6:73956814-73956836 AAATTAAGATGAGGTTATACTGG + Intergenic
1010860598 6:80905493-80905515 CAGTTAAGATGAGATCATACTGG + Intergenic
1010977184 6:82329207-82329229 TAGTTAAGATGAGGTCATACTGG + Intergenic
1011314257 6:86014318-86014340 AAGTTAAAATGAGGTTGTTCAGG + Intergenic
1011759083 6:90540086-90540108 CAATTAAGTTCAGGTTCTTCAGG + Intronic
1012167437 6:95975441-95975463 TAGTTAAGATGAGGTCATACTGG + Intergenic
1014726313 6:124976207-124976229 CAGTTAAGTTCATGTATTACCGG + Intronic
1015393991 6:132714944-132714966 TAGTTAAGATGAAGTTATACTGG - Intergenic
1015403280 6:132810952-132810974 TAGTTAAGATGAGGTTTTACTGG + Intergenic
1016372848 6:143392587-143392609 TAGTTAAGATGAGGTCATACTGG - Intergenic
1017331290 6:153200516-153200538 TAGTTAAGATGAGATCGTACTGG - Intergenic
1018035451 6:159877561-159877583 TAGTTAAGATGAGGTCATACTGG + Intergenic
1018244367 6:161807791-161807813 AAGTTAAGATGAGGTTTTACTGG - Intronic
1018367008 6:163130943-163130965 TAGTTAAGATAAGGTCCTACTGG + Intronic
1018568650 6:165184231-165184253 AAGTTAAGATAAGGTACTACTGG - Intergenic
1019730829 7:2628554-2628576 CAGTGAAGATGAGGTCATACTGG - Intergenic
1019828933 7:3306559-3306581 CAGTTAAGTTTAGGCTATACTGG + Intronic
1021816140 7:24449310-24449332 GAGTTAAGATGAGGTCATACTGG - Intergenic
1022387883 7:29918445-29918467 TAGTTAAGATGAGGTCATACTGG + Intergenic
1023059422 7:36313971-36313993 CAATTAAGATAAGGTCCTACTGG + Intergenic
1024379777 7:48683162-48683184 TAGTTAAGATGAGGTCATACTGG - Intergenic
1024410187 7:49031533-49031555 AAGTTAAGATGAGGTTATACTGG + Intergenic
1024538063 7:50454690-50454712 CAGTTAAGATGAGGTCCTTCTGG + Intronic
1028075729 7:86512662-86512684 CAGTTAACATCATATTGAACAGG - Intergenic
1029884671 7:103855861-103855883 AAGTGAAGATGAGGTTATACTGG - Intronic
1030317814 7:108134123-108134145 TAGTAAAGATCAGGTTGTTGGGG + Intergenic
1030318034 7:108136472-108136494 AAGTTAAGATGAGGTCATACTGG + Intergenic
1031119209 7:117701727-117701749 TAATTAAGATAAGGTGGTACTGG - Intronic
1031172239 7:118307044-118307066 TAGTTAAGATGAGGTCATACTGG - Intergenic
1031872189 7:127099881-127099903 TAGTTAAGATGAGGTCATACTGG + Intronic
1031914969 7:127554411-127554433 TAGTTAAGATGAGGTCATACTGG - Intergenic
1032088194 7:128894498-128894520 TAGTTAAGATGAGGTCATACTGG + Intronic
1032672612 7:134099142-134099164 TAGTTAAGATGAGGTCATACTGG + Intergenic
1032934504 7:136713298-136713320 TAGTTAAGATGAGGTCATACTGG + Intergenic
1033069110 7:138185788-138185810 AAGATAAAATGAGGTTGTACTGG - Intergenic
1033261827 7:139850648-139850670 AAGTTAAGATGAGGTCCTACTGG + Intronic
1033414420 7:141149580-141149602 AAGTTAAGATGAGGTCATACTGG + Intronic
1033592084 7:142817710-142817732 TAGTTAAGATGAGGTCATACTGG - Intergenic
1034167881 7:149039560-149039582 AAATTAAGATGAGGTTGTATTGG + Intergenic
1034988064 7:155529699-155529721 CAGTTAAGATGAGGTCATACTGG - Intronic
1035130313 7:156646488-156646510 TAGTTAAGATGAGGTCATACTGG - Intronic
1035206665 7:157298113-157298135 TAGTTAAGAAGAGGTTGTATTGG + Intergenic
1035972829 8:4270595-4270617 GAGTCAAAATCAGGTTGAACAGG - Intronic
1036161108 8:6389223-6389245 TAGTTAAGATAAGGTGATACTGG + Intergenic
1036179913 8:6575690-6575712 CAGTTAAGATAGGGTCATACTGG + Intronic
1037161165 8:15774322-15774344 TAGTTAAGATGAGGTCATACTGG + Intergenic
1037345219 8:17891509-17891531 GAGTTAAGATGAGGTCATACTGG - Intronic
1037462676 8:19128657-19128679 TAGTTAAGATGAGGTCATACTGG - Intergenic
1038482579 8:27911833-27911855 TAGTTAAGATGAGGTTATATTGG + Intronic
1039405738 8:37310939-37310961 CAGTTTATATCATGTTGTAATGG - Intergenic
1040889640 8:52303410-52303432 CAGTTAAGATAAGGTCATGCTGG - Intronic
1042458050 8:69028810-69028832 GAGTTAAGATGAGGTTGGACAGG + Intergenic
1042711256 8:71719898-71719920 AAGTTAAGATGAGGTCATACTGG - Intergenic
1042874147 8:73425229-73425251 TAGTTAAGATGAGGTCATACTGG + Intronic
1043182491 8:77103677-77103699 TAGTTAAGATGAGGTCATACTGG - Intergenic
1043754795 8:83989493-83989515 CAAATAAGTTCAGGTAGTACTGG - Intergenic
1043924784 8:86024683-86024705 TAGTTAAGATAAGGTCATACTGG + Intronic
1044773310 8:95660717-95660739 TAGTTAAGATGAGGTCATACTGG + Intergenic
1044963318 8:97552261-97552283 CAGTTAAGATGAGGTTGTACTGG - Intergenic
1046109422 8:109704039-109704061 CAGTTAACATCAGGGTGTCAAGG - Intergenic
1046409322 8:113818466-113818488 CAGTTAACATCATATTGGACAGG + Intergenic
1047388047 8:124427598-124427620 TAGTTAAGATGAGGTTATACTGG - Intergenic
1048133634 8:131724487-131724509 CAGTTAAGATAAGGTCATACTGG + Intergenic
1048768903 8:137874068-137874090 TAGTTAAGATGAGGTAATACTGG + Intergenic
1049026579 8:139995185-139995207 CAGTTGAGGCCAGGTGGTACTGG - Intronic
1049672080 8:143874391-143874413 CAGTTAAGGTGAGGTCATACCGG + Intronic
1050032392 9:1400339-1400361 GAGTTAAGATGAGGTCATACTGG - Intergenic
1050046998 9:1557299-1557321 TAGTTAAGATGAGGTTATACTGG + Intergenic
1050308692 9:4331354-4331376 TAGTTAAGATGAGGTTGTAGTGG - Intronic
1050351498 9:4744421-4744443 TAGTTAAGATCAGGTCATAGTGG + Intergenic
1050366861 9:4880805-4880827 TAGATAAGATGAGGTTATACTGG - Intronic
1050921223 9:11203241-11203263 TAGTTAAGATGAGGTCATACTGG + Intergenic
1051665309 9:19463089-19463111 TAGTTAAGATGAGGTCATACTGG - Intergenic
1051888140 9:21916250-21916272 CAGTTAAGATGAGGTCATACCGG + Intronic
1052071667 9:24089528-24089550 TAGTTAAGATGAGGTCATACTGG + Intergenic
1052158970 9:25231253-25231275 TAGTTAAGATGAGGTCATACTGG + Intergenic
1052222974 9:26049915-26049937 AAGTTAAGATGAGGTTATGCTGG - Intergenic
1052353035 9:27476520-27476542 CAGTTAACATGAGGTCATACTGG - Intronic
1054760356 9:68999216-68999238 TAGTTAAGATGAGGTCATACTGG - Intronic
1054810307 9:69429040-69429062 CCGTTATGTGCAGGTTGTACAGG + Exonic
1055858352 9:80718911-80718933 AAGTTAAGATGAAGTAGTACTGG - Intergenic
1056501073 9:87209953-87209975 CAATTAAGATGAGGTCGTACTGG + Intergenic
1056545785 9:87612299-87612321 TAGTTAAGATGAGGTCATACTGG + Intronic
1056593801 9:87988295-87988317 TAATTAAGATCAGGTAGTACTGG - Intergenic
1056850717 9:90081485-90081507 AAGATAAGATCAGGATGCACTGG - Intergenic
1057282652 9:93723922-93723944 TAGTTAAGATGAGGTCATACTGG - Intergenic
1058580769 9:106454084-106454106 CAGTTAAAATGAGGTAATACAGG - Intergenic
1059473015 9:114521370-114521392 TAGTTAAGATGAGGTCCTACTGG - Intergenic
1059613655 9:115925598-115925620 GAGTTAAGACCAGGCTGTATGGG - Intergenic
1060050948 9:120377727-120377749 TAGTTAAGATGAGGTCATACTGG - Intergenic
1061763068 9:132863715-132863737 CATTTAAGATCAGGTTCTCCAGG + Exonic
1185512545 X:674216-674238 AGGTTGAGATGAGGTTGTACTGG - Intergenic
1185666470 X:1769151-1769173 TCGTTAAGATGAGGTTGCACTGG + Intergenic
1186505863 X:10091587-10091609 TAGTTAAGATGAGGTCATACTGG - Intronic
1186907848 X:14131076-14131098 TAGTTAAGATGAGGTCATACTGG - Intergenic
1186981097 X:14958357-14958379 CAGTAAAGATGAGGTCATACTGG + Intergenic
1187566419 X:20454081-20454103 AAGTTAAGATGAGGTCGTAGTGG - Intergenic
1187928358 X:24271207-24271229 CAGTTAAAATGAGGTGATACTGG - Intergenic
1188293692 X:28419048-28419070 CAGTGAAGATAAGGTTATACTGG + Intergenic
1188362525 X:29273485-29273507 AAGTTAAGATCTTGCTGTACTGG + Intronic
1189061526 X:37758614-37758636 TAGTTAAGATAAGGTCATACTGG - Intronic
1189246044 X:39564344-39564366 AAGTTAAGATGAGGTCATACTGG - Intergenic
1189305504 X:39984004-39984026 AAGTTAAGATGAGGTCATACTGG - Intergenic
1189343218 X:40220368-40220390 CAGCTAAGACCAGGTTACACTGG - Intergenic
1189629885 X:42941823-42941845 AAATTAAGATGAGGTTGTAATGG - Intergenic
1190372189 X:49753394-49753416 AAGTTAAGATGAGGTTATTCTGG + Intergenic
1193773013 X:85609935-85609957 TAGTTAAGATGAGGTCATACTGG + Intergenic
1194349862 X:92812879-92812901 CAATTTAGATCAGGTTGTAAAGG + Intergenic
1194592373 X:95815217-95815239 GAGTTAAGATAAAGTTATACTGG - Intergenic
1195027198 X:100889301-100889323 TAGTTAAGATGAGGTCATACTGG + Intergenic
1195900505 X:109792658-109792680 TAGTTAAGATAAGGTCATACTGG - Intergenic
1197121335 X:122896803-122896825 CAGTTTAGTTCATGATGTACAGG + Intergenic
1197780929 X:130159165-130159187 CAGTTCAGGTCAGGTTTTACTGG + Intronic
1197814286 X:130480573-130480595 CAGTTAATCTCAGGTTTTACAGG - Intergenic
1198211360 X:134519318-134519340 AAGTTAAGATGAGGTCATACTGG - Intronic
1198284140 X:135173067-135173089 AAGTTAAGATGAGGTCCTACAGG - Intergenic
1199062669 X:143377109-143377131 CAGTGAAGTCCAGGTTGTAGTGG - Intergenic
1199122851 X:144077494-144077516 CAGTTAAGCTCAGTTTTTAAGGG - Intergenic
1199141690 X:144320992-144321014 TAGTTAAGATGAGGTCTTACTGG + Intergenic
1199493371 X:148425967-148425989 TAGTTAAGATGAGGTCATACTGG - Intergenic
1199593746 X:149490989-149491011 TAGTTAAGATCAGGTCATATTGG - Intronic
1199694239 X:150332188-150332210 CAGTTCAGATGAGGTCATACAGG + Intergenic
1199697744 X:150355129-150355151 TAGTTAAGATGTGGTTATACTGG + Intergenic
1199981284 X:152921888-152921910 CAGGTAAGATGAGGTCATACTGG - Intronic
1200326668 X:155247698-155247720 TAGTTAAGATGAGGTCATACTGG - Intergenic
1200457352 Y:3409110-3409132 CAGATAAGCTAAGGTTGCACGGG - Intergenic
1200658183 Y:5929507-5929529 CAATTTAGATCAGGTTGTAAAGG + Intergenic
1201576962 Y:15471072-15471094 AAGTTAAGATGAGGTCATACGGG + Intergenic
1202141706 Y:21731193-21731215 CAGTCATGTTCAGGTTGTTCAGG - Intergenic
1202145159 Y:21772609-21772631 CAGTCATGTTCAGGTTGTTCAGG + Intergenic