ID: 1163401740

View in Genome Browser
Species Human (GRCh38)
Location 19:17098052-17098074
Sequence GTGAAGAAAAAAAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1671
Summary {0: 1, 1: 0, 2: 10, 3: 148, 4: 1512}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163401740_1163401747 3 Left 1163401740 19:17098052-17098074 CCCCCCACCTTTTTTTTCTTCAC 0: 1
1: 0
2: 10
3: 148
4: 1512
Right 1163401747 19:17098078-17098100 GGAGTCTCACTCTGTCGCCCAGG 0: 7932
1: 55019
2: 107113
3: 150256
4: 160143
1163401740_1163401748 17 Left 1163401740 19:17098052-17098074 CCCCCCACCTTTTTTTTCTTCAC 0: 1
1: 0
2: 10
3: 148
4: 1512
Right 1163401748 19:17098092-17098114 TCGCCCAGGCCAGAATGCAGTGG 0: 14
1: 589
2: 8566
3: 93745
4: 247219
1163401740_1163401752 28 Left 1163401740 19:17098052-17098074 CCCCCCACCTTTTTTTTCTTCAC 0: 1
1: 0
2: 10
3: 148
4: 1512
Right 1163401752 19:17098103-17098125 AGAATGCAGTGGCATGATTGCGG 0: 2
1: 25
2: 278
3: 4259
4: 32600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163401740 Original CRISPR GTGAAGAAAAAAAAGGTGGG GGG (reversed) Intronic
900546778 1:3233891-3233913 TAAAAAAAAAAAAAGGTGGGGGG + Intronic
900676578 1:3891060-3891082 GTCAAGAAAAAAAATGTAAGGGG + Intronic
901355187 1:8640266-8640288 GTTTAAAAAAAAAAGTTGGGAGG - Intronic
901376246 1:8841616-8841638 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
901485706 1:9559535-9559557 AGGCAAAAAAAAAAGGTGGGGGG + Intronic
902189270 1:14750006-14750028 ATGACCAAAAAAAAGGTGGGGGG + Intronic
902314601 1:15608676-15608698 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
902371096 1:16007251-16007273 AAAAAAAAAAAAAAGGTGGGGGG + Exonic
902441852 1:16435615-16435637 CTGAAAAAAAAAAAAGGGGGGGG - Intronic
902730938 1:18368514-18368536 AAGAAAAAAAAAAAGTTGGGGGG + Intronic
902782431 1:18713079-18713101 CTCAAGAAAAAAAAGGGGAGGGG + Intronic
902825888 1:18974036-18974058 GTGAGGAGGAAAAAGATGGGAGG - Intergenic
903099397 1:21015068-21015090 GTTTAAAAAAAAAAGGAGGGGGG + Intronic
903128684 1:21264313-21264335 GTCAAAAAAAAAAAAGGGGGGGG - Intronic
903185895 1:21628887-21628909 CAGAAAAAAAAAAAGGAGGGGGG + Intronic
903202841 1:21756538-21756560 TCCAAGAAGAAAAAGGTGGGTGG - Exonic
903375912 1:22865925-22865947 GTGAAGGAAAGAAGGGTGGGGGG - Intronic
903412271 1:23154906-23154928 GTGATGGAAAAATAGATGGGAGG - Intronic
903416185 1:23184813-23184835 GTGCAGAAATCAAAGGTGGGTGG - Intergenic
903502252 1:23807406-23807428 GAGAGGAAAAAAAAAGTGGCTGG + Intronic
903572085 1:24313425-24313447 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903772170 1:25770805-25770827 GAGAAGAAAGAAAATGGGGGTGG - Intronic
903999246 1:27329198-27329220 AAAAAAAAAAAAAAGGTGGGCGG - Intronic
904007276 1:27370001-27370023 GAAAAAAAAAAAAAGGCGGGGGG - Intronic
904104715 1:28069575-28069597 AAGAAGAAAAAAAAAGAGGGTGG + Intronic
904122897 1:28214033-28214055 TTTAAGAAAAAAAGGCTGGGGGG + Intronic
904136379 1:28315816-28315838 GTTAAAAAAAAAAGGGGGGGGGG - Intergenic
904350441 1:29901867-29901889 GGGAAGGAAGAACAGGTGGGTGG + Intergenic
904470140 1:30730867-30730889 GAGTAGAAAAAAAAGGTGCTTGG + Intergenic
904736300 1:32636694-32636716 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
904935541 1:34127366-34127388 GAGAAGAAAAATAAAATGGGAGG + Intronic
904981067 1:34502214-34502236 AAGAAGCAAAAAATGGTGGGGGG - Intergenic
905142262 1:35856817-35856839 CTCAAAAAAAAAAAGGGGGGGGG + Exonic
905584681 1:39106803-39106825 CACAAGAAAAAAAAAGTGGGGGG - Intronic
905783435 1:40733011-40733033 GGAAAAAAAAAAAAGGGGGGGGG - Intronic
905866294 1:41378579-41378601 GTGTATAAAGAAAATGTGGGTGG + Intronic
906028438 1:42696514-42696536 TTAAGGAAAAAAAAGGGGGGGGG - Intronic
906028439 1:42696515-42696537 GTTAAGGAAAAAAAAGGGGGGGG - Intronic
906265405 1:44425008-44425030 GTAAAGAAATAAAAGTTGGAGGG + Intronic
906961988 1:50424378-50424400 GAAAAGAAAAAAAAAGGGGGGGG - Intergenic
907091700 1:51731048-51731070 CACAAAAAAAAAAAGGTGGGGGG - Intronic
907183656 1:52592141-52592163 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
907231525 1:53003821-53003843 GTGAAGAAAGAAAAAGGGGCTGG - Intronic
907288612 1:53397950-53397972 TCAAACAAAAAAAAGGTGGGGGG + Intergenic
907319112 1:53591831-53591853 ATGAAGAAACAAAGGTTGGGTGG - Intronic
907823095 1:57989908-57989930 GAGAAGAAAAGAAAGGAGGTGGG - Intronic
907987825 1:59550304-59550326 GAAAAGCAAGAAAAGGTGGGAGG - Intronic
908212398 1:61914559-61914581 GTGACAAAAAAAGGGGTGGGGGG - Intronic
908413264 1:63887297-63887319 CTGAAGAAAGAAGAGGAGGGTGG + Intronic
908696092 1:66843199-66843221 CAAAAAAAAAAAAAGGTGGGGGG + Intronic
908742970 1:67347785-67347807 GAGAAGGAAAAAGAGGTGGCAGG + Intronic
908793003 1:67801959-67801981 GTGAGGAAGAAAAAGGAGGGAGG + Intronic
909624949 1:77705114-77705136 GTTTAAAAAAAAAAGGGGGGGGG + Intronic
909907057 1:81209869-81209891 CTTAAAAAAAAAAAGGTGGCTGG - Intergenic
910026599 1:82662151-82662173 GTGAAGAAAAGAAGGGAGAGAGG + Intergenic
910040403 1:82844375-82844397 GGGAAGAAAAAAGGGGTGGTTGG + Intergenic
910243140 1:85109924-85109946 AGGAAGAAAAAAAAGGAGGTGGG + Intronic
910402062 1:86847356-86847378 CTCAAAAAAAAAAAGGTGTGTGG - Intergenic
910570628 1:88698261-88698283 GGGAAGAAAGAAAAGGGGGGTGG - Intronic
910758725 1:90716101-90716123 GTTAAGAAAATAAAGTGGGGGGG + Intronic
910808205 1:91209828-91209850 TTAGAAAAAAAAAAGGTGGGGGG - Intergenic
910912323 1:92249991-92250013 AAGAAAAAAAAAAAGTTGGGGGG - Intronic
910988191 1:93027002-93027024 TTAAAAAAAAAAAAAGTGGGAGG + Intergenic
911117680 1:94263393-94263415 GTTAAAAAAAAAAAGGTTTGGGG + Intronic
911182945 1:94877124-94877146 GTGTTTAAAAAAAAGGTCGGGGG + Intronic
911219262 1:95229986-95230008 GAGAAAAAAAAAGAGGTAGGAGG - Intronic
911231188 1:95363165-95363187 GGGAAGGAAATAAAGCTGGGTGG + Intergenic
911674709 1:100646638-100646660 GAGAAGAAAGAAAAGCAGGGTGG + Intergenic
912056683 1:105608641-105608663 ATGAGGAACAAAATGGTGGGTGG + Intergenic
912203706 1:107486718-107486740 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
912311921 1:108631542-108631564 GAGAATAAAAAATAAGTGGGGGG + Intronic
912426217 1:109593948-109593970 GTTTACAAAAAAAAGGTTGGTGG + Exonic
912647045 1:111403024-111403046 CTGCAGAGAAAAAAGGTGGCTGG + Intergenic
913304992 1:117419354-117419376 AGGAAGGAAAAAAGGGTGGGAGG - Intronic
913440204 1:118888913-118888935 GAAAAAAAAAAAAAGGTGGGGGG + Intronic
913692352 1:121291110-121291132 GCAAAAAAAAAAAAAGTGGGGGG + Intronic
914229799 1:145755235-145755257 CTCAAAAAAAAAAAGGTGGGGGG + Intronic
914245223 1:145880667-145880689 GTGAAGAAAAATAGGGTCTGTGG + Intronic
914351900 1:146847230-146847252 TTGAAGAAGGAAAAGGTGGGAGG - Intergenic
914502835 1:148262708-148262730 TTGGAGAAAAAAAAATTGGGGGG - Intergenic
914516316 1:148377828-148377850 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914745333 1:150497286-150497308 AAGAGAAAAAAAAAGGTGGGGGG + Intronic
914869426 1:151460181-151460203 GGGAAGAATAAACAGGTGGATGG - Intergenic
914912661 1:151800087-151800109 GTGAGGAAAGTGAAGGTGGGAGG + Intergenic
915110313 1:153560399-153560421 GGAGAGAAATAAAAGGTGGGGGG + Intergenic
915128214 1:153680101-153680123 GGGAAGAGAGAAAATGTGGGAGG - Intronic
915324109 1:155071730-155071752 GGGAAGAAGAAAAAGGGGGGAGG - Intergenic
915606430 1:156954763-156954785 GAGAAGAAAGAAAGGGAGGGAGG + Intronic
915685444 1:157627508-157627530 TTGAAGAAAAAACAGGCAGGAGG + Intergenic
915730984 1:158054238-158054260 GAGAAGAAAAAGAAAGTGGTGGG + Intronic
915772002 1:158435003-158435025 GAAGAGAAAAATAAGGTGGGTGG - Intergenic
915954575 1:160211286-160211308 CAGAAGAAAAAGATGGTGGGGGG + Intronic
916058081 1:161081668-161081690 GTGAGGAACAACAAGGTGTGTGG - Intronic
916410335 1:164541077-164541099 GAAAAGAAAGAAAAGGTGGGGGG + Intergenic
916437483 1:164790553-164790575 GTGAAGTAAAAAAGGATGAGAGG - Intronic
916452100 1:164930539-164930561 GGGAAGAAAGAGAAGGAGGGAGG - Intergenic
916891353 1:169115195-169115217 AAAAAGAAAAAAAAGGGGGGTGG + Intronic
916992204 1:170256176-170256198 GTTGAGAAAAAAGTGGTGGGTGG + Intergenic
917041809 1:170813061-170813083 GGAAAGAAAAAAAAAGGGGGTGG + Intergenic
917311892 1:173687459-173687481 GAGAAGAAAAAAGGGGTGGGGGG - Intergenic
917341276 1:173980262-173980284 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
917952638 1:180056468-180056490 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
918229568 1:182515539-182515561 GTAAAAAAAAAAAAAGGGGGGGG + Intronic
918448847 1:184640146-184640168 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
919228126 1:194735563-194735585 TTGAAGAAAACAATGGTGGGGGG - Intergenic
919358439 1:196557562-196557584 GTGTAGAAAAAAAAAATGGTGGG + Intronic
919782251 1:201228566-201228588 GGGAAGAAAAACAAGGGAGGAGG + Exonic
920776865 1:208947254-208947276 GTAAAGAAAAAGAAGGAAGGAGG + Intergenic
920841939 1:209562418-209562440 ATGAAGAAAAAGCAGGTGGGTGG + Intergenic
920867760 1:209767673-209767695 TTGAAAAAAAAAAAAGAGGGGGG + Intronic
921191065 1:212709085-212709107 CTGAAGGAGAAAAAAGTGGGTGG + Intergenic
921248520 1:213273488-213273510 TTCAAGGAAAAAAAGGGGGGAGG - Exonic
921302190 1:213761997-213762019 ATGAAGAGCAAAATGGTGGGTGG + Intergenic
921564496 1:216700116-216700138 GTTAAAAAAAAAAAGGTGCGGGG - Intronic
921969689 1:221134436-221134458 GTAAAGAGAAAAAAGATGGGAGG - Intergenic
922148275 1:222971402-222971424 ATGAAAAAAAAAAACTTGGGGGG - Intronic
922250678 1:223846109-223846131 GCGAAGAAAGAAAAGGCGGCCGG - Intergenic
922269379 1:224017809-224017831 GAGGAGAAAAAAAAGGTCGGTGG - Intergenic
922404796 1:225300700-225300722 GTCTCAAAAAAAAAGGTGGGGGG + Intronic
922429680 1:225538553-225538575 GTGAAAAAAAAAAGGCGGGGGGG - Intronic
922812808 1:228427130-228427152 GAGAAGAAAAAAAGGAAGGGAGG - Intergenic
922926741 1:229353678-229353700 GTGGAGATAAAAATGGTGGCTGG - Intergenic
923108558 1:230872695-230872717 AAGAAAAAAAAAAAGGTGGGAGG - Intergenic
923219106 1:231876847-231876869 GGGAAGCAAAGAAAGGTGGGAGG - Intronic
923551400 1:234967103-234967125 CTCAAAAAAAAAAAGATGGGGGG + Intergenic
923743254 1:236675400-236675422 GTGAAAAAAGTACAGGTGGGTGG - Intergenic
924106312 1:240652844-240652866 ATTAAGAAAGAAAATGTGGGTGG - Intergenic
924164834 1:241270753-241270775 AAGAAAAAAAAAAAGGGGGGGGG - Intronic
924453578 1:244200126-244200148 GTTAAAAAAAAAAAGGAGGTGGG + Intergenic
924943881 1:248831446-248831468 GTGATGAAAAGCAATGTGGGGGG - Intergenic
1062991668 10:1825162-1825184 GTGGAGAGAAGAAAGCTGGGTGG - Intergenic
1062992526 10:1833561-1833583 GTGAAAAGAACAAAGGTGAGAGG + Intergenic
1063083750 10:2793755-2793777 AGGAAGAAAAAAATGGAGGGAGG - Intergenic
1063778932 10:9298651-9298673 AAGAAGAAAAAAAATGTGTGAGG - Intergenic
1063857253 10:10269046-10269068 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1064118210 10:12596818-12596840 GTCTAAAAAAAAAATGTGGGTGG - Intronic
1064212887 10:13375456-13375478 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1064322440 10:14318321-14318343 GGTAAAAAAAAAAAGGTGGGGGG - Intronic
1064836843 10:19542320-19542342 GTAAGGAAAATAAAGATGGGTGG - Intronic
1064857688 10:19789305-19789327 GAGAAGAAAAAAAACTGGGGGGG - Intronic
1065090385 10:22227338-22227360 AAGAAAAAAAAAAAGGTAGGTGG - Intergenic
1065342423 10:24720993-24721015 GGAAAAAAAAAAAAGGTGAGAGG + Intronic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1065491788 10:26289785-26289807 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1065517617 10:26540279-26540301 GTTAAGAAAAAGAAGGCGAGGGG + Intronic
1065655481 10:27944436-27944458 GTGAGAAAAAAAAAGATGAGTGG + Intronic
1065684525 10:28270519-28270541 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1065745537 10:28837695-28837717 GGGAGGAAAAGAAAGGAGGGAGG + Intergenic
1065860058 10:29864890-29864912 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1065939765 10:30553745-30553767 GAGAAGAAAAAGAAGGGGGTAGG - Intergenic
1066248258 10:33606027-33606049 TTGAAGAAAAACAAAGTTGGAGG - Intergenic
1066339891 10:34521370-34521392 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1066430447 10:35346267-35346289 AGCAAGAAAGAAAAGGTGGGTGG - Intronic
1066505543 10:36038662-36038684 GTGCAGAAAAGGAAAGTGGGGGG - Intergenic
1066555698 10:36610274-36610296 TGAAAGAAAAAAAAGGTGGCCGG - Intergenic
1066576590 10:36832415-36832437 GATAAAAAAAAAAAGGGGGGGGG + Intergenic
1067254911 10:44627822-44627844 GAGAAAAAAAAAAAAGAGGGTGG + Intergenic
1067561412 10:47307298-47307320 GGGAAGAAAAGAGAGGAGGGAGG + Intronic
1068048628 10:51919668-51919690 CTTTAAAAAAAAAAGGTGGGGGG - Intronic
1068110985 10:52680802-52680824 GGAAAGAAAAAAAAGATGGAGGG + Intergenic
1068214493 10:53966432-53966454 GTAAAGAAAGGAAAGGAGGGAGG - Intronic
1068246741 10:54381560-54381582 GTTAAAAATAAAAAGATGGGAGG + Intronic
1068246938 10:54384319-54384341 GTTAAAAAAAAAAAAGGGGGGGG - Intronic
1068311993 10:55290836-55290858 TTGAAAGAAAAAAAGATGGGAGG + Intronic
1068322316 10:55435165-55435187 GTAAAGAAAAATAAGGTGCAAGG + Intronic
1068923249 10:62507749-62507771 GGAAAGAAACAAAGGGTGGGTGG + Intronic
1069396828 10:67998549-67998571 TTGAAAAAAAAAAAAGGGGGGGG + Intronic
1069452902 10:68531471-68531493 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1069510202 10:69036426-69036448 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
1069553632 10:69382406-69382428 GTGGAGAAAGAAAGGGTGGCCGG + Intronic
1069983969 10:72271421-72271443 GTGAATGAAAAAAAGGTGCTTGG + Intergenic
1070005921 10:72424114-72424136 GTCTTAAAAAAAAAGGTGGGGGG - Intronic
1070085719 10:73235354-73235376 TTGGGGAAAGAAAAGGTGGGGGG + Intronic
1070141499 10:73741432-73741454 TAGAAAAAAAAAAAGGTGGGGGG + Intergenic
1070908803 10:80099533-80099555 GAGAAGAAAAGAAAGGAGGGAGG + Intergenic
1071025015 10:81102101-81102123 AGGAAGAGAAAAAAGGTGAGAGG - Intergenic
1071283248 10:84122195-84122217 GAGAAAAAACAAAAGGTGGGGGG - Intergenic
1071332770 10:84576228-84576250 GAGAAGAAAAACGAGGAGGGTGG - Intergenic
1071387303 10:85134318-85134340 GTGAACAAAACAAAGGTGCAAGG - Intergenic
1071585966 10:86821804-86821826 CTCAAGAAACAAAAGGAGGGAGG - Intronic
1071889153 10:89983562-89983584 CTTAAGAAAATAAAGTTGGGCGG + Intergenic
1072237003 10:93462087-93462109 CAAAAAAAAAAAAAGGTGGGGGG - Intronic
1072299719 10:94047478-94047500 GTGAAGTCATAAAAGGCGGGAGG - Intronic
1072423568 10:95310108-95310130 GTGTAGAAAAGCAAGCTGGGAGG + Intergenic
1072522703 10:96242523-96242545 GTGACCAATAAATAGGTGGGTGG + Intronic
1072965024 10:99964469-99964491 CAGGAGAAAAGAAAGGTGGGGGG - Intronic
1073325782 10:102643533-102643555 GAGAAGAAAAGAAAGTGGGGAGG + Intergenic
1073347477 10:102794744-102794766 GTGAAAAAGAAAAAAGTAGGGGG + Intronic
1073479636 10:103778329-103778351 CTCCAGAAAAAAAAGGCGGGGGG + Intronic
1073626021 10:105097933-105097955 GAGAAGAAAACAAAGGACGGTGG - Intronic
1073665092 10:105522622-105522644 GGGAAGAAGAAAGAGATGGGGGG + Intergenic
1074024763 10:109622941-109622963 GTAGAGATAAAAGAGGTGGGGGG - Intergenic
1074215169 10:111377104-111377126 AGGAAGGAAAAAAAAGTGGGGGG + Intergenic
1074255162 10:111794688-111794710 GAGAGGAAAAAAAGGGTGGGGGG + Intergenic
1074545026 10:114395612-114395634 GGGGAGAAAAAAACGGGGGGTGG + Intronic
1074850870 10:117438729-117438751 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1075609070 10:123836852-123836874 GTGAAGGGAAAATTGGTGGGGGG - Intronic
1075838595 10:125477628-125477650 GAGGAGAGAAGAAAGGTGGGGGG + Intergenic
1076125335 10:127969669-127969691 AAGAAAAAAAAAAAGGGGGGCGG + Intronic
1076133015 10:128026598-128026620 GTTAAGAGAGAAAAAGTGGGAGG - Intronic
1076190177 10:128477360-128477382 GGGAGGAAAAGAAAGGTGGTAGG + Intergenic
1076301571 10:129432001-129432023 GTTAATTAAAAAAAGGCGGGAGG - Intergenic
1076568580 10:131415875-131415897 GAGAAGAAATGAAAGGAGGGTGG - Intergenic
1077580195 11:3412570-3412592 AAAAAAAAAAAAAAGGTGGGTGG + Intergenic
1077922434 11:6651603-6651625 GTGTAGAAAGAAAAGTTAGGAGG + Intronic
1078113492 11:8420980-8421002 CTGAAAAAAAAAAAGGGGAGGGG + Intronic
1078158160 11:8816553-8816575 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1078179350 11:8997736-8997758 TTGAAGAAAAGAGAGGTGAGAGG + Intronic
1078241400 11:9533985-9534007 GGAAAAAAAAAAAAGGAGGGTGG - Intergenic
1078553030 11:12293456-12293478 GGGAAGAAAAAACAGGGAGGGGG + Intronic
1078802062 11:14656446-14656468 GTGAAGAAAAGAACTGTGGGTGG + Intronic
1078915664 11:15776154-15776176 GGGAAGAAAGAAAAGAGGGGAGG + Intergenic
1078932325 11:15921953-15921975 GGAAAGAAAAGAAAGGAGGGGGG - Intergenic
1079222206 11:18573065-18573087 ATGCAGGAAAAAAAGGTGGGGGG + Intronic
1079537217 11:21528514-21528536 TGGAAAAAAAAAAAGGGGGGGGG - Intronic
1079537218 11:21528515-21528537 GTGGAAAAAAAAAAAGGGGGGGG - Intronic
1079915124 11:26360177-26360199 GTGGAAAAAAAAAGGGCGGGGGG - Intronic
1079922237 11:26447215-26447237 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1079996668 11:27302562-27302584 GTGAAGAAGAACAAGGTGTAGGG - Intergenic
1080024144 11:27596152-27596174 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1080573398 11:33577253-33577275 GAGAAGAAGAACAAGGTGTGGGG + Intronic
1080750707 11:35147609-35147631 TTGAAAAAAAAAAAAGTTGGGGG - Intronic
1080911575 11:36605282-36605304 CTGCAAAAAAAAAAAGTGGGGGG - Intronic
1081280032 11:41198045-41198067 GTGAATAAAAAAAAGCTAAGTGG + Intronic
1081371613 11:42311355-42311377 GTGAAGAGAAAGAAAGTGAGAGG - Intergenic
1081610420 11:44559479-44559501 GAGAAAAAAATAAAGGTCGGTGG + Intergenic
1081899017 11:46611711-46611733 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1082038441 11:47664868-47664890 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1082189961 11:49231181-49231203 ATGAAGAAAGGAATGGTGGGAGG + Intergenic
1082874550 11:57974804-57974826 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
1083007110 11:59356811-59356833 GGGGAGAAAAAAATGGTAGGTGG + Intergenic
1083361694 11:62113118-62113140 CTAAAGAAAAAAAAGGGGGACGG - Intergenic
1083367204 11:62148540-62148562 GAGAAGAAGAAGAAGGTGAGGGG + Exonic
1083556604 11:63634208-63634230 AAGAAGAAAAAAAAGGGGGCTGG + Intronic
1083607772 11:63989018-63989040 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1083831217 11:65234983-65235005 AGGAAGAAAGAAAAGGAGGGAGG - Intergenic
1083920455 11:65779383-65779405 GTGAAGGTAAAAGAGATGGGTGG + Exonic
1084237118 11:67795393-67795415 AAAAAAAAAAAAAAGGTGGGTGG + Intergenic
1084343271 11:68523712-68523734 GAGAAAAAAAAAAGGGGGGGGGG - Intronic
1084415477 11:69030180-69030202 GAGAAAAAAAGAAAGGAGGGAGG - Intergenic
1084491167 11:69479303-69479325 GAAAAGAAAAAACAAGTGGGTGG + Intergenic
1084670018 11:70600523-70600545 CTGAAGAGATAAAAGGTGGGTGG + Intronic
1084862619 11:72030358-72030380 GAAAAGAAAAAAAAAGGGGGCGG + Intronic
1085027354 11:73244042-73244064 ATTAAAAAAAAAAAAGTGGGGGG + Intergenic
1085177154 11:74499564-74499586 GCAAAAAAAAAAAAGGGGGGGGG - Intronic
1085179289 11:74520051-74520073 CTGAAGGACAAAAAGGAGGGTGG - Intronic
1085325799 11:75605740-75605762 TTTAAAAAAAAAAAGTTGGGGGG + Intronic
1085363076 11:75910490-75910512 CTTAAAAAAAAAAAAGTGGGGGG - Intronic
1085560011 11:77462969-77462991 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1085713118 11:78848144-78848166 GAAAAAAAAAAAAAGGAGGGAGG - Intronic
1085797924 11:79560595-79560617 GGGAAGGAAAGAAAGGTAGGTGG - Intergenic
1086089587 11:82992261-82992283 GTGAACAAAAATAGTGTGGGGGG - Intronic
1086127168 11:83360797-83360819 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1086129455 11:83385295-83385317 GAAAAGCAAAAAAAGGGGGGGGG + Intergenic
1086276367 11:85134248-85134270 ATGAAAAAAAAAAAAGAGGGTGG - Intronic
1086300435 11:85421413-85421435 GTTAAAAAAAAAAAAGGGGGAGG - Intronic
1086340929 11:85847377-85847399 ATGAAAAAAAAAAGGGTGGGGGG - Intergenic
1086431446 11:86740579-86740601 GTTCAGAAAAAAAGGGAGGGGGG + Intergenic
1086499641 11:87438986-87439008 GTAAAAGAAAAAGAGGTGGGAGG - Intergenic
1086676567 11:89615361-89615383 ATGAAGAAAGGAATGGTGGGAGG - Intergenic
1086761707 11:90639381-90639403 GTAAAGAGAAAAAAGGAGAGTGG + Intergenic
1086796593 11:91112353-91112375 GGGAAGAAAGAAAAGGTGTGTGG - Intergenic
1087484418 11:98744015-98744037 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1087505537 11:99016085-99016107 GTGAACAAAAAAAAAATAGGTGG + Intergenic
1087510235 11:99083138-99083160 GAGAAGAAAAAACAGGTGGCAGG - Intronic
1087640164 11:100747979-100748001 TTGAGAAAAAAAAAGGGGGGTGG - Intronic
1087743684 11:101918087-101918109 GGGAAAAAAAGACAGGTGGGTGG - Intronic
1087795946 11:102454662-102454684 GAGAAAAAAAAAAAGATGTGAGG + Intronic
1087851024 11:103029337-103029359 GAGAAGAAAAAAAGGTTGTGAGG - Intergenic
1088250985 11:107860689-107860711 ATTAAAAAAAAAAAGGTGGGAGG - Intronic
1088924577 11:114287680-114287702 AAGAAGAAAAATAAGGTGGGAGG - Intronic
1089099257 11:115947238-115947260 GGAAAGAAAAGAAAGGAGGGAGG + Intergenic
1089099921 11:115954014-115954036 TTAAAAAAAAAAAAGGAGGGGGG + Intergenic
1089161237 11:116439152-116439174 AGGAAGAAAAAAAAGGAGAGAGG + Intergenic
1089419993 11:118324649-118324671 GTGGATAAAGAAAATGTGGGAGG + Intergenic
1089537763 11:119171137-119171159 AAAAAGAAAAAAAAGGTGGTAGG + Intronic
1089840533 11:121413598-121413620 TTAAAGAAAAAAAAGGAAGGTGG - Intergenic
1090172263 11:124615379-124615401 GGGTAGAAAAGAAAGGTGTGGGG - Intronic
1090177043 11:124659635-124659657 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1090464710 11:126923927-126923949 GTGAAGAAAAGAAGGTTTGGGGG - Intronic
1090628157 11:128623832-128623854 GAAAAGAAAAAAAGGTTGGGGGG + Intergenic
1090721237 11:129475246-129475268 GTGAAGAAATTAGAAGTGGGAGG - Intergenic
1090725675 11:129525183-129525205 GAGGAGAAAAGAAAAGTGGGCGG + Intergenic
1090884325 11:130862442-130862464 GTGGAGAAAAAAGAGGTGAAGGG + Intergenic
1091044040 11:132310061-132310083 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1091369781 11:135048246-135048268 GTGAATAGAAGAAAGGTGGCCGG - Intergenic
1091494922 12:964236-964258 ATGTTGAAAAGAAAGGTGGGGGG + Intronic
1092606505 12:10125679-10125701 GTGAAGAAAAAAAGGATGGTTGG - Intronic
1092782200 12:11997506-11997528 CTGAACAAAAAAACGTTGGGAGG + Intergenic
1092944955 12:13444399-13444421 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1092994606 12:13937083-13937105 ATAAAAAAAAAAAAGGGGGGGGG + Intronic
1093068099 12:14679888-14679910 ATGAAAAAAAAAAAGGAAGGAGG - Intronic
1093196572 12:16136566-16136588 GTTAAGAAAAAAAAGGGTGAGGG + Intergenic
1093207433 12:16267725-16267747 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1093445080 12:19247754-19247776 TTAAAAAAAAAAAAGGTAGGGGG + Intronic
1093553510 12:20443973-20443995 GAGAAGGAAAAGAAGGAGGGAGG + Intronic
1093594249 12:20942691-20942713 TTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1093600376 12:21014409-21014431 GTCAAGAAACAAAAGATGTGAGG + Intergenic
1093726510 12:22517952-22517974 AAGAAAAAATAAAAGGTGGGTGG + Intronic
1093772549 12:23034458-23034480 GGGAAGAAGAAAAAAGAGGGAGG - Intergenic
1093997117 12:25654639-25654661 GCTAAGAAAAAAAAGTTAGGAGG + Intergenic
1094140640 12:27178303-27178325 ATGAACAAAAAGAAGGTTGGAGG - Intergenic
1094561321 12:31556198-31556220 AAAAAGAAAAAAAAGGGGGGAGG - Intronic
1094832070 12:34304848-34304870 GTGAAGAAAAAAAAGCTGTGTGG + Intergenic
1095085939 12:38057398-38057420 AAGAAAAAGAAAAAGGTGGGGGG + Intergenic
1095746020 12:45659831-45659853 GTGAAGAAAGAAAAAGGAGGTGG + Intergenic
1095796910 12:46229787-46229809 GCAAAAGAAAAAAAGGTGGGGGG - Intronic
1095879335 12:47115564-47115586 GGGAAGAAGAAAAAGATGAGGGG - Intronic
1095937892 12:47705187-47705209 GGGAAGAGAAGTAAGGTGGGAGG + Intronic
1096217748 12:49807867-49807889 AGGAAGAGAAAAAAGTTGGGAGG + Intronic
1096316996 12:50576474-50576496 AAAAAGAAAAAAAAGGTGGGGGG - Intronic
1096343368 12:50823034-50823056 AAGAAAAAAAAAAAAGTGGGAGG - Intergenic
1096409759 12:51368701-51368723 TTGAAGAAGGAAAAAGTGGGCGG - Intronic
1096441424 12:51646782-51646804 TTGAAGAAAAAATAGGTGATGGG + Intronic
1097107217 12:56632958-56632980 GTGGGGAAAAGAGAGGTGGGTGG - Intronic
1097237269 12:57549133-57549155 GCCAAAAAAAAAAAGGTGTGGGG - Intergenic
1097564064 12:61246320-61246342 GAAAAAAAAAAAAAGGTTGGTGG - Intergenic
1097786198 12:63762715-63762737 TTGAAGAAAAAAAAAGTTTGAGG - Intergenic
1097793132 12:63835615-63835637 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1097860282 12:64512035-64512057 GGGAAGAAGAGAAAGGAGGGGGG + Intergenic
1097997681 12:65907418-65907440 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1098085138 12:66834185-66834207 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1098464923 12:70775779-70775801 GTTAAAAAAAAAAGGGTTGGGGG - Intronic
1098658292 12:73060534-73060556 TTGAAGAAAAAGGAGGTTGGGGG - Intergenic
1098830384 12:75354153-75354175 GAAGAGAAAAAAAAGGGGGGGGG + Intronic
1098892111 12:76019975-76019997 GTGAAAAAAAAAATGATGTGAGG - Intergenic
1099326015 12:81215235-81215257 ATGACAAAAAAAAAGGTGGGGGG - Intronic
1099531728 12:83790319-83790341 ATGGCGAAAAAAAAGGTGGGGGG - Intergenic
1099566204 12:84249774-84249796 GTGAAGAAGAAAAAGATGATCGG + Intergenic
1099713446 12:86260259-86260281 TTGAAACAATAAAAGGTGGGTGG - Intronic
1099932286 12:89088294-89088316 GTGAAGAAAAGACAGGAGGGAGG + Intergenic
1100068610 12:90682472-90682494 GTGAAAAAAAAAAAGTTTGTGGG + Intergenic
1100361101 12:93880269-93880291 TTGAAGAAAAAAAAAGGGGTTGG - Intronic
1100841055 12:98612215-98612237 GGGAAAAAAAAAAAGGGGAGGGG - Intergenic
1100887643 12:99089162-99089184 GTGAAAAAAAAAAATGATGGAGG - Intronic
1100998423 12:100329403-100329425 GTTAAAAAAAAAAGGGTGAGGGG + Intronic
1101044037 12:100786337-100786359 GTGAGGTAGGAAAAGGTGGGGGG + Intronic
1101205571 12:102483813-102483835 GAGAAGAAAAAAAAAGTTGGGGG - Intergenic
1101408894 12:104453201-104453223 GAGAAGAAAATAAAGGAGAGAGG - Intergenic
1101546504 12:105718364-105718386 GTTGTGAAAATAAAGGTGGGAGG - Intergenic
1101632642 12:106510624-106510646 GTGAAGAAAAAGAAGAAGTGAGG - Intronic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1101915221 12:108890622-108890644 GAGAAGAAAAAAAAAGAGAGAGG - Intronic
1102159352 12:110756064-110756086 GAGAAAAAAAAAAAGGGCGGGGG - Intergenic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102623594 12:114216677-114216699 GAAAGGAAAAAAAAGGAGGGAGG + Intergenic
1102731786 12:115117682-115117704 GTGAAGAGAAAATAGCAGGGAGG + Intergenic
1102833408 12:116029243-116029265 CTGAAAAAAAAAAAAGGGGGGGG + Intronic
1102863977 12:116359898-116359920 GAAAAGAAAGAAAAGGAGGGAGG - Intergenic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103175439 12:118859400-118859422 GAGAAACAAACAAAGGTGGGAGG - Intergenic
1103318226 12:120074237-120074259 GGGAAGAGACAAAAGGTGGAAGG - Intronic
1103326481 12:120124746-120124768 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1103457906 12:121080614-121080636 GAAAAAAAAAAAAAGGCGGGGGG - Intergenic
1103746521 12:123128451-123128473 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1103987913 12:124779778-124779800 GTGAAGCAAGCACAGGTGGGCGG - Intronic
1104202714 12:126607343-126607365 GAGCAGAACAGAAAGGTGGGTGG - Intergenic
1104450083 12:128861858-128861880 GGGAAGAAAAAAAAAGTATGAGG + Intronic
1104578122 12:129987143-129987165 GTGGAAGAAAAAAAAGTGGGAGG + Intergenic
1105600943 13:21886268-21886290 GTGAAGACAGAAACTGTGGGTGG + Intergenic
1105694612 13:22875568-22875590 TGGAAGAAACAAAAGGAGGGAGG + Intergenic
1105696309 13:22892586-22892608 GTGAAGAGAAAATATGGGGGAGG - Intergenic
1105975755 13:25470955-25470977 GGGAAGAGAGAAAAGGTTGGGGG + Intronic
1106084249 13:26526186-26526208 GTGCAGAAAAGAAAGGATGGGGG - Intergenic
1106494116 13:30259341-30259363 AAGAAAAAAAAAAAAGTGGGGGG + Intronic
1106732148 13:32552433-32552455 GTGAAGAAGAGAAAAGTGGCTGG - Intergenic
1106784930 13:33097354-33097376 GCCAAAAAAAAAAAAGTGGGGGG - Intergenic
1106849594 13:33775299-33775321 GGGAAGAAAAAAAAGGAGGGGGG - Intergenic
1107512237 13:41096370-41096392 CTCAAAAAAAAAAAGGAGGGGGG - Intergenic
1107659059 13:42620551-42620573 GTGAAGAAAAAAAAGCCCTGTGG - Intergenic
1107938876 13:45367003-45367025 GTGAAGGAAAAAAATTTGGCCGG + Intergenic
1108006620 13:45953719-45953741 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1108071710 13:46635459-46635481 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1108078952 13:46712819-46712841 GCAAAGAAAAAACAGGTGGTGGG + Intronic
1108086039 13:46794849-46794871 GTGAAGAAAAAAGAAAAGGGAGG - Intronic
1108214463 13:48170605-48170627 GTCAAAAAAAAAAGGGGGGGTGG + Intergenic
1108275396 13:48804261-48804283 GTGTAGAAAAATAAGGTGCTTGG - Intergenic
1108340015 13:49489910-49489932 ATGTAAAAAAAAAAGGGGGGGGG - Intronic
1108819880 13:54335743-54335765 ATAAAAAAAAAAAAAGTGGGGGG - Intergenic
1109187665 13:59289758-59289780 GAGAAGACAAAAGAGGTAGGTGG - Intergenic
1109612879 13:64789641-64789663 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1109674362 13:65654486-65654508 CTAAAGAAAAAAAATGTGGTTGG + Intergenic
1109759844 13:66813440-66813462 GGGAAGAGAGAAAGGGTGGGAGG + Intronic
1109765919 13:66897228-66897250 GGGAAGAAAGGAAAGGAGGGAGG + Intronic
1109996073 13:70128850-70128872 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1110056550 13:70981340-70981362 GAAAAGAAAAGAAAGGAGGGAGG - Intergenic
1110556599 13:76866809-76866831 GTTAATATAAAAAATGTGGGAGG - Intergenic
1110717307 13:78720979-78721001 GGGAAGGAAAAGAAGGAGGGAGG + Intergenic
1110930353 13:81207785-81207807 GGAAAAAAAAAAAAGGCGGGGGG - Intergenic
1110987282 13:81986349-81986371 GGAAAGAAAAAAAAGGTGGGAGG + Intergenic
1111379655 13:87431392-87431414 CTAAAGAAAAACAAGGTGGAAGG + Intergenic
1111457204 13:88500030-88500052 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1111484900 13:88884212-88884234 TTGGGGAAAAAAAAGGGGGGGGG - Intergenic
1111875007 13:93882053-93882075 GAAAAGAAAAGAAAGGAGGGAGG - Intronic
1112251088 13:97781107-97781129 AAGAAAAAAAAAAAGGAGGGAGG + Intergenic
1112343016 13:98567930-98567952 TTTAAAAAAAAAAAGGGGGGGGG + Intronic
1112404315 13:99104723-99104745 ACGCAGAAAAAAAGGGTGGGGGG + Intergenic
1112413263 13:99181649-99181671 GTGAAGAGAAAATAGCAGGGAGG + Intergenic
1112428606 13:99329229-99329251 AAAAAGAAAAACAAGGTGGGAGG - Intronic
1112608730 13:100934437-100934459 GTAAAAAAAAACAAGGGGGGGGG + Intergenic
1112708671 13:102101699-102101721 AAGAAAAAAAAAAAGTTGGGGGG - Intronic
1112809915 13:103206075-103206097 TTAAAAAAAAAAAATGTGGGGGG - Intergenic
1113080284 13:106512379-106512401 TTGAAAAAAAAAAAGGGGGGGGG + Intronic
1113594380 13:111520946-111520968 GTGAAGAAAAGAAAGCAGGGAGG - Intergenic
1114062582 14:19032560-19032582 GTGAAGGAATAAAGGGTGGTTGG - Intergenic
1114099679 14:19367437-19367459 GTGAAGGAATAAAGGGTGGTTGG + Intergenic
1114175205 14:20312378-20312400 CTACAAAAAAAAAAGGTGGGGGG - Intronic
1114197809 14:20494574-20494596 GTCTTAAAAAAAAAGGTGGGTGG - Intergenic
1114202064 14:20530839-20530861 GAAAAGAAAGAAAAGGAGGGAGG + Intergenic
1114392374 14:22323763-22323785 CTGAAGAAAAAAAAATTGTGTGG + Intergenic
1114460358 14:22882694-22882716 GTGGAGAAGGAAAAGGTGGCAGG + Intergenic
1114463724 14:22905308-22905330 CAGAAGAAAACTAAGGTGGGAGG + Intronic
1114490752 14:23100259-23100281 AAGAAGAAGAAAAAGGTGGGGGG + Exonic
1114721214 14:24884077-24884099 CTGCCAAAAAAAAAGGTGGGGGG + Intronic
1115344619 14:32329035-32329057 ATTTAGAAAAAAAAGGTGGGAGG - Intergenic
1115425085 14:33249342-33249364 GAAAAAAAAAAAAAGGTGGGGGG - Intronic
1115518197 14:34206257-34206279 GTGAGGAGAAAAAAAGTGGCAGG - Intronic
1115801276 14:36996691-36996713 ATGGAGAAAAAAAAAGTGGATGG + Intronic
1116016310 14:39411520-39411542 CTCAAGAAAAAAAAAGGGGGGGG - Intronic
1116055847 14:39862832-39862854 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
1116109421 14:40558249-40558271 GTGAAGAAAAGGAGGGTGGAAGG - Intergenic
1116147347 14:41091525-41091547 ATGAATAATAATAAGGTGGGAGG - Intergenic
1116386432 14:44336215-44336237 CTGAAGAAAAATAAAGTTGGGGG + Intergenic
1116906111 14:50405201-50405223 ATGAAGAAAGAAAATGTGGCTGG - Intronic
1116993459 14:51299205-51299227 TTAAAAAAAAAAAAGGTAGGGGG - Intergenic
1117157338 14:52953506-52953528 AACAAGAAAAAAAAGGTGGGTGG + Intergenic
1117239865 14:53819380-53819402 CTGAAGAATAAAGAGCTGGGTGG - Intergenic
1117990947 14:61432908-61432930 CTTAATAAAAAAAAAGTGGGGGG + Intronic
1118078782 14:62333605-62333627 ATGAAAAAAGAACAGGTGGGTGG - Intergenic
1118102097 14:62618215-62618237 GGAAAGAAAGAAAATGTGGGTGG - Intergenic
1118346233 14:64943050-64943072 GAGAGGAAAAAAAGGGAGGGAGG + Intronic
1118407001 14:65434779-65434801 TAAAAGAAAAAAAAGGTGGGGGG - Intronic
1118417012 14:65550479-65550501 GTGAAGAACAAAATGGTTGTAGG + Intronic
1118449513 14:65887130-65887152 GAAAAAAAAAAAAAGGTGGAAGG + Intergenic
1118500042 14:66353110-66353132 GTGAAAAAAAAACGGATGGGTGG - Intergenic
1118789089 14:69072651-69072673 GAAAAGAAAAAAAATGTGGGTGG + Intronic
1118850861 14:69582304-69582326 ATTAAGAAGAAAAAGGAGGGGGG - Intergenic
1118851913 14:69590531-69590553 ATGTAAAAAAAAAAAGTGGGGGG - Intergenic
1119064257 14:71510169-71510191 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1119119440 14:72060363-72060385 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1119228311 14:72960874-72960896 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1119793091 14:77370948-77370970 CAGAAAAAAAAAAAGGTCGGGGG + Intronic
1119807543 14:77491992-77492014 TAAAAAAAAAAAAAGGTGGGGGG - Intronic
1119964027 14:78893094-78893116 GCAAAGAAAAGGAAGGTGGGTGG - Intronic
1120114431 14:80596829-80596851 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1120285575 14:82496263-82496285 ATGACAAAAAAAAAGGTGGGGGG + Intergenic
1120476399 14:84993517-84993539 GAGAAGATAAAAAAGGAAGGAGG - Intergenic
1121147239 14:91594712-91594734 GTGAAGAGAAAATAGAGGGGAGG + Intronic
1121505834 14:94475692-94475714 GTGCAGAAAAGAGAGGTGGAAGG - Intronic
1121856003 14:97270815-97270837 GTGAAGAAATAAATGGAGTGAGG - Intergenic
1122012170 14:98759243-98759265 AGGAAGAAAGAAAAGGAGGGAGG - Intergenic
1122085972 14:99305115-99305137 GAGAAAAAAAAAGGGGTGGGGGG - Intergenic
1122103801 14:99435736-99435758 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1122746488 14:103900001-103900023 GTGAAGAAGAGCACGGTGGGTGG + Intergenic
1122752127 14:103944564-103944586 CTCAAAAAAAAAAGGGTGGGGGG - Intronic
1123123106 14:105927143-105927165 GTGAAGTAATAAACCGTGGGTGG + Intronic
1123405765 15:20018650-20018672 GTGAAGTAACAAACCGTGGGTGG + Intergenic
1123494213 15:20808909-20808931 GTGAAGGAATAAAGGGTGGTTGG + Intergenic
1123515095 15:21025298-21025320 GTGAAGTAACAAACCGTGGGTGG + Intergenic
1123550710 15:21377992-21378014 GTGAAGGAATAAAGGGTGGTTGG + Intergenic
1123677398 15:22724428-22724450 CTTAAAAAAAAAAAGGTGGTTGG - Intergenic
1123709621 15:22977865-22977887 GAAAAGAAAACAAAGGAGGGAGG + Intronic
1123963152 15:25427803-25427825 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1124251569 15:28109555-28109577 GGAAAGAATAAAAAGGAGGGAGG + Intergenic
1124820601 15:33042770-33042792 TTTAAAAAAAAAAAGTTGGGGGG - Intronic
1124827524 15:33113663-33113685 GAGAAGTAACAGAAGGTGGGTGG - Intronic
1124848813 15:33316120-33316142 GTGAAAAAGAAAAGAGTGGGAGG + Intronic
1125051527 15:35303692-35303714 GTTAAAAAAAAAAAAGGGGGAGG + Intronic
1125096695 15:35861955-35861977 GCAAAAAAAAAAAAAGTGGGGGG - Intergenic
1125323803 15:38515780-38515802 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1125697598 15:41651951-41651973 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1125804217 15:42478831-42478853 TGGAAGAGAAAAAAGGTAGGAGG - Intronic
1126035853 15:44544711-44544733 AAAAAAAAAAAAAAGGTGGGAGG + Intronic
1126055527 15:44726437-44726459 TTCAAAAAAAAAAAAGTGGGGGG + Intergenic
1127016220 15:54691431-54691453 GTTAAAAAAAAAAAGGTGGGGGG + Intergenic
1127328156 15:57915418-57915440 TTAAAAAAAAAAAAGGGGGGGGG - Intergenic
1127551537 15:60043553-60043575 GTGGAGACAGACAAGGTGGGGGG + Intronic
1128024975 15:64427946-64427968 GGGAAAAAAAAAGAGGGGGGAGG - Intronic
1128082313 15:64864053-64864075 CTTAAGAAAAATAAGGTGGCAGG + Intronic
1128102257 15:65012146-65012168 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1128165293 15:65459039-65459061 TTAAAAAAAAAAAAGGCGGGGGG + Intronic
1128441000 15:67708493-67708515 CTCTAGAAAAAAAAAGTGGGAGG - Intronic
1128574118 15:68758589-68758611 GTGTGGAAAAAAAAGTGGGGGGG + Intergenic
1128604839 15:69028826-69028848 GTTAAAAAAAAAAAGGTGTGTGG - Intronic
1129120697 15:73394690-73394712 GGGAGGGAAGAAAAGGTGGGAGG - Intergenic
1129446001 15:75618589-75618611 TTGAAGAAATCAAATGTGGGAGG - Intronic
1129526383 15:76218261-76218283 GAAAAGAAAAAAAAAGTGTGTGG - Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1129592052 15:76924777-76924799 AAGAAGAAAAAGAATGTGGGAGG - Intergenic
1129985381 15:79915378-79915400 ATGTAGGAAAAAAAAGTGGGTGG - Intronic
1130108850 15:80948904-80948926 GTGAAGAAGAAGAAGTTGTGAGG + Exonic
1130521000 15:84660497-84660519 CTATAGAAAAAAAAGGGGGGGGG + Intergenic
1130702605 15:86200554-86200576 GAGCAAAAAAAAAAGGGGGGGGG - Intronic
1130783307 15:87068621-87068643 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1131043592 15:89295735-89295757 AACAAAAAAAAAAAGGTGGGGGG - Intronic
1131045843 15:89314841-89314863 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1131098806 15:89672360-89672382 GTGAAGAAAAATAAGGTATCTGG - Intronic
1131318986 15:91368225-91368247 GTTGAAAAAAAAAAAGTGGGAGG - Intergenic
1131620780 15:94065899-94065921 GAGGAAAAAAAAAAGGTGGGGGG + Intergenic
1131675461 15:94666494-94666516 ATAAAGAAAGAAAAGGTAGGTGG + Intergenic
1131870504 15:96758623-96758645 TTGGGGAAAGAAAAGGTGGGGGG + Intergenic
1131919255 15:97304847-97304869 TTAAAAAAAAAAAAGGTGTGGGG - Intergenic
1131935914 15:97504717-97504739 AAGAAGAAAAAAAAAGGGGGTGG - Intergenic
1132171454 15:99660946-99660968 CTGAAGAAGAACAAGGTGAGAGG + Intronic
1132418025 15:101638290-101638312 CCAAAAAAAAAAAAGGTGGGGGG - Intronic
1132435296 15:101796070-101796092 ATGAAGATAAAAAATGTGGTTGG + Intergenic
1202959051 15_KI270727v1_random:105245-105267 GTGAAGGAATAAAGGGTGGTTGG + Intergenic
1132848514 16:2012524-2012546 CTAAAAAAAAAAAAGCTGGGCGG - Intronic
1133083281 16:3340892-3340914 TTGAAAAAAAACAAAGTGGGAGG - Intergenic
1133348726 16:5087808-5087830 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1133371809 16:5251027-5251049 GTGAATAAAAGAAAGAGGGGCGG - Intergenic
1133407393 16:5536098-5536120 AAAAAGAAAAAAAAGGGGGGGGG - Intergenic
1133460684 16:5983983-5984005 GAGAAGAAGAAGAATGTGGGAGG - Intergenic
1133497343 16:6331432-6331454 ATGAAGAAAAAAAGTCTGGGAGG + Intronic
1133633658 16:7645945-7645967 AGAAAAAAAAAAAAGGTGGGTGG - Intronic
1133665693 16:7965770-7965792 GTGAAGGAAAAAGACTTGGGGGG - Intergenic
1133767790 16:8849814-8849836 GTGATGACAAAGAAGGTGGAAGG - Intergenic
1134197792 16:12172262-12172284 GGGAAGAAAAAGAAGGGAGGAGG + Intronic
1134649469 16:15897262-15897284 ATAAAAAAAAAAAAAGTGGGGGG - Intergenic
1134855512 16:17515331-17515353 GTGAAGAAAATAAAGTAGAGAGG + Intergenic
1134903042 16:17955922-17955944 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
1134981556 16:18614391-18614413 GAAAAGAAAAAAAGGGGGGGTGG + Intergenic
1135029365 16:19025748-19025770 GAAAAAAAAAAAAGGGTGGGGGG - Intronic
1135065310 16:19304766-19304788 GTGAACAAAAAAGAGGAAGGAGG + Intronic
1135105366 16:19645137-19645159 CTTAAGAGGAAAAAGGTGGGGGG + Intronic
1135122343 16:19777185-19777207 GAAACAAAAAAAAAGGTGGGGGG + Intronic
1135229232 16:20690095-20690117 GAAAAGAAAAAGAAGGTGGTGGG + Intronic
1135469812 16:22720379-22720401 GTAAAAAAAAAAAAAGAGGGTGG + Intergenic
1135637682 16:24093054-24093076 GAGAAGACAGAAAAGGAGGGAGG - Intronic
1135935836 16:26779266-26779288 GTTTAAAAAAAGAAGGTGGGGGG + Intergenic
1135958823 16:26979028-26979050 GGGAGGATCAAAAAGGTGGGGGG - Intergenic
1136040716 16:27576712-27576734 ATGCAGAAAGAAGAGGTGGGTGG - Intronic
1136233486 16:28901337-28901359 AAAAAAAAAAAAAAGGTGGGCGG + Intronic
1136420408 16:30128859-30128881 CTCAAAAAAAAAAAGGTGGGGGG - Intergenic
1136483424 16:30556480-30556502 ATGAAAGAAAAAAAGGGGGGCGG + Intronic
1136530678 16:30866576-30866598 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1136560607 16:31037056-31037078 GGAAAAAAAAAAAAGGGGGGGGG - Intronic
1136656994 16:31715377-31715399 TTGAAGAACAAAAAGGAAGGGGG + Intronic
1136948931 16:34691357-34691379 GTGAAGGAAGAAAACGAGGGTGG + Intergenic
1137285013 16:47008574-47008596 GTAAAGGAAAAAAAGCAGGGAGG + Intergenic
1137349820 16:47703642-47703664 CAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1137450576 16:48570149-48570171 AAGAAGAAAAAAAAGGGGTGGGG + Intronic
1137634196 16:49971426-49971448 GTTAAAAAAAAAAAGGGTGGGGG + Intergenic
1137634197 16:49971427-49971449 TTAAAAAAAAAAAGGGTGGGGGG + Intergenic
1138116986 16:54368708-54368730 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1138441780 16:57039756-57039778 GTGAAGACAAAAGAGGGGTGAGG - Intronic
1138594698 16:58023616-58023638 ACCAAGAAAAAAAAGGTGTGTGG + Intergenic
1139789483 16:69421443-69421465 GTGAAAAAAAAAAATGTATGTGG + Intergenic
1139982133 16:70868306-70868328 TTGAAGAAGGAAAAGGTGGGAGG + Intronic
1140130800 16:72159127-72159149 GTGAAGAAAAAACAGGGACGTGG - Intronic
1140740335 16:77936042-77936064 GGGGAGAAAAAAAAGGAGGTGGG + Intronic
1141231858 16:82175223-82175245 GTAAAAAAAAAAAAGCTAGGTGG - Intergenic
1141683218 16:85555947-85555969 GCAAATAAAAAAAAGGAGGGGGG - Intergenic
1141781240 16:86162925-86162947 GAGTAGAACAAAAAGGTGGAAGG - Intergenic
1141782443 16:86172496-86172518 GAGAAGAAAGAAATGGAGGGAGG - Intergenic
1141872270 16:86795183-86795205 GGGGGGAAAAAAAAGGGGGGGGG + Intergenic
1142800865 17:2344701-2344723 AGGAAGAAAAAACATGTGGGAGG + Intronic
1142860535 17:2758173-2758195 TTAAAAAAAAAAAAGGGGGGGGG - Intergenic
1143394394 17:6580628-6580650 AAGAAGAAAAACAAGGTGAGAGG + Intronic
1143622582 17:8089283-8089305 CTGAAGAAAATAAGCGTGGGAGG + Intergenic
1143843048 17:9749981-9750003 TTGAAAACAAAAAAGGGGGGTGG - Intergenic
1144031720 17:11329127-11329149 GGGAATAAAGAAAAGGTGGCAGG + Intronic
1144183594 17:12775039-12775061 CTCAAAAAAAAAAGGGTGGGGGG + Intergenic
1144372898 17:14609883-14609905 GTGAAGAAAAGACAGGTGCAAGG + Intergenic
1144386884 17:14756202-14756224 GTGGAGAAAAGAAAGGAAGGGGG - Intergenic
1144387099 17:14758905-14758927 GTGGAGAAAACAAAGGAAGGGGG + Intergenic
1144473467 17:15564024-15564046 GTTAAGAAAAACAAGGCAGGAGG + Intergenic
1144653995 17:17024108-17024130 GAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1144774864 17:17780364-17780386 TGGGAGAAAAAAAGGGTGGGTGG - Intronic
1144923056 17:18780786-18780808 GTTAAGAAAAACAAGGCAGGAGG - Intergenic
1145105468 17:20111747-20111769 CGGAAGGAGAAAAAGGTGGGAGG + Intronic
1145154408 17:20532895-20532917 GTGAGGAAGAAAACGGTTGGCGG + Intergenic
1145178550 17:20723620-20723642 TTAAAAAAAAAAAAGGTGGGTGG - Intergenic
1145193763 17:20869148-20869170 GTGAAGAAAGAAAAGACGGGGGG + Intronic
1145219241 17:21074860-21074882 GGAAAGAAAGAAAAGCTGGGAGG - Intergenic
1145363255 17:22229566-22229588 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1145775771 17:27527397-27527419 AAAAAGAAAAAAAAGGGGGGGGG - Intronic
1146019025 17:29259573-29259595 CTCAAAAAAAAAAAGGTGGGGGG + Exonic
1146021348 17:29281763-29281785 CTAAAAAAAAAAAGGGTGGGGGG - Intronic
1146329301 17:31914665-31914687 CTCAAAAAAAAAAAGGTTGGAGG + Intergenic
1146421803 17:32693856-32693878 GGGAAGAGAAAAAAGGAGAGTGG + Intronic
1146785661 17:35718685-35718707 TGGAAGAAAAAAAGGGTTGGGGG + Intronic
1147116130 17:38301231-38301253 AAGAAGAAAAAAAAAGTAGGAGG - Intronic
1147153026 17:38529374-38529396 GAAAAGAAAGAAAAGATGGGTGG + Intergenic
1147271064 17:39271611-39271633 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1147394507 17:40131328-40131350 GTGTAAAAAAAAAAAGTGGTGGG + Intronic
1147401593 17:40183491-40183513 GAAAAGAAAAGAAAGATGGGAGG - Intronic
1147458604 17:40554206-40554228 GTGAAGAAAACGATGGAGGGAGG + Exonic
1147492185 17:40879953-40879975 GTGAAAAAAAAATAGTTGAGGGG + Intronic
1147502002 17:40974629-40974651 AAGAAGAAAAGAAAGGAGGGAGG - Intergenic
1147672819 17:42186373-42186395 AGGAAGAAAAAAAAAGCGGGGGG - Intergenic
1147714319 17:42494231-42494253 CTCAAAAAAAAAAAGGGGGGTGG + Intronic
1147912372 17:43863456-43863478 GTGAAGAAGAAAAGAGTGGAAGG - Exonic
1147923919 17:43935228-43935250 CTCAAAAAAAAAAAGGTTGGGGG + Intergenic
1148024700 17:44578678-44578700 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1148122453 17:45221307-45221329 GGAGAGAAATAAAAGGTGGGGGG + Intergenic
1148295566 17:46499322-46499344 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1148542221 17:48489932-48489954 GTGAAAAACAAAAAGGAGGGGGG + Intergenic
1148576799 17:48718189-48718211 GTAAAAAAAAAAAGGGGGGGGGG + Intergenic
1148579490 17:48733952-48733974 GAGAGGAAAAAAAAGGAAGGAGG - Intergenic
1148661945 17:49341320-49341342 CTGAAAAAAAAAAAGATGGATGG + Intronic
1148719885 17:49743926-49743948 CTTAAAAAAAAAAAGGTTGGGGG + Intronic
1148774061 17:50084617-50084639 GTGAAAAAAAAACAGGTTGCTGG + Intronic
1148880620 17:50723653-50723675 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1148924187 17:51067737-51067759 AAAAAGAAAAAAAAGGTGAGGGG + Intronic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149159068 17:53668394-53668416 GTGAAGACATAAAACTTGGGAGG + Intergenic
1149456372 17:56791856-56791878 CTCAAAAAAAAAAAAGTGGGGGG + Intergenic
1149586426 17:57790744-57790766 GTGGAGAAGAAGAAAGTGGGTGG - Intergenic
1149768211 17:59298150-59298172 CTCAAAAAAAAAAAGGTCGGGGG - Intergenic
1149804223 17:59599820-59599842 CAAAAAAAAAAAAAGGTGGGGGG - Intronic
1149838190 17:59933194-59933216 AAAAAAAAAAAAAAGGTGGGTGG - Intronic
1149958732 17:61082885-61082907 AGGAAGAAAAAACAGGAGGGAGG - Intronic
1149972436 17:61232385-61232407 TTGGCCAAAAAAAAGGTGGGGGG + Intronic
1150081105 17:62240024-62240046 TTAAAAAAAAAAAAGGTAGGTGG + Intergenic
1150681053 17:67284925-67284947 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1150726197 17:67653269-67653291 TAAAAGAAAAAAAAGGTTGGGGG + Intronic
1150755584 17:67909271-67909293 GATAAAAAAAAAAAGGGGGGGGG - Intronic
1150931813 17:69592962-69592984 GAGAAGAAAAAAATGGAGGGAGG - Intergenic
1151028374 17:70705957-70705979 CTGCAGAAACAAAAAGTGGGAGG - Intergenic
1151168588 17:72226269-72226291 ATAAAGAAAAAAAGGGTGTGGGG - Intergenic
1151279278 17:73060261-73060283 GTAAAAAAAAAAAAGTTGGGGGG + Intronic
1151356132 17:73559718-73559740 GGGAAGAAAAGAAAGGGGGAGGG - Intronic
1151400017 17:73849905-73849927 AACAAAAAAAAAAAGGTGGGGGG + Intergenic
1151610372 17:75169850-75169872 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1151808658 17:76422751-76422773 GTGAAGAAAAATAAAGCAGGTGG - Intronic
1152913033 17:83016454-83016476 GAGAAGAGAATAAAGGAGGGTGG + Intronic
1153019170 18:611226-611248 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1153161142 18:2206008-2206030 GGCAAGAAAAAAAAAGTGTGTGG + Intergenic
1153222093 18:2870935-2870957 CTAAAGAAAAAAAGGGTGGTGGG - Intronic
1153351492 18:4085256-4085278 AGGCAGAAAAAAAATGTGGGTGG + Intronic
1153643340 18:7174118-7174140 GAGATTAAAAAAAAAGTGGGGGG + Intergenic
1153741886 18:8138197-8138219 GGGAAAAAAAAAAAGGTAGGGGG - Intronic
1153882754 18:9434979-9435001 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1153973698 18:10248258-10248280 CTGAAGAAAAAGAAGTTGGCTGG + Intergenic
1154007808 18:10547913-10547935 GTGAATAAAAAAGAAGTGGGGGG - Intronic
1154451740 18:14483364-14483386 GTGAAGGAATAAAGGGTGGTTGG + Intergenic
1155015272 18:21831642-21831664 CTCAAAAAAAAAAAAGTGGGGGG - Intronic
1155068726 18:22293642-22293664 GTGAAGAACAAAGAGGTGCCAGG - Intergenic
1155392566 18:25351663-25351685 GTTAAGAAAAAAAGGGTGGGGGG - Intronic
1155494060 18:26425631-26425653 CTTATGAAAAAAAAGGGGGGGGG - Intergenic
1155505340 18:26527479-26527501 CTGCAAAAAAAAAAGGGGGGGGG + Intronic
1155662240 18:28263162-28263184 GTAAAGAAAAACAAGGGGTGGGG - Intergenic
1155710426 18:28870408-28870430 GTGAACAAAGAAAAGAGGGGTGG - Intergenic
1155750015 18:29411136-29411158 CTACAGAAAAAAAAGGAGGGGGG + Intergenic
1155892318 18:31285123-31285145 CTTAAAAAAAAAAAGGTTGGGGG - Intergenic
1155922723 18:31619306-31619328 CTCAAAAAAAAAAAGGTGGGGGG + Intergenic
1155946780 18:31861923-31861945 CAGAAAAAAAAAAAGGGGGGGGG + Intronic
1155983931 18:32209805-32209827 GTTTAAAAAAAAAAGGGGGGCGG + Intronic
1156091967 18:33482426-33482448 GGAAAAAAAAAAGAGGTGGGGGG - Intergenic
1156522443 18:37733181-37733203 ATGAAGAAAATAAAGCGGGGTGG - Intergenic
1156533242 18:37838409-37838431 GGGGGGAAAAAAAAGGTGGAAGG - Intergenic
1156549418 18:37999837-37999859 GTAAAGAAAAGTAAGATGGGAGG + Intergenic
1156566454 18:38196935-38196957 AAGAAAAAAAAAAGGGTGGGGGG - Intergenic
1156688826 18:39681828-39681850 GTGAAGGCGACAAAGGTGGGTGG + Intergenic
1156714957 18:39997032-39997054 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1156738360 18:40292273-40292295 GGAACAAAAAAAAAGGTGGGGGG - Intergenic
1156755628 18:40521258-40521280 GGGAAGAAAGGAAAGGAGGGTGG - Intergenic
1156764171 18:40631239-40631261 GGGAAGAAAAAAAAGGACAGAGG - Intergenic
1156806440 18:41188421-41188443 AAAAAGAAAAGAAAGGTGGGGGG + Intergenic
1157125993 18:44956528-44956550 GTGATGAAGGAAAAGGTGGAGGG - Intronic
1157303544 18:46498817-46498839 GTGAAGAAGAATTTGGTGGGTGG + Intronic
1157336034 18:46738252-46738274 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1157763300 18:50280699-50280721 GAGAAGAAAAATAAGGGGGGAGG - Intronic
1157797794 18:50591341-50591363 ATGTAGAATGAAAAGGTGGGAGG - Intronic
1157888372 18:51390559-51390581 GGGAAAAAAAAATAGGTGAGAGG - Intergenic
1158414172 18:57234660-57234682 ATGAGGAAAAGAAAGGTGGGAGG + Intergenic
1158552103 18:58445128-58445150 GAAAAGAAAAGAAAGGAGGGAGG + Intergenic
1158641527 18:59207801-59207823 GAAAAGAAAAAAAAGGTGGGGGG - Intergenic
1158726366 18:59976724-59976746 AAAAAAAAAAAAAAGGTGGGTGG - Intergenic
1158731284 18:60025802-60025824 ATCAACAAAAAAATGGTGGGAGG - Intergenic
1158739517 18:60123895-60123917 TTGAAGAAAAAAAAAATAGGGGG - Intergenic
1158883698 18:61805569-61805591 GTGAAGTAACAAAAGGTTGAAGG + Intergenic
1159270476 18:66142621-66142643 GTGAAGAAAAAAAAACTGAAGGG + Intergenic
1159333818 18:67037113-67037135 TTGAAGAAGAATAAGTTGGGAGG - Intergenic
1159367782 18:67491975-67491997 CTTTCGAAAAAAAAGGTGGGGGG - Intergenic
1159412743 18:68103394-68103416 ACGAAGTAAAAAAAGGAGGGAGG - Intergenic
1159646751 18:70927364-70927386 GTTAAAAAAAAAAAGGCAGGGGG - Intergenic
1159755807 18:72362581-72362603 GTTAAAAAAAAAAAAGTGGCAGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160728842 19:631325-631347 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1160971253 19:1768748-1768770 GTGAAGAAAACAGAGGAAGGGGG + Intronic
1160979307 19:1809635-1809657 AGGAAGAAATACAAGGTGGGCGG - Exonic
1161020829 19:2010635-2010657 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1161050340 19:2160533-2160555 CTCAAAAAAAAAAAAGTGGGCGG + Intronic
1161197299 19:2993929-2993951 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1161282425 19:3453239-3453261 AAAAAGAAAAAAAAGGTTGGGGG + Intronic
1161350953 19:3791344-3791366 TTCAAAAAAAAAAAAGTGGGGGG - Intronic
1161553190 19:4925867-4925889 GAAAAGAAAAAACAGGTGAGAGG - Intronic
1161650677 19:5482578-5482600 GGGAAGGAAGAAAAGGAGGGGGG + Intergenic
1161667244 19:5584804-5584826 TTCAAGAGAGAAAAGGTGGGTGG - Intergenic
1162119538 19:8454676-8454698 GTTAAAAAAAAAAAGGGGGGGGG - Intronic
1162411196 19:10506670-10506692 AGAAAGAAAAAAAGGGTGGGGGG - Intergenic
1162576620 19:11503032-11503054 TCAAAAAAAAAAAAGGTGGGGGG + Intronic
1162592563 19:11602088-11602110 ATGATGAGAAAGAAGGTGGGAGG + Intronic
1162761064 19:12888379-12888401 GGAAAAAAAAAAAAGTTGGGTGG + Intergenic
1162928026 19:13940046-13940068 ATAAAGAAAAAAAAAGTGGGGGG + Intronic
1163001482 19:14370590-14370612 GTAAAGAAAAAAAATGGGGAAGG + Intergenic
1163128073 19:15255186-15255208 TTGGAAAAAAAAAAGGGGGGGGG + Intronic
1163135503 19:15308176-15308198 GTGAAGAAAAAAAAGAAAGGGGG + Intronic
1163141645 19:15353185-15353207 AAGAAGAAAAAAAAGGTGTGGGG + Intergenic
1163165626 19:15495858-15495880 AAAAAGAAAAAATAGGTGGGGGG - Intronic
1163194356 19:15704144-15704166 GTAAAAAAAAAAAAGGTTGGGGG + Intergenic
1163401740 19:17098052-17098074 GTGAAGAAAAAAAAGGTGGGGGG - Intronic
1163560426 19:18016182-18016204 GAAAAGAAAAGAAAGGGGGGAGG + Intergenic
1163751527 19:19081140-19081162 ATAAAGAAAAGAAAGGAGGGAGG + Intronic
1164144992 19:22506738-22506760 TCAAAAAAAAAAAAGGTGGGGGG - Intronic
1164161775 19:22631177-22631199 GTGAAAAAAATAATGGAGGGTGG + Intergenic
1164217941 19:23167316-23167338 GTTAAAAAAAAAAAGGGAGGGGG + Intergenic
1164441730 19:28284606-28284628 ATGAAGGAAAAAAGGGTGAGGGG + Intergenic
1164693105 19:30225671-30225693 GTAAGGAAAACAAAGGTGGGGGG + Intergenic
1164751433 19:30658021-30658043 CTGAAGGAAAAAAAAGGGGGGGG - Intronic
1164888573 19:31803980-31804002 GTGAAGGCAACTAAGGTGGGAGG - Intergenic
1165050510 19:33138646-33138668 GGAAAAAAAAAAAAGGTGTGGGG - Intronic
1165308526 19:35016909-35016931 AAAAAAAAAAAAAAGGTGGGAGG + Intronic
1165327437 19:35122531-35122553 TTGAAGAAAAATAAGTGGGGTGG - Intronic
1165400719 19:35598046-35598068 GTGAATGACATAAAGGTGGGGGG + Intergenic
1165723839 19:38099004-38099026 GAGAAGAAAAGAAAGGAGGGAGG - Intronic
1166307588 19:41943589-41943611 CAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1166666798 19:44684943-44684965 GGGAAGGAGGAAAAGGTGGGTGG + Intergenic
1166681771 19:44772368-44772390 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1166866504 19:45841289-45841311 TCAAAAAAAAAAAAGGTGGGGGG - Intronic
1167160711 19:47765722-47765744 GGGAAGGAGAAAAAGGTGGGGGG + Intergenic
1167859055 19:52268463-52268485 CTTAAGAAAAAAAAAGTTGGGGG + Intergenic
1167884324 19:52487952-52487974 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1168162883 19:54523855-54523877 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1168290832 19:55356591-55356613 GTGAAAACAAAAAAAGTTGGTGG - Intronic
1168526194 19:57090506-57090528 CTGAAGAAAGAAAAGGTAAGAGG - Intergenic
1168566907 19:57432571-57432593 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
925608977 2:5687923-5687945 GTGAAGGATGAATAGGTGGGTGG + Intergenic
925628009 2:5861590-5861612 GTGTAGAAGAAAAATTTGGGGGG - Intergenic
925761496 2:7188693-7188715 GTTAAGGAAGAAAAGTTGGGAGG + Intergenic
926039020 2:9657862-9657884 GAGAAGAGAGAAAAGGTGTGGGG - Intergenic
926503244 2:13680251-13680273 CTTAAAAAAAAAAGGGTGGGGGG + Intergenic
926509231 2:13752846-13752868 GTGAAGAGAAAATAGTGGGGAGG - Intergenic
926733665 2:16056680-16056702 GTGGAAAAAAAAAAGTGGGGAGG - Intergenic
926875867 2:17478024-17478046 GAAAAGAAAAGAAAGGAGGGAGG + Intergenic
927544371 2:23940116-23940138 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
927780126 2:25932429-25932451 ATGAAGAAAAATAGGCTGGGTGG - Intronic
928107424 2:28479978-28480000 GAGAAGCAACCAAAGGTGGGAGG + Intronic
928270905 2:29853788-29853810 GTGAAGAGAGAAGAGGAGGGAGG - Intronic
928559269 2:32462052-32462074 AATAAAAAAAAAAAGGTGGGGGG + Intronic
928649674 2:33391065-33391087 TTCAAAAAAAAAAAGGTGGAGGG - Intronic
928763917 2:34618601-34618623 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
929027591 2:37619653-37619675 GGGAAGAAAAAAAGGGAGGGTGG + Intergenic
929224768 2:39501520-39501542 CTTAAAAAAAAAAAGGGGGGGGG - Intergenic
929485802 2:42353098-42353120 TTAAAGAAAAAGAAGGAGGGTGG + Intronic
929520235 2:42643037-42643059 GTTAAAAAAAAAAGGGGGGGGGG - Intronic
929598063 2:43188461-43188483 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
929675302 2:43920842-43920864 CTAAACAATAAAAAGGTGGGTGG + Intronic
929840909 2:45461927-45461949 CTGAAGAGAAAAAAGGGAGGAGG - Intronic
930134461 2:47887282-47887304 TTTCAAAAAAAAAAGGTGGGGGG + Intronic
930336881 2:50059956-50059978 GTGCAGAAAGAAAATGTGAGTGG + Intronic
930508722 2:52317607-52317629 GAAAAGAAAGAAAAGGAGGGAGG + Intergenic
931069813 2:58633174-58633196 GTGAAAAATTAAAAGGTGGTTGG + Intergenic
931303236 2:61001802-61001824 ATGAATAAAAAAAAGGGTGGGGG - Intronic
931365190 2:61613169-61613191 CTCAAAAAAAAAAAGGTCGGCGG - Intergenic
931408012 2:61999923-61999945 CTCAAAAAAAAAAAAGTGGGTGG - Intronic
931628495 2:64278024-64278046 AGGAAGAAAAAAAGGGGGGGAGG - Intergenic
931781141 2:65580166-65580188 GTGGAGAAAGAAAAGGAGGCAGG - Intergenic
931917280 2:66969852-66969874 GTTAAAAAAAAAAAAGGGGGGGG + Intergenic
931917281 2:66969853-66969875 TTAAAAAAAAAAAAGGGGGGGGG + Intergenic
931920050 2:67005422-67005444 AGGAAGAAATATAAGGTGGGAGG + Intergenic
932147523 2:69336034-69336056 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
932160843 2:69458168-69458190 GTGAACAAGAGAAAGGAGGGGGG - Intronic
932527191 2:72483463-72483485 TTAAAGAAAAAAAAGGGAGGTGG + Intronic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
932963873 2:76447422-76447444 GTGTAAAAAAGAAAGGAGGGAGG - Intergenic
933201743 2:79458516-79458538 GTGATGAAAAAATAAGTGAGTGG - Intronic
933269948 2:80222586-80222608 GTGAAGAAGAAAAAAGTGCTTGG - Intronic
933305569 2:80593850-80593872 GTGGATAAAGAAAATGTGGGTGG - Intronic
933542914 2:83671265-83671287 GGGAACAAAAGAAAGGAGGGAGG + Intergenic
933690793 2:85178093-85178115 GTGAGGAAAAAAATGGTATGAGG + Intronic
933846544 2:86331515-86331537 AAGGAAAAAAAAAAGGTGGGGGG + Intronic
934245793 2:90304727-90304749 AAGAAAAAAAAAAGGGTGGGGGG + Intergenic
934262954 2:91492310-91492332 AAGAAAAAAAAAAGGGTGGGGGG - Intergenic
934495702 2:94795395-94795417 AATAAAAAAAAAAAGGTGGGGGG + Intergenic
934511335 2:94946740-94946762 GTGGAGAAAGAAAAGATGGTAGG - Intergenic
934879248 2:97959196-97959218 CTGAAGTAAAGAAACGTGGGGGG + Intronic
935108289 2:100067184-100067206 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
935321563 2:101894648-101894670 TTTAAGGAAAAAAGGGTGGGGGG - Intronic
935485459 2:103647742-103647764 CTTAAGAAAAAAAGGTTGGGAGG + Intergenic
935531558 2:104239143-104239165 GTAAGGAGCAAAAAGGTGGGTGG + Intergenic
935819170 2:106876982-106877004 TAGAGGAAAAAAAAGGTGGTAGG + Intronic
935970022 2:108521979-108522001 GTCAAGAAAAAAAAGGGGGGGGG + Intergenic
936122498 2:109758944-109758966 GGGAAGAAAAAAGAGGAGGGAGG + Intergenic
936222195 2:110612528-110612550 GGGAAGAAAAAAGAGGAGGGAGG - Intergenic
936971473 2:118180317-118180339 GTGATGGAAAAACAGGTGGATGG + Intergenic
937038578 2:118803051-118803073 GTGAAGGAGAAAAAGGAGTGAGG + Intergenic
937162893 2:119782706-119782728 CTCAAAAAAAAAAAGGGGGGTGG - Intronic
937392862 2:121506487-121506509 TAGGAAAAAAAAAAGGTGGGGGG + Intronic
937562034 2:123238067-123238089 ATTAAAAAAAAAAAGGCGGGGGG + Intergenic
937571814 2:123372253-123372275 GTGAAGACATAAAAGGTGCTTGG - Intergenic
937742489 2:125372996-125373018 GAGAAAAAAAAAGAGCTGGGAGG - Intergenic
938201525 2:129376675-129376697 GGGCAGAATAAAAAGTTGGGGGG - Intergenic
938479949 2:131652766-131652788 GTGAAGGAATAAAGGGTGGTTGG - Intergenic
938539219 2:132272780-132272802 GACAAGAAATAAAAGTTGGGGGG - Intergenic
938544319 2:132314171-132314193 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
938723072 2:134083646-134083668 GGGAAGAGAAAAAGGCTGGGGGG - Intergenic
938732765 2:134159296-134159318 GGGAAGAAAAAAAAAGAGGAAGG - Intronic
939191731 2:138924536-138924558 GAGAAGAGAGAAAAGGTGGAAGG - Intergenic
940085110 2:149850443-149850465 GAAAAGAAAAACAAGGAGGGAGG + Intergenic
940275204 2:151932831-151932853 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
940524964 2:154801473-154801495 GAAAAGAAAAGAAAGGAGGGAGG - Intronic
940745208 2:157559962-157559984 GGGAAGGAAGAAAAGGAGGGAGG + Intronic
941225295 2:162839730-162839752 GGGAAGGAACAAAAGGTGGGTGG + Intergenic
941287363 2:163630662-163630684 TTGTACAAAAAAAAGGGGGGGGG + Intronic
941784076 2:169479239-169479261 GTGAAGAGAAATAAGGAGAGGGG + Exonic
941898306 2:170653067-170653089 ATGAAGAAAAAAAGGAAGGGTGG - Exonic
941898900 2:170658884-170658906 GAGAAGAAAAACAATGTTGGAGG - Intergenic
941957492 2:171219596-171219618 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
942336194 2:174888921-174888943 GTGAATCCACAAAAGGTGGGAGG + Intronic
942430839 2:175909734-175909756 AATAAGAAAAAAAAGGTGGAGGG + Intergenic
942473109 2:176283241-176283263 GTGAAGAACAAAAAGGGAGGTGG - Intronic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
943007829 2:182408218-182408240 GTGGGAAAATAAAAGGTGGGAGG - Intronic
943229458 2:185229394-185229416 GTAAAGAAAAAGAAAGAGGGAGG + Intergenic
943287966 2:186029162-186029184 ATTTAGAAAAAAAAGGTAGGAGG + Intergenic
943641806 2:190367927-190367949 GGGAAGAAAAAAAAGGAAGGGGG - Intronic
944349135 2:198706071-198706093 AAGAAAAAAAGAAAGGTGGGAGG + Intergenic
944700222 2:202239447-202239469 CTCAAAAAAAAAAAGGTGGCGGG + Intergenic
944714180 2:202362381-202362403 AAAAAGAAAAAAAAGGTGGGGGG - Intergenic
944865944 2:203861952-203861974 ATAAAAGAAAAAAAGGTGGGGGG - Intergenic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945396817 2:209328561-209328583 CTGCAGGAAAAAAAAGTGGGGGG + Intergenic
945582707 2:211616078-211616100 GTCAAGCAAAGAAAGGTGGGTGG - Intronic
945768528 2:214010868-214010890 GTGAGTAAAAAGAAAGTGGGAGG + Intronic
945826483 2:214726037-214726059 CAAAAAAAAAAAAAGGTGGGGGG + Exonic
945834555 2:214823143-214823165 GAAAAGAAAAGAAAGGAGGGAGG + Intergenic
945923464 2:215779755-215779777 GTGAAGTAAAGAAAGGTTGCAGG - Intergenic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
946057330 2:216913606-216913628 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
946108146 2:217390318-217390340 GTGAAGAAATAAGATTTGGGTGG - Intronic
946384082 2:219371266-219371288 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
946472232 2:219971706-219971728 GAGAAAAAAAAAAATGTGAGTGG - Intergenic
946501119 2:220248395-220248417 GTGAAGAAATAAAAAGAGTGTGG + Intergenic
946540793 2:220682325-220682347 ATGAAGAATAAAAAGGGGGCTGG - Intergenic
946689914 2:222302067-222302089 AAAAAAAAAAAAAAGGTGGGCGG + Intronic
946863373 2:224021241-224021263 GTGAAGAAAGAAAGGGTGCCCGG + Intronic
946914931 2:224509212-224509234 CTTAAGAAAAAAAAGGTGGGGGG - Intronic
947077672 2:226363771-226363793 GAGAAGAAAAGAAAGAAGGGAGG + Intergenic
947411550 2:229846018-229846040 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
947904088 2:233747147-233747169 ATGAAGAAAACAAATGTAGGAGG + Intronic
948188934 2:236043723-236043745 GGGAAAAAAAAAAAGTGGGGGGG + Intronic
948206507 2:236165252-236165274 GTGAATAATAAAAAGGAGAGAGG - Exonic
948314889 2:237020445-237020467 GAGAAAAAAAAAATGGTGTGTGG - Intergenic
948966698 2:241387246-241387268 GGGAAGAAAGAAAAGGAGGGAGG + Intronic
949011825 2:241684760-241684782 GTAAAACAAAAAAAGGTGGTAGG + Intronic
949038075 2:241828043-241828065 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1168758683 20:333722-333744 TGTAAAAAAAAAAAGGTGGGGGG + Intergenic
1168950449 20:1796549-1796571 GTGAAGAGAAATGATGTGGGAGG - Intergenic
1169448745 20:5693481-5693503 TTGCACACAAAAAAGGTGGGCGG + Intergenic
1169449287 20:5697503-5697525 AAAAAAAAAAAAAAGGTGGGCGG + Intergenic
1169561594 20:6807174-6807196 GAGAATAGCAAAAAGGTGGGAGG - Intergenic
1169833009 20:9845874-9845896 TTCAAGAAGAATAAGGTGGGAGG + Intergenic
1170020194 20:11829116-11829138 GTTGAGAAAAGATAGGTGGGAGG - Intergenic
1170169403 20:13393874-13393896 GCCAAAAAAAAAAAGGTGTGGGG + Intronic
1170329517 20:15193123-15193145 GAGAAGAGAAAGAAGATGGGAGG - Intronic
1170331219 20:15213019-15213041 GTGCAAAAAGAAAAGGTGGTTGG + Intronic
1170540384 20:17381753-17381775 GTGGAGAAAAAAAGGGAGGGTGG - Intronic
1170961995 20:21033844-21033866 GGGAAGAAAAAAAAGAGAGGTGG - Intergenic
1171453973 20:25256384-25256406 GTTAAAAAAAAAAAAGTGGAGGG + Intronic
1171848686 20:30292768-30292790 GTGAGGAAAAAATTGGGGGGTGG + Intergenic
1171966174 20:31532503-31532525 GGGAAAAAAAAAAAAGTAGGGGG - Intronic
1171974186 20:31583609-31583631 TTAAAGAAAAAAAAGGGGGCTGG + Intergenic
1172043013 20:32059300-32059322 GAAAAGAAAAGAAAGGAGGGAGG - Intronic
1172052460 20:32128869-32128891 GCTTAGAAAGAAAAGGTGGGAGG + Intronic
1172087780 20:32401553-32401575 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1172342267 20:34167782-34167804 GTAAAGGAAAATAAGGTTGGAGG + Intergenic
1172549782 20:35789856-35789878 GTGTATAAAAAAAAAGGGGGGGG - Intronic
1172744492 20:37196227-37196249 CTCAAAAAAAAAAAGGTGGGGGG - Intronic
1172790007 20:37496570-37496592 GTAAAGATATAAAAGTTGGGAGG - Intronic
1172819791 20:37721512-37721534 CTGAAGAGAAAAAAGGTAGGGGG - Intronic
1172828694 20:37813014-37813036 ATTAAAAAAAAAAAGTTGGGAGG + Intronic
1173080421 20:39861941-39861963 GTAAAAAAAAAAAAAGCGGGGGG + Intergenic
1173088205 20:39945131-39945153 GTGAGGCAAAGAAAGGTGGAAGG + Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173818850 20:46008132-46008154 GTAAAAAAAAAAACGGGGGGTGG - Intergenic
1174023430 20:47550451-47550473 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1174587408 20:51619563-51619585 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1174589448 20:51633766-51633788 GAAAAGAAAAAAAGGGAGGGAGG + Intronic
1175101258 20:56580321-56580343 GTCAAAAAGAACAAGGTGGGTGG + Intergenic
1175245759 20:57581110-57581132 GTGAATTGAGAAAAGGTGGGGGG - Intergenic
1175709622 20:61208963-61208985 CTGGAAAAAAAAAAGGGGGGGGG - Intergenic
1176444404 21:6806856-6806878 GTGAAGGAATAAAGGGTGGTTGG - Intergenic
1176649009 21:9528992-9529014 GTGAAGAAAGAAAAGACGGTGGG - Intergenic
1176822569 21:13671894-13671916 GTGAAGGAATAAAGGGTGGTTGG - Intergenic
1176848281 21:13893387-13893409 TAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1178063522 21:28877396-28877418 GGGAAGAAAAAAAAGAAGGAAGG + Intronic
1178122275 21:29481476-29481498 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1178455295 21:32744275-32744297 AAGAAAAAAAAAAAGGAGGGGGG + Intronic
1178473775 21:32918442-32918464 GTCAAAAAAAAAAAGGGGGGGGG + Intergenic
1178603084 21:34011993-34012015 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1178836979 21:36106699-36106721 TTTGAGAAAAAAAAGGGGGGGGG + Intergenic
1179311539 21:40200241-40200263 GGGAAGAAGAAAAAGTTTGGGGG - Intronic
1179404301 21:41112686-41112708 GGGAAGAAAAGAAGGGAGGGAGG + Intergenic
1180061834 21:45389370-45389392 GAGAAGAAAAAAATGGTAAGTGG - Intergenic
1180481074 22:15755187-15755209 GTGAAGGAATAAAGGGTGGTTGG - Intergenic
1180723014 22:17923398-17923420 CTGTAGAAAAAAAATGTGGTAGG - Intronic
1180729880 22:17973249-17973271 ATGGGGAAAACAAAGGTGGGGGG + Intronic
1180825740 22:18859608-18859630 TTGAAAAAAAAAAAGGGGGGGGG + Intronic
1181212209 22:21295553-21295575 TTGAAAAAAAAAAAAGGGGGGGG + Intergenic
1181268939 22:21647568-21647590 AAAAAGAAAAAAAAGGGGGGGGG + Intergenic
1181847753 22:25725946-25725968 CTCAAAAAAAAAAAGGAGGGGGG + Exonic
1182011145 22:27001712-27001734 GAGAGAAAAAAAAAGGTGGGAGG - Intergenic
1182136831 22:27912990-27913012 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1182224041 22:28781941-28781963 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
1182263153 22:29090652-29090674 TTGAAGAAAAAAAATAAGGGAGG + Intronic
1182286326 22:29250349-29250371 GAGAAGAAGAAAAAGGCAGGAGG - Intronic
1182753745 22:32661699-32661721 GTGTTGACAAGAAAGGTGGGGGG - Intronic
1182766841 22:32763936-32763958 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1182833511 22:33322824-33322846 TTGTAGAAAAAAAAGGTGGCCGG + Intronic
1182838547 22:33364381-33364403 TTGAAAAAACAAAAGATGGGAGG - Intronic
1182888170 22:33793780-33793802 ATGAAAAAAAAAAAGTTGGGGGG - Intronic
1183080456 22:35452468-35452490 GTGTTGAATAAACAGGTGGGTGG + Intergenic
1183092319 22:35531046-35531068 AAAAAGAAAAAAAAAGTGGGGGG - Intergenic
1183153972 22:36059867-36059889 GTGAATAAAGAAACTGTGGGGGG + Intergenic
1183707161 22:39481151-39481173 GTGAAGAACAGCAAGGCGGGTGG - Intronic
1183724854 22:39582821-39582843 ATGAAGCAAAGAAGGGTGGGTGG - Intronic
1183807246 22:40221754-40221776 GTCAAAAAAAAAAAAGGGGGGGG - Intronic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1183926174 22:41207830-41207852 CTCAAAAAAAAAAAGCTGGGTGG - Intronic
1183980475 22:41536889-41536911 TTTAAAAAAAAAAAGGTGGGGGG + Intronic
1184174775 22:42782191-42782213 CTCAAAAAAAAAAAAGTGGGGGG - Intergenic
1184795935 22:46732417-46732439 GAGAAGAAAAATAAATTGGGTGG + Intronic
1185061947 22:48611737-48611759 GTGAGTCAGAAAAAGGTGGGAGG - Intronic
1203322913 22_KI270737v1_random:86024-86046 AGGAAGAAAAGAAGGGTGGGAGG - Intergenic
949385465 3:3497242-3497264 CAGAGGAAAAAAAAAGTGGGGGG + Intergenic
949504351 3:4713074-4713096 AAGAAAAGAAAAAAGGTGGGGGG + Intronic
949710414 3:6864001-6864023 GTGGTGAAAAAAGGGGTGGGGGG + Intronic
949859356 3:8491568-8491590 GTTAAAAAAAAAAAGGGGGTGGG + Intergenic
949881703 3:8666480-8666502 GGGAAGAAAAACAAGGAAGGGGG + Intronic
950023947 3:9808197-9808219 ATGAAAAAAAAAAAGGGGGGGGG - Intronic
950213244 3:11139272-11139294 ATAAAAAAAAAAAAGGCGGGCGG - Intronic
950582025 3:13868641-13868663 GAGAAAGAAAAAAAGGAGGGAGG + Intronic
950696934 3:14708464-14708486 TTGAAAAAAAAAAAAGTGGGAGG - Intronic
950808475 3:15628900-15628922 CTGATTTAAAAAAAGGTGGGGGG - Intronic
950915031 3:16636230-16636252 GTGAAGCAAAACAAGGTAGGGGG + Intronic
951194566 3:19809397-19809419 GTTAAAAAAAAAAAGGTGGGGGG + Intergenic
951386231 3:22045971-22045993 GGGAAGAAAAATAATGAGGGAGG + Intronic
951441314 3:22727060-22727082 CTGAGGAAATAAAAGGAGGGAGG - Intergenic
951505518 3:23440834-23440856 GAGCAGGAAAAAAAGTTGGGGGG - Intronic
951584194 3:24198457-24198479 GTTAAAAAAAAAAGGGGGGGGGG - Intronic
952100392 3:30005193-30005215 GTGCAAAAAAAAAAAGAGGGTGG + Intronic
952274595 3:31865065-31865087 GAGAAGAAAAGAAGGGAGGGAGG + Intronic
952293550 3:32041154-32041176 GTCAAGAGAAAAAATGAGGGAGG + Intronic
952635831 3:35529427-35529449 GTGGAAAAAAAAAAGTGGGGAGG + Intergenic
953029149 3:39166135-39166157 CTGAAGAAAAAAAGGGTGGAAGG + Intergenic
953175279 3:40545734-40545756 TGGAGAAAAAAAAAGGTGGGGGG + Intronic
953386414 3:42508740-42508762 GAGAGGAGAGAAAAGGTGGGAGG - Intronic
953991939 3:47490642-47490664 GAAGAGAAAAGAAAGGTGGGGGG + Intergenic
954014344 3:47673383-47673405 CTCAAAAAAAAAAGGGTGGGGGG + Intronic
954016430 3:47696064-47696086 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
954288011 3:49632785-49632807 GTGTCTAAAAAAAAAGTGGGGGG + Intronic
954340200 3:49947249-49947271 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
954882054 3:53843180-53843202 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
955014591 3:55057752-55057774 GGGAAGAAAAAAATGGAGGTGGG - Intronic
955141369 3:56273241-56273263 AGAAAGAAAAAAAAAGTGGGAGG - Intronic
955142790 3:56286115-56286137 GTGAAAGAAAAATAGGTGGCCGG + Intronic
955176309 3:56617448-56617470 GAGAAGAAAAAAAAGTAAGGAGG + Exonic
955307208 3:57845839-57845861 TCCAAAAAAAAAAAGGTGGGGGG - Intronic
955551668 3:60091747-60091769 GAGAAGAAAGGCAAGGTGGGAGG - Intronic
955662630 3:61317309-61317331 GGGAAGAAAGAAAAGAAGGGAGG + Intergenic
955960167 3:64332494-64332516 TTTAAAAAAAAAAGGGTGGGGGG - Intronic
955990246 3:64619250-64619272 GTGGAGAAAAAACAGGTAAGGGG + Intronic
955990494 3:64621805-64621827 AAAAAGAAAAAAAAGGTAGGCGG + Intronic
956009798 3:64818374-64818396 GTGAAGAAAAGAATGGGAGGTGG - Intergenic
956102096 3:65779168-65779190 GTGAAGAAAAAAAATGAGTGAGG - Intronic
956499516 3:69866822-69866844 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
956607279 3:71085451-71085473 GTGAAGTAAAAAAAGCTAAGTGG - Intronic
956864659 3:73357106-73357128 ATGAAGAAAGAAAAAGAGGGAGG - Intergenic
956890413 3:73607682-73607704 ATGAAGGAAAAAAAAATGGGAGG - Intronic
956966744 3:74470548-74470570 GTGAAGAAAAAAGCCTTGGGTGG + Intronic
956995992 3:74826603-74826625 TTAAAAAAAAAAAAGGTTGGGGG + Intergenic
957053068 3:75425160-75425182 AAAAAAAAAAAAAAGGTGGGCGG + Intergenic
957290797 3:78275994-78276016 CAGAAAAAAAAAAAGGTGTGGGG + Intergenic
957517967 3:81280634-81280656 GACAAAAAAAAAAAGGTGGGGGG + Intergenic
957548425 3:81670808-81670830 TTCAAGAAAAAATAGGAGGGAGG + Intronic
957912093 3:86633022-86633044 ATCAATAAAAATAAGGTGGGGGG + Intergenic
958032865 3:88134102-88134124 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
958863559 3:99472879-99472901 GAGAAGAAAAAACAAGTGGAGGG - Intergenic
959115810 3:102177121-102177143 GTGAATAAAAAAAAGAGGGGGGG - Intronic
959176195 3:102914232-102914254 GTGAATACATAAAAGGAGGGAGG + Intergenic
959497525 3:107068763-107068785 GTGAGGAAAAAGAAGGTAGGGGG - Intergenic
959513994 3:107245114-107245136 TAAAAAAAAAAAAAGGTGGGGGG - Intergenic
959836791 3:110927382-110927404 TTGAAGAAAGAAAAGGAAGGAGG + Intergenic
959859800 3:111204388-111204410 GGGAAAAAAAAAAAAGAGGGAGG + Intronic
960191894 3:114716579-114716601 GGGAAGAGCAAAAAGGTAGGAGG - Intronic
960341898 3:116485444-116485466 ATGAAGAAAAATAAGGCAGGAGG + Intronic
960351507 3:116599180-116599202 AAGAAAAAAAAAAGGGTGGGGGG - Intronic
960363448 3:116742266-116742288 GAGAAGAAAAAAAAAAAGGGGGG + Intronic
960431882 3:117579556-117579578 GAGAAGAAGAAAGAGGTCGGGGG + Intergenic
960601785 3:119466093-119466115 GAAAAGAAAAGAAAGGAGGGAGG + Intronic
960607449 3:119521693-119521715 TTTAAAAAAAAAAAAGTGGGCGG + Intronic
960627512 3:119695409-119695431 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
960694081 3:120378635-120378657 TTAAAAAAAAGAAAGGTGGGAGG - Intergenic
960719625 3:120613060-120613082 GGAAAGAAAGAAAAGGTAGGTGG - Intergenic
960960272 3:123066017-123066039 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
961235377 3:125361880-125361902 GTGGATAAAGAAAAGGGGGGTGG - Intronic
961301768 3:125926377-125926399 AAAAAAAAAAAAAAGGTGGGTGG - Intergenic
961339794 3:126210498-126210520 GGGAAGAAGAAATGGGTGGGAGG - Intergenic
961690990 3:128669392-128669414 GAAAAGAAAAGAAAGGAGGGAGG + Intronic
961719527 3:128883654-128883676 TAGAAAAAAAAAAAGGTTGGAGG - Intronic
961856069 3:129872696-129872718 ATGAGGAAAATAAAGGTGAGGGG + Intronic
961860679 3:129914797-129914819 GGGAAAAAAAAAAAGCTGGAGGG - Intergenic
961930295 3:130526149-130526171 CTGACTATAAAAAAGGTGGGAGG + Intergenic
961977770 3:131044430-131044452 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
962157886 3:132967975-132967997 TTCCAGAAAGAAAAGGTGGGAGG + Intergenic
962326523 3:134438519-134438541 GTTAAAAAAAAAAAGGGGCGGGG - Intergenic
962332973 3:134496418-134496440 GGATAGAAAAAAAAGGGGGGGGG + Intronic
962426858 3:135277868-135277890 GAAAAAAAAAAAAAGGTGGGGGG + Intergenic
962563074 3:136628456-136628478 CTGGAGAAAAAAAAGGGGTGGGG + Intronic
962572514 3:136724816-136724838 GTTAAGAAAATAAAGGCAGGAGG + Intronic
962922130 3:139959739-139959761 GTAGAGTAAAAAAAGGGGGGCGG - Intronic
963049326 3:141128037-141128059 GAGAAGAAAAAGAAGGCTGGTGG + Intronic
963376773 3:144477109-144477131 ATGAAGAAATAAAAGGAGAGAGG - Intergenic
963422299 3:145075499-145075521 GTGAAGGAAAAAAATGTGCTAGG + Intergenic
963441868 3:145350163-145350185 GGGAAGTCAAAAAAGGTGTGTGG - Intergenic
963524842 3:146404808-146404830 GCAAAAAAAAAAAAGGGGGGGGG + Intronic
963768951 3:149368950-149368972 CTGGAAAAAAAAAAGGGGGGGGG + Intergenic
963916311 3:150861813-150861835 GGAAAAAAAAAAAAGGGGGGGGG - Intergenic
963941011 3:151096385-151096407 CTGAGGAAAAAAAAGGGGGTGGG - Intronic
964081245 3:152760713-152760735 TTGAAGAAAAAAAAATTGGGGGG - Intergenic
964206769 3:154183682-154183704 ATGTAAAAATAAAAGGTGGGTGG + Intronic
964385605 3:156144643-156144665 GAGAAGAGAGAAAACGTGGGGGG - Intronic
964400799 3:156296468-156296490 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
964558165 3:157963962-157963984 CAGAAAAAAAAAAAGGGGGGCGG + Intergenic
964657003 3:159078544-159078566 GGCAAAAAAAAAAAGGCGGGGGG - Intronic
964890699 3:161531350-161531372 GTGAAGAAAACAAAGTGAGGAGG - Intergenic
964942013 3:162170031-162170053 AGGAAGAAAAGAAAGGAGGGAGG - Intergenic
965532334 3:169785057-169785079 ATTATGAAAAAAAAGGGGGGGGG + Intronic
965539603 3:169859004-169859026 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
965590203 3:170356056-170356078 AAGAAGGAAGAAAAGGTGGGGGG + Intergenic
965641477 3:170833333-170833355 ATGAAGATAAAAAATGTGGGAGG + Intronic
965990117 3:174807201-174807223 ATGAAGAAAAAAAAGTTGGGTGG - Intronic
966729387 3:183137815-183137837 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
966864157 3:184247644-184247666 GGAAAGAAGAAAAAGGTGAGGGG - Intronic
966957803 3:184902114-184902136 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
967104570 3:186245006-186245028 GTCAGGAAAAAAAAAGTGGAGGG + Intronic
967616762 3:191579111-191579133 GAAAAGAAAAAAAAGGTGGAGGG - Intergenic
967801802 3:193670380-193670402 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
967824304 3:193866570-193866592 CAAAAAAAAAAAAAGGTGGGGGG + Intergenic
968197340 3:196718311-196718333 CTGAAGAAAAAAAAAAGGGGGGG + Intronic
968265105 3:197356679-197356701 GTGAAGAACACAGAGGTGGGTGG + Intergenic
968378555 4:67295-67317 GTTTAAAAAAAAAGGGTGGGGGG + Intronic
968914196 4:3490061-3490083 GTGAAGAAAGGAATGGGGGGAGG - Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969942012 4:10742101-10742123 GTGAAGAGTAGAGAGGTGGGAGG - Intergenic
970015216 4:11505475-11505497 GCAAAAAAAAAAAAGGGGGGGGG - Intergenic
970322963 4:14893726-14893748 GTGAAGAGAGACATGGTGGGGGG - Intergenic
970336777 4:15054874-15054896 ATGAATAAAAAAAAGAGGGGAGG + Intronic
970506224 4:16733353-16733375 GAAAAAAAAAAAAAGTTGGGGGG + Intronic
970535681 4:17027711-17027733 CTGATGAAACACAAGGTGGGTGG + Intergenic
970549287 4:17163446-17163468 ATGGAGAAAAACATGGTGGGTGG + Intergenic
970584218 4:17499976-17499998 AGAAAAAAAAAAAAGGTGGGGGG - Intronic
971065297 4:23025252-23025274 GAAAAAAAAAAAAAGATGGGAGG - Intergenic
971087480 4:23295824-23295846 ATGGAAAAAAAAAAGGGGGGTGG + Intergenic
971323491 4:25624643-25624665 CTTAAGAAAAAAAAAGTGTGGGG - Intergenic
971376253 4:26058078-26058100 GTAAAAAAAAAAAAGTTTGGAGG - Intergenic
971439174 4:26661323-26661345 GTAAGGAAAAAGAAGGTGGAGGG - Intronic
971457828 4:26860916-26860938 AAAAAAAAAAAAAAGGTGGGGGG - Exonic
971505777 4:27365225-27365247 ATGAAGACAATGAAGGTGGGGGG - Intergenic
971512041 4:27438476-27438498 GAGAAGAAAATAAATTTGGGAGG + Intergenic
971690544 4:29828882-29828904 GTGAAAAGTTAAAAGGTGGGGGG + Intergenic
971826444 4:31629833-31629855 TGTTAGAAAAAAAAGGTGGGGGG + Intergenic
971844789 4:31905538-31905560 GTGAAGATAAGAGATGTGGGAGG - Intergenic
971862142 4:32121729-32121751 GGGAAGGAAAAAAAGAAGGGAGG - Intergenic
972033186 4:34488592-34488614 GTGTACAAAAAAAAGGAGGCAGG + Intergenic
972190322 4:36583645-36583667 ATGAAGAGGGAAAAGGTGGGGGG + Intergenic
972322718 4:37987285-37987307 CTGAAAAAAAAAAAAGTGGAAGG - Intronic
972361399 4:38328707-38328729 GGGAGGAAAAAGAAGGAGGGAGG - Intergenic
972462192 4:39315049-39315071 GTGAAGGAGAAAGAAGTGGGAGG - Intronic
972506984 4:39728965-39728987 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
972591158 4:40488332-40488354 AAGAAAAAAAAAAGGGTGGGGGG + Intronic
972617301 4:40711868-40711890 TCAAAAAAAAAAAAGGTGGGGGG - Intergenic
972920842 4:43939177-43939199 TCTCAGAAAAAAAAGGTGGGAGG + Intergenic
972954305 4:44370006-44370028 ATGAAGAAAATAAAGCTGGATGG + Intronic
973181984 4:47280289-47280311 GTCAATAAAACAAAAGTGGGGGG - Intronic
973261601 4:48170628-48170650 CTGAAGAACAAAATGGTGGCAGG - Intronic
973317579 4:48779002-48779024 GAAAAGAAAAAAAAGGGGGTGGG - Intronic
973565451 4:52181779-52181801 TTTAAAAAAAAAAAGGGGGGGGG + Intergenic
973981363 4:56310790-56310812 GCAAAAAAAAAAAAGGGGGGGGG - Intronic
974035847 4:56817499-56817521 ACTAAGAAAAAAAAGGTTGGAGG + Intronic
974062498 4:57048050-57048072 CTCAAAAAAAAAAAGGGGGGCGG - Intronic
974074140 4:57153490-57153512 GTGAAGTCAATAAAGGTGGATGG + Intergenic
974283098 4:59824750-59824772 CTGGAGAAAAGAAAGGAGGGTGG - Intergenic
974332867 4:60502958-60502980 GGAAAGAAAAGAAAGGAGGGAGG - Intergenic
974466441 4:62262689-62262711 GGCAAAAAAAAAAAGGTGGGGGG + Intergenic
974592546 4:63972577-63972599 ATGAAGAAAGCAAAGGTGGCTGG - Intergenic
974734215 4:65908449-65908471 ATGAAGAAAAAGAAAGTTGGGGG + Intergenic
974932559 4:68375609-68375631 CTGGAGAAAAAAGATGTGGGAGG - Intergenic
974983951 4:68995417-68995439 AAGAAGAAATAAGAGGTGGGTGG + Intergenic
975120418 4:70722251-70722273 CAGCTGAAAAAAAAGGTGGGGGG + Exonic
975143929 4:70946818-70946840 GGAAGGAAAAAAAAGGAGGGAGG + Intronic
975570795 4:75815952-75815974 CAAAACAAAAAAAAGGTGGGGGG - Intergenic
975773865 4:77761336-77761358 GAAAAAAAGAAAAAGGTGGGAGG + Intronic
975962968 4:79935216-79935238 TTTAAAAAAAAAAAGTTGGGGGG - Intronic
976257499 4:83113658-83113680 GTGATTAAAAAAAAGTTGGCAGG + Intronic
976623746 4:87156157-87156179 CTCAAAAAAAAAAAGGGGGGGGG + Intergenic
976783461 4:88788748-88788770 GCGAAGAAAAACAAGGTTTGAGG - Intronic
976813787 4:89124106-89124128 CAAAAAAAAAAAAAGGTGGGTGG - Intergenic
977421611 4:96807749-96807771 GAGGAGAAAATAAAGGTGGATGG - Intergenic
977495886 4:97774867-97774889 GAGAAGAAAAAAGAGGTGGAAGG + Intronic
977556447 4:98491687-98491709 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
977692355 4:99928334-99928356 GTGGAGACATAAAAGGTGGAAGG - Intronic
977846375 4:101772807-101772829 AAGAAGAAAAAAAAAGTGGAGGG + Intronic
978285431 4:107072715-107072737 GTAAAGAAAGAAAATGTGAGGGG + Intronic
978453332 4:108860756-108860778 GTGAGGAAAATAAAGGAGGTAGG + Intronic
978500074 4:109400055-109400077 TTGAGAAAAAAAAAGGGGGGGGG - Intergenic
978576026 4:110190799-110190821 TTGAAAAAAAAAAAAGTGGCCGG - Intronic
978835350 4:113142722-113142744 ATGAAGAAAAAGAAAGAGGGGGG + Intronic
979159577 4:117442694-117442716 GTGGATAAAGAAAATGTGGGGGG - Intergenic
979541281 4:121886100-121886122 GAGAAGAAATAAGATGTGGGTGG + Intronic
979580761 4:122356741-122356763 AAGAAAAAGAAAAAGGTGGGTGG + Exonic
979685939 4:123510375-123510397 GTGAAGAAAAATAAGGAGACTGG - Intergenic
979853442 4:125601985-125602007 GTGAAGAAAAAACATGTTTGTGG - Intergenic
979993667 4:127405576-127405598 ATGAAGCAAAAAAAGGAGAGAGG - Intergenic
980144323 4:128962545-128962567 GTTTAGAGAAAAAAGGTGGGAGG - Intronic
980221339 4:129919867-129919889 GCAAAGAAAAAAAAGTTGGAAGG + Intergenic
980504991 4:133707160-133707182 AAGTATAAAAAAAAGGTGGGGGG - Intergenic
980589800 4:134870701-134870723 GTAAACAAGAAAAAGGTGAGTGG - Intergenic
980624846 4:135361425-135361447 ATAAAGAAATAAAAGGTGGAAGG + Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
980804414 4:137793209-137793231 GAAAAGAAAAGAAAGGAGGGAGG + Intergenic
981077669 4:140607312-140607334 GTGAGATAAAAAATGGTGGGGGG - Intergenic
981105642 4:140877750-140877772 GTTAAGGAAACAAAGGTGTGGGG + Intronic
981176165 4:141686328-141686350 ATAAATAAATAAAAGGTGGGAGG + Intronic
981223917 4:142269290-142269312 GAGAGGAAAAAAGAGGGGGGAGG - Intronic
981266814 4:142794182-142794204 CTAAAGAAAAACAAGGTAGGAGG + Intronic
981292844 4:143096574-143096596 GTGAAGAGAAAACAGGGGAGAGG - Intergenic
981550725 4:145938109-145938131 CTCAAGGAAAAAAAGGGGGGGGG + Intronic
981652543 4:147076252-147076274 GTGAAGAAAATAAAGATGTTGGG - Intergenic
981732534 4:147914560-147914582 GTTAAAAAAAAAAAGGGGGGGGG - Intronic
981849536 4:149213271-149213293 GTGAGGAAAAAAAGTGGGGGTGG - Intergenic
982009568 4:151093606-151093628 GTTAAGAAAAAAAAATTGGTCGG + Intergenic
982073471 4:151716269-151716291 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
982298413 4:153853818-153853840 GTGAATAAAGAAAATGTGGTAGG - Intergenic
982449538 4:155535835-155535857 GTGAAGGAAAGGAAGGTGTGAGG + Intergenic
982501739 4:156165938-156165960 TGTAAAAAAAAAAAGGTGGGGGG + Intergenic
982662781 4:158226874-158226896 GAAAAGAAAAAAAGGGGGGGCGG - Intronic
982672272 4:158335377-158335399 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
982813814 4:159860595-159860617 GTGAACATAAAAAAGGTTTGTGG - Intergenic
983298416 4:165895726-165895748 TAAAAGAAGAAAAAGGTGGGAGG + Intronic
983302294 4:165942267-165942289 GAAAAAAAAAAAAAGGAGGGTGG - Intronic
983343180 4:166492602-166492624 ATTAAGAAAAAAAAGGAGAGAGG - Intergenic
983444039 4:167825883-167825905 ATGGAGAAAAAGAAGGTGAGAGG + Intergenic
983791394 4:171801799-171801821 ATAAACAAAAAAAAGGGGGGGGG - Intergenic
984167662 4:176321155-176321177 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
984254465 4:177374646-177374668 GGGAAGAAAGGAAAGGAGGGAGG - Intergenic
984499199 4:180536901-180536923 ATAAAGAAGAAAAAGCTGGGAGG - Intergenic
984620954 4:181951222-181951244 TGGAAGAAAAAAAATGTGTGTGG - Intergenic
984671196 4:182489838-182489860 GGGAAGAAAAGGAAGGAGGGAGG - Intronic
984872188 4:184335634-184335656 GAGGAGAAATCAAAGGTGGGAGG - Intergenic
985216841 4:187662548-187662570 GGAAAGAAAAAAAAGTGGGGGGG - Intergenic
985223000 4:187727887-187727909 GTGAAGAGAAGACCGGTGGGAGG + Intergenic
985310760 4:188595567-188595589 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
985374787 4:189323457-189323479 GTGAATATAAAAGCGGTGGGTGG - Intergenic
986635050 5:9812826-9812848 CTGAAGAGAAAAAAACTGGGAGG - Intergenic
986854847 5:11856544-11856566 GTCCAGAAAAGAGAGGTGGGAGG + Intronic
986934528 5:12866675-12866697 CTGAAAAAAAAAAATGTGTGTGG + Intergenic
987014074 5:13799425-13799447 GGGAAGAAAATATAGGTGTGTGG - Intronic
987050931 5:14145496-14145518 ACCAAAAAAAAAAAGGTGGGGGG - Intronic
987057977 5:14213219-14213241 GTGAAAAGAAAAGAGGAGGGAGG - Intronic
987091835 5:14514747-14514769 TTGAAAAAAAATAAAGTGGGGGG - Intronic
987343147 5:16956058-16956080 GGGAAAAAAAAAGAGGGGGGGGG + Intergenic
987445379 5:18011260-18011282 GTGAAGAGAAGAAGGGTGGATGG - Intergenic
987590351 5:19917342-19917364 GAAAAGAAAAAAAAGGGGGCGGG - Intronic
987689064 5:21244005-21244027 CTGAAGAAAAAATAGTTTGGTGG + Intergenic
988353231 5:30139933-30139955 AGGAAGAAAATAAAGGTAGGAGG - Intergenic
988528133 5:32004090-32004112 TTAAAAAAAAAAAAGGTGGGGGG + Intronic
988537093 5:32078806-32078828 GGGAAAAAAAAAAAAGTGTGGGG + Intronic
988644664 5:33081150-33081172 GTGAAGAAAGAAAGGAAGGGAGG - Intergenic
989055327 5:37360773-37360795 GAGATAAAAAAAAAGGGGGGGGG + Intronic
989167620 5:38446481-38446503 GGGAGGAAAAAAGAGTTGGGGGG - Intronic
989339507 5:40357487-40357509 AGGAAGGAAAAAAAGGAGGGAGG + Intergenic
989507945 5:42249031-42249053 GTAAAGAAAAAAAAAGTAGGTGG + Intergenic
989584399 5:43063332-43063354 GAAAAGAAAAGAAAGGTGGCAGG + Intergenic
989644149 5:43611103-43611125 GTAAAGAAAAAGAGGGAGGGAGG - Intronic
989654619 5:43733132-43733154 GAGAAGGAAAAAGTGGTGGGAGG - Intergenic
989669514 5:43899068-43899090 GTGAAGAAAGAAAATGCAGGAGG - Intergenic
990327111 5:54689325-54689347 GAGATTAAAAGAAAGGTGGGGGG - Intergenic
990367074 5:55082038-55082060 CAGAAAAAAAAAAAGGGGGGGGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
990640297 5:57775989-57776011 TTAAAAAAAAAAAGGGTGGGGGG - Intergenic
990649378 5:57880936-57880958 GTGAAGAAACAGCAGCTGGGAGG - Intergenic
990779031 5:59337329-59337351 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
990967894 5:61469700-61469722 GTCTAAAAAAAAAAGGTTGGGGG - Intronic
991229959 5:64321181-64321203 GAGGAAAAAAAAAGGGTGGGGGG + Intronic
991245281 5:64503672-64503694 AGGAAGGAAAAAAAGGAGGGAGG + Intergenic
991336428 5:65553099-65553121 GCAAAAAATAAAAAGGTGGGGGG + Intronic
991902771 5:71477003-71477025 TAAAAAAAAAAAAAGGTGGGGGG - Intronic
992044567 5:72872749-72872771 CTCAAAAAAAAAAAGCTGGGGGG - Intronic
992111306 5:73496990-73497012 AAAAAGAAAAAAAAGGTGGCAGG + Intergenic
992426269 5:76661100-76661122 GTTAAAAATAAAAAGGTGTGGGG - Intronic
992446161 5:76835868-76835890 GTCAAAAAAAGAAGGGTGGGGGG - Intergenic
992899258 5:81277154-81277176 TTAGAAAAAAAAAAGGTGGGAGG + Intergenic
993247618 5:85470915-85470937 GTGAAAAAAAAGAAGGCGGCTGG + Intergenic
993476118 5:88366682-88366704 GTGCAGAAAAAGAAGGTAGCTGG + Intergenic
993555317 5:89329531-89329553 TTAAAAAAAAAAAAAGTGGGGGG + Intergenic
993665414 5:90689324-90689346 AAAAAAAAAAAAAAGGTGGGTGG - Intronic
993726381 5:91372077-91372099 CTGAAGATAAAGAAGGTGGGAGG - Intronic
994287633 5:97989584-97989606 GGGAGGAAAAAGAAGGTAGGAGG - Intergenic
994679659 5:102869886-102869908 GGGAAGAAACAAAAGGTAGAAGG + Intronic
994767059 5:103931793-103931815 GTGATTGAAAAAAAGGTGGTGGG + Intergenic
995250780 5:109991051-109991073 CTGAACAAAAAAGAGGTGGAGGG + Intergenic
995348980 5:111153493-111153515 GTTAAAAGAAAAAAGGTGTGAGG - Intergenic
995400014 5:111730523-111730545 TAAATGAAAAAAAAGGTGGGGGG + Exonic
995599722 5:113782146-113782168 GTTCAGAAAAAAAATGTGTGTGG - Intergenic
995644766 5:114299094-114299116 AGGAAGAAAGAAAAGGAGGGAGG - Intergenic
995669829 5:114590000-114590022 GTAAAAAAAAAAAAGGTGATGGG - Intergenic
995880506 5:116839747-116839769 GTGAAAGAAAAAAATGTGGATGG + Intergenic
996453124 5:123649725-123649747 GTTAACAAAAAAAAGGCGGGGGG - Intergenic
996564313 5:124863562-124863584 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
996674238 5:126155942-126155964 ATGAAGGAAAAAATGGGGGGGGG - Intergenic
996863229 5:128088394-128088416 AAGAAGAAATAAAAGGTGGAGGG + Intronic
997464604 5:134078963-134078985 AAGAAAAAAAAAAAGGAGGGGGG - Intergenic
997913659 5:137901997-137902019 GGAAAAAAAAAAAAAGTGGGAGG + Intronic
997966337 5:138359457-138359479 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
998035198 5:138909354-138909376 TTAAAAAAAAAAAGGGTGGGGGG - Intronic
998090838 5:139367470-139367492 GTTAAAAAAAAAGGGGTGGGGGG - Exonic
998106971 5:139474935-139474957 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
998283120 5:140831512-140831534 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
998552668 5:143092547-143092569 TTGAGAAAAAAAAAGGTGGGGGG - Intronic
998623458 5:143819639-143819661 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
998716121 5:144886612-144886634 GTGAAGAAAAAAAAAGAAGAAGG + Intergenic
998812080 5:145976443-145976465 GAAAAAAAAAAAAAGGTGGGGGG + Intronic
998852251 5:146362511-146362533 ATTAAGAAAAAAAAAGAGGGGGG - Intergenic
999259053 5:150226730-150226752 GTCAAAAAAAAAAAAGGGGGGGG + Intronic
999667244 5:153925921-153925943 ATGAAGAAAAATAAAGTGAGGGG - Intergenic
999899184 5:156067963-156067985 ATTAAAAAAAAAAAAGTGGGGGG - Intronic
1000068518 5:157718044-157718066 GGGAAGAAAGAAAAGGTAAGTGG - Intergenic
1000149912 5:158489864-158489886 GTGAAAAAAGAAGAGGTGGAAGG + Intergenic
1000713778 5:164614072-164614094 TTTAAGGAAAAAAAGGTGGGGGG + Intergenic
1000808808 5:165834887-165834909 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1000861065 5:166456676-166456698 TTAAAAAAAAAAAAGGTGGGGGG - Intergenic
1001062807 5:168508305-168508327 ATAAAAAAAAAAAAGGCGGGTGG - Intronic
1001155166 5:169266407-169266429 CTGAAGAAAAGGAATGTGGGTGG + Intronic
1001505832 5:172279649-172279671 GTGAAGAAAGAAAAGGTTGTTGG + Intronic
1001507472 5:172291264-172291286 AAAAAAAAAAAAAAGGTGGGCGG - Intergenic
1001574162 5:172751082-172751104 GAAAAGAAAAGAAAGGAGGGAGG + Intergenic
1001580484 5:172794777-172794799 GACAAGAAAACAAAGGTGGCTGG + Intergenic
1001742370 5:174064682-174064704 ATGAGAAAAACAAAGGTGGGGGG + Intronic
1001806703 5:174592779-174592801 AAAAAGAAAAAAACGGTGGGTGG + Intergenic
1001893491 5:175359374-175359396 CTTAAAAAAAAAAAGGTGTGGGG - Intergenic
1002034955 5:176460996-176461018 GAGAAGAAAAAAAGGGGAGGTGG - Intronic
1002289829 5:178192838-178192860 GTAAAAAAAAAAAGGGGGGGGGG - Intergenic
1002606426 5:180385450-180385472 GGGAAGAAAAAGACGGTGGAGGG + Intergenic
1002821051 6:724822-724844 GGGAAGAAAGAAAAGGTGTTAGG - Intergenic
1002877177 6:1221055-1221077 CTGGAAAAAAAAAAGATGGGAGG + Intergenic
1003022889 6:2527377-2527399 TTGAAGAAAAATAAGGAGAGAGG - Intergenic
1003107612 6:3227944-3227966 GTGAAGAAAAGGAGGGTGAGAGG + Intronic
1003192181 6:3883945-3883967 CTTAAAAAAAAAAAGGTGGAGGG + Intergenic
1003519909 6:6849676-6849698 GGGAAGAAAACAAAGGTGTGAGG + Intergenic
1003597903 6:7490840-7490862 CTGCAGAAAAAAAAGGCGGATGG - Intergenic
1003656844 6:8019596-8019618 GTAAAGAAAAAAGGGGGGGGGGG + Intronic
1003713694 6:8621587-8621609 GGGAAGAAAAAAATGGGAGGAGG - Intergenic
1003955791 6:11163998-11164020 GTGAAGGCAAACAAGGTGAGAGG - Intergenic
1004069826 6:12288238-12288260 GTTAAAAAAAAAAAAGTAGGGGG + Intergenic
1004404979 6:15324478-15324500 AAGAAGAAGAAAAAGGAGGGGGG - Intronic
1004439855 6:15639538-15639560 GTGATGAAAATTAAGGTGGAAGG + Intronic
1004620600 6:17327150-17327172 AGGAAAAAGAAAAAGGTGGGGGG + Intergenic
1004726787 6:18318654-18318676 ATGCAGAAAAAAATGGTGAGTGG + Intergenic
1004790328 6:19018968-19018990 ATGAAAAAACAAATGGTGGGAGG + Intergenic
1004801433 6:19152878-19152900 GTCAAAAAAAAAAGGGGGGGGGG + Intergenic
1004953644 6:20702648-20702670 GCGAAGAAAACACAGGTGGCTGG - Intronic
1005348543 6:24912459-24912481 GGGCAAAAAAAAAAGGGGGGGGG - Intronic
1005468270 6:26136724-26136746 GTGAAGAAAGAAAGGAAGGGAGG - Intronic
1005509583 6:26500513-26500535 GAGAAGAGAGAAAAGATGGGAGG - Intergenic
1005942381 6:30570376-30570398 CTGAAGAAAACAAAGGAGGGAGG + Intergenic
1006236806 6:32640558-32640580 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1006422752 6:33945461-33945483 ATAATGAAAAAGAAGGTGGGAGG - Intergenic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007050204 6:38820135-38820157 TTGAAGAAAAGCAAGGTAGGGGG + Intronic
1007275846 6:40673077-40673099 GGGAAGAAGAAGAAGGCGGGGGG - Intergenic
1007385005 6:41514530-41514552 GTGAAGTAAAACAAAGTAGGGGG - Intergenic
1007446847 6:41913111-41913133 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1007466089 6:42052320-42052342 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1007573368 6:42909266-42909288 AAAAAAAAAAAAAAGGTGGGAGG - Intergenic
1007822624 6:44571846-44571868 GGGAATAAGACAAAGGTGGGTGG + Intergenic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1008195191 6:48510233-48510255 GTGAAAAAGAAAAAGGTAAGAGG + Intergenic
1008923989 6:56872824-56872846 GAAAAAAAAAAAAAGGGGGGGGG - Intronic
1009894921 6:69736207-69736229 GTACAGAAAAAAAAAGTGGTGGG - Intronic
1010282701 6:74039167-74039189 GTGAAGATATAAAATTTGGGAGG + Intergenic
1010439778 6:75880270-75880292 GAAAAGAAAAAAAAGTTGAGAGG + Intronic
1010600711 6:77822615-77822637 AAGAAAAAAAAAAAGGGGGGGGG - Intronic
1010770726 6:79826466-79826488 TTGAAGAAAATCAAAGTGGGAGG + Intergenic
1011078361 6:83462401-83462423 TTGCAGAAATAAAAGGTGGGAGG + Intergenic
1011286098 6:85724851-85724873 GGGAAGGCAACAAAGGTGGGAGG - Intergenic
1011349581 6:86407807-86407829 GAAAAGAAAAGAAAGGAGGGAGG - Intergenic
1011497051 6:87947276-87947298 GGGAAGAAAAAAGGGGTGAGGGG - Intergenic
1011575008 6:88787681-88787703 GTGAAGAAAAGATTGGAGGGAGG + Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011925113 6:92632965-92632987 GTGAAAATGAAAAAAGTGGGAGG - Intergenic
1012149889 6:95735514-95735536 GTGAAGAAAAACATAGAGGGTGG - Intergenic
1012246532 6:96932567-96932589 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1012659550 6:101870611-101870633 GGAAAGAAAAAAAGGGTAGGTGG - Intronic
1012875963 6:104726208-104726230 GGGTAGAAAAAAGAGGGGGGAGG + Intergenic
1012953982 6:105548730-105548752 GTGAAGAAAAAAGAGGATCGGGG - Intergenic
1013198475 6:107866994-107867016 GTAAAGAAGAAAAAGGTTAGGGG + Intergenic
1013244311 6:108272045-108272067 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1013254312 6:108369520-108369542 CTGTATTAAAAAAAGGTGGGAGG + Intronic
1013310899 6:108892764-108892786 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1013313798 6:108922262-108922284 AAGAAAAAAAAAAGGGTGGGGGG - Intronic
1013421767 6:109973382-109973404 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1013664280 6:112330641-112330663 GAGAAAAAAAAAAGAGTGGGTGG - Intergenic
1013891463 6:115032780-115032802 GTGAAGGAGAAAAGGGTTGGGGG - Intergenic
1013943529 6:115694463-115694485 GTTAAGAAATTGAAGGTGGGGGG - Intergenic
1013982458 6:116147983-116148005 TCAAAAAAAAAAAAGGTGGGGGG + Intronic
1013990957 6:116253449-116253471 CAGAAGGAAAAAAAGGTGGCAGG - Exonic
1014217008 6:118762099-118762121 TTTAAAAAAAAAAAGGAGGGGGG - Intergenic
1014389555 6:120843815-120843837 GTGAAGCAAAAAAAAATGAGGGG + Intergenic
1014536802 6:122623498-122623520 CTGAATAAAAAAGTGGTGGGAGG - Intronic
1014550415 6:122783984-122784006 GTTTATAAAAAAAAGGGGGGGGG - Exonic
1014743462 6:125172044-125172066 AAGAAGAGAAAGAAGGTGGGAGG - Intronic
1014988066 6:128036732-128036754 TTAAAAAAAAAAAAGGAGGGAGG - Intronic
1015681058 6:135808927-135808949 CTGAAGATAAAAAAGGGAGGAGG - Intergenic
1015845688 6:137518538-137518560 AAGGAGAAAAAAAAAGTGGGGGG - Intergenic
1016042842 6:139449938-139449960 TTAAAAAAAAAAAAGGTTGGGGG - Intergenic
1016512222 6:144856166-144856188 GAATAGAACAAAAAGGTGGGGGG - Intergenic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1016830119 6:148425734-148425756 GGGAAAAAAAAAAAGGAGGAGGG - Intronic
1016852261 6:148632707-148632729 GGGAAGAAAGAAAAGGAGGTAGG + Intergenic
1017442148 6:154474410-154474432 CTCAAAAAAAAAAAAGTGGGGGG + Intronic
1017615482 6:156242658-156242680 GTGTTTAAAAAAAGGGTGGGGGG + Intergenic
1017666533 6:156724589-156724611 TTAAAAAAAAAAAAGGGGGGGGG + Intergenic
1017689342 6:156947658-156947680 ATGAAGAAAAAATAGGGGGAGGG - Intronic
1017951401 6:159138027-159138049 GTAAAGAAAAAAAAGGCCTGAGG + Intergenic
1018231435 6:161679676-161679698 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
1018325553 6:162663920-162663942 CTCTAAAAAAAAAAGGTGGGGGG + Intronic
1018373734 6:163191797-163191819 GTTTAGAGAAAAAAGGTGGCTGG - Intronic
1018449645 6:163895585-163895607 GAGAAAAAAAAAAGGGGGGGGGG - Intergenic
1018597229 6:165494439-165494461 GTGGATAAAGAAAATGTGGGGGG + Intronic
1018852949 6:167654291-167654313 TTTAGGAAAAACAAGGTGGGTGG - Intergenic
1018992120 6:168682112-168682134 ATCAAGAAACAAAAGGAGGGAGG + Intergenic
1019162023 6:170075403-170075425 GTGGAGAAAAAGAAGGGGAGAGG + Intergenic
1020020412 7:4863282-4863304 TTAAAGAAATAAAAGGTAGGGGG - Intronic
1020108060 7:5431590-5431612 AAAAAGGAAAAAAAGGTGGGGGG - Intronic
1020466350 7:8483957-8483979 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1020636982 7:10708136-10708158 GTGAGACAAAAAGAGGTGGGAGG + Intergenic
1020640323 7:10746605-10746627 GGCAAGAAAAACAAAGTGGGAGG + Intergenic
1020677973 7:11202865-11202887 GAGAAGAGAAAAGGGGTGGGTGG - Intergenic
1020768656 7:12358371-12358393 CTCAAAAAATAAAAGGTGGGGGG + Intronic
1020769696 7:12373604-12373626 GTGAAGAAAACTAAATTGGGTGG - Intronic
1020969614 7:14919173-14919195 CTGAAGAAAAACAAAGTCGGAGG + Intronic
1021033152 7:15763433-15763455 GAGAAGGAAATAAATGTGGGGGG + Intergenic
1021254436 7:18373252-18373274 GTGTAGTAAGAAAAGGTGGGTGG + Intronic
1021265929 7:18522565-18522587 CTGAAAAAAAAAAAGCAGGGTGG + Intronic
1021547041 7:21825608-21825630 GGGAAAAAAAAAAAGGAGGCAGG - Intronic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1022278726 7:28883276-28883298 GAGAAGAAAGAAAGGGAGGGAGG - Intergenic
1022952323 7:35350899-35350921 GTGAAGAAAAGAAAGGAAAGAGG - Intergenic
1023031052 7:36090823-36090845 GGTAATAACAAAAAGGTGGGTGG - Intergenic
1023082220 7:36536373-36536395 GCAAAGAAAAAAAAAGTAGGGGG - Intronic
1023084755 7:36559121-36559143 TTGAATAAAGAAAATGTGGGAGG - Intronic
1023096758 7:36669369-36669391 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1023212837 7:37826745-37826767 TTGAAGAAATAGAAGATGGGAGG - Intronic
1023428457 7:40064290-40064312 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1023612828 7:41988461-41988483 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1023615168 7:42012378-42012400 GAGAAGAAGAAAAGGGAGGGGGG - Intronic
1024355496 7:48410152-48410174 TTAAAAAAAAAAAAGCTGGGTGG - Intronic
1024447858 7:49502642-49502664 GTGAGGGAGAAAAATGTGGGTGG - Intergenic
1025275543 7:57579064-57579086 GTGAAGAAAGAAAAGACGGTGGG - Intergenic
1025870978 7:65434039-65434061 GGGAAGGAAGAAATGGTGGGTGG + Intergenic
1025948469 7:66123749-66123771 CAAAAAAAAAAAAAGGTGGGGGG + Intronic
1025982852 7:66421399-66421421 AAGAAAAAAAAAAAGGGGGGGGG + Intergenic
1026110631 7:67456259-67456281 CTTAAAAAAAAAAGGGTGGGGGG + Intergenic
1026350342 7:69510075-69510097 GAGAAGGATAAAAAGGAGGGAGG + Intergenic
1026501981 7:70950935-70950957 GTGAAAAAAAAAAAATTGGCCGG + Intergenic
1026841190 7:73670810-73670832 GAAAAAAAAAAAAAAGTGGGAGG + Intronic
1026916717 7:74124525-74124547 TTAAAGAAAAAAAATGTGAGAGG + Intergenic
1026963607 7:74425355-74425377 GAGAAGAAAAAAAAGAGGGAGGG + Intergenic
1027014835 7:74773196-74773218 CTCAAAAAAAAAAAAGTGGGAGG + Intergenic
1027117349 7:75491626-75491648 GCGGAGAAAAAAAAGGTGAGAGG + Intergenic
1027361144 7:77411816-77411838 GTGAAGAATACTAAGGTGAGGGG + Intronic
1027457657 7:78413675-78413697 GAGAAGAAAAAGAAGATGAGAGG + Intronic
1027534486 7:79379822-79379844 GTAAAAAAAAAAAAAGTTGGGGG - Intronic
1027640019 7:80721737-80721759 TTGAAGAATAAAAAGGTAGAAGG - Intergenic
1027740480 7:81996833-81996855 GTGTTGAAAAAAAAGTTGGAAGG - Intronic
1027762336 7:82295715-82295737 GTGACAAAAAAAAAAGTGTGAGG + Intronic
1028030519 7:85906396-85906418 GTGAAGGATAAAGAGGTGTGAGG - Intergenic
1028164803 7:87526156-87526178 GAAAAAAAAAAAAAGGTGGTGGG - Intronic
1028199750 7:87947516-87947538 GTAAAAAAAAAAAAAGTGGTGGG + Intronic
1028351980 7:89859960-89859982 GGAAAAAAAAAAAGGGTGGGGGG + Intergenic
1028573176 7:92315017-92315039 GTTAAAAAAAAAAAGGATGGAGG + Intronic
1028832555 7:95343372-95343394 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1029046477 7:97634625-97634647 GGGAAGAAAGGAAAGGTGAGAGG + Intergenic
1029374475 7:100169706-100169728 TTTAAAAAAAACAAGGTGGGGGG - Exonic
1029574990 7:101397535-101397557 CTCAAAAAAAAAAAGGAGGGGGG - Intronic
1029577813 7:101415149-101415171 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1029680322 7:102104057-102104079 TTAAAGAAAAAAAAGGGTGGGGG - Intronic
1029899601 7:104024845-104024867 GAAAAGAAAAAAAAGATAGGAGG + Intergenic
1030021604 7:105280643-105280665 GTCATTAAAAAAAAGGGGGGGGG + Intronic
1030023900 7:105303069-105303091 GTCTCAAAAAAAAAGGTGGGGGG + Intronic
1030250621 7:107440386-107440408 GTTAAAAAAAAAAAGCTGAGAGG + Intronic
1030387212 7:108878583-108878605 GCAAAGCAAAAAAAGGTGAGAGG + Intergenic
1031291974 7:119949467-119949489 GTGAAGAAACATAAAGAGGGTGG - Intergenic
1031317078 7:120272218-120272240 ATAAACACAAAAAAGGTGGGTGG + Intergenic
1031478465 7:122250520-122250542 GTTGAAAAAAAAAAGCTGGGTGG + Intergenic
1031867495 7:127053785-127053807 CTCAAAAAAAAAAAGGGGGGGGG + Intronic
1031925587 7:127635183-127635205 ATGGAGAAAACAAAGATGGGTGG + Intergenic
1032244963 7:130203540-130203562 GTGAAGAAAAATAAGTTTAGAGG - Intronic
1032533464 7:132640773-132640795 CTGAAAAAAAAAAAAGGGGGGGG + Intronic
1032552976 7:132802956-132802978 GTTAAGAAAGAAAGGGAGGGAGG - Intronic
1032692786 7:134305664-134305686 GGGAAGAAAAAACTGGTCGGGGG - Intronic
1032933374 7:136699661-136699683 GATAAGAAAAAACAGGAGGGAGG - Intergenic
1032935089 7:136719644-136719666 GTCAAGAGAAAAAAGGAAGGAGG + Intergenic
1032996654 7:137454619-137454641 GTGAAGCAATAAAGGATGGGTGG + Intronic
1032996771 7:137455627-137455649 GTTAAAAAAAAAAGGGGGGGGGG + Intronic
1033401467 7:141029294-141029316 CTGAAGAACAAAGAGGTAGGGGG - Intergenic
1033948942 7:146759698-146759720 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1034103191 7:148468849-148468871 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1034916081 7:155040411-155040433 TTGAAGAAAAAGAAGTTTGGAGG + Intergenic
1034946683 7:155266936-155266958 ATTAAAAAAAAAAAGGTGGGAGG - Intergenic
1036069803 8:5428193-5428215 AAGAAAAAAAAAAAGGCGGGGGG - Intergenic
1036279892 8:7391725-7391747 GTGAAGGAAGAAAAGGAGAGTGG - Intergenic
1036341629 8:7920158-7920180 GTGAAGGAAGAAAAGGAGAGTGG + Intergenic
1036474801 8:9083634-9083656 GTTAAAAAAAAAAAGCGGGGGGG + Intronic
1036734812 8:11303151-11303173 TTGAAGAACAAAAAGGTGAGAGG + Intronic
1036826708 8:11982421-11982443 GTAAAGGGAAAAAAGGTGTGAGG + Intronic
1037052512 8:14394135-14394157 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1037105518 8:15102325-15102347 GTGGAGAATAAAAAGGTAAGTGG + Intronic
1037480582 8:19301920-19301942 AGGAAGGAAGAAAAGGTGGGAGG + Intergenic
1037727311 8:21493598-21493620 GGGTAGAAAGAAAAAGTGGGAGG - Intergenic
1037844508 8:22271124-22271146 GTTAAAAAAAAAAAGGAGGCCGG - Intergenic
1037850303 8:22322253-22322275 GTCTCAAAAAAAAAGGTGGGGGG - Intronic
1038064545 8:23950215-23950237 AAGAAAAAAAAAAAGGGGGGGGG - Intergenic
1038265764 8:26039239-26039261 AGGCAGAAAAAAAGGGTGGGGGG + Intronic
1038510405 8:28129035-28129057 TGAAAGAAAAAAAAGGGGGGAGG - Intronic
1038571939 8:28670206-28670228 CTCAAAAAAAAAAAGGTTGGGGG + Intronic
1038679262 8:29652001-29652023 GCTATTAAAAAAAAGGTGGGGGG - Intergenic
1038797714 8:30724536-30724558 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1038834708 8:31106500-31106522 CCGAAGAAAAACAAGGAGGGTGG - Intronic
1038835653 8:31119165-31119187 AAGAAGAAAAGAAAGGAGGGAGG - Intronic
1038845016 8:31221069-31221091 CGGAAGGAGAAAAAGGTGGGAGG - Intergenic
1039320906 8:36429921-36429943 GACAAAAAAAAAAAGGTGGTGGG - Intergenic
1039324298 8:36467527-36467549 GTTAAAAAAAAAAAAATGGGAGG + Intergenic
1039343512 8:36677243-36677265 TTAAAAAAAAAAGAGGTGGGGGG - Intergenic
1039439044 8:37581860-37581882 GAAAAGAAAAATAAGGGGGGTGG - Intergenic
1039465583 8:37783158-37783180 AAAAAGAAAAAAAAGGTGGGGGG + Intergenic
1039513233 8:38108517-38108539 TAAAAAAAAAAAAAGGTGGGGGG + Intronic
1039543382 8:38389512-38389534 GTGAATAAATAAATGGTGGCCGG - Intronic
1039780472 8:40780028-40780050 GAGGAGAAAAAAAAGTTGGGAGG - Intronic
1039887303 8:41662254-41662276 GTCAAAAAAAAAAAGGCGGGGGG + Intronic
1039934638 8:42031025-42031047 GCAAAAAAAAAAAAGGGGGGGGG + Intronic
1039942512 8:42103220-42103242 GTTTTGAAAAGAAAGGTGGGCGG + Intergenic
1040279320 8:46030437-46030459 GAAAAGAAAAAAAAGTTGGCAGG + Intergenic
1040468546 8:47717230-47717252 GTGAAGAGAATGAAGGTGGAAGG - Intronic
1040645029 8:49388106-49388128 GTGCAGAAGGAAAACGTGGGTGG + Intergenic
1040751478 8:50714064-50714086 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1040816951 8:51518900-51518922 GTGAAGGAAGAAGGGGTGGGAGG + Intronic
1041223936 8:55679682-55679704 GTGAAGTAAAAAGAAGTGTGAGG + Intergenic
1041324897 8:56653510-56653532 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1041388566 8:57329558-57329580 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1041409261 8:57535509-57535531 TTGATGAAAAAATAGGTGGTGGG - Intergenic
1041444143 8:57931777-57931799 GGGAAGGAAAAGAAGGAGGGAGG + Intergenic
1041496569 8:58492090-58492112 TTTAAGAAAAAAAAAGTGGCAGG + Intronic
1041659298 8:60385690-60385712 GTACAGAAAAAATGGGTGGGAGG - Intergenic
1042088044 8:65130202-65130224 GAGAAAAAAAAAAAGTCGGGGGG - Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042146305 8:65733622-65733644 GAGAAAAAAAAACAGTTGGGTGG + Intronic
1042514939 8:69649279-69649301 ATTCAGAAAAAAAAGGTGTGTGG - Intronic
1042836937 8:73087515-73087537 TTGAAGAAAAAAAACGAGCGGGG - Intronic
1042889335 8:73589969-73589991 GGGAAGAAGAAAGAGGAGGGAGG + Intronic
1043692587 8:83173980-83174002 CTGAAGAAAAAAAAGGTCACTGG - Intergenic
1044704076 8:94991799-94991821 TTTAAAAAAAAAAAGGGGGGGGG - Intronic
1044845271 8:96373971-96373993 GAGCTGAAACAAAAGGTGGGGGG + Intergenic
1044952090 8:97444824-97444846 GTGAAGAAACAAAGGCTGGCTGG + Intergenic
1045023142 8:98061826-98061848 GAGAAGAAAAAAAAGAAGGAAGG + Intergenic
1045301643 8:100916178-100916200 GTCAAAAAAAAAAAGGGCGGGGG - Intergenic
1046071833 8:109264844-109264866 GTAAAAAAAAAAAAAGTAGGAGG - Intronic
1046131174 8:109970367-109970389 GTAAAGGAAAACAAAGTGGGTGG + Intronic
1046667049 8:117015643-117015665 CTCCAGAAAAAAAAGGTGGGTGG - Intronic
1046667323 8:117018667-117018689 ATCAAAAAAAAAAAGGGGGGGGG - Intronic
1046723330 8:117647408-117647430 GAAAAGAGAAAAAAAGTGGGTGG - Intergenic
1046901891 8:119532785-119532807 GTGAAGGAGAAAATGGTTGGAGG + Intergenic
1046951656 8:120025349-120025371 CAGAAAAAAAAAATGGTGGGTGG - Intronic
1047008960 8:120650456-120650478 GTGAGGGAAAAAAAGGGGGAAGG - Intronic
1047137405 8:122095933-122095955 GTGAAAAAAAAAAAGGCTGATGG + Intergenic
1047348216 8:124049035-124049057 AAGAAAAAAAAAAAGGTGGTGGG - Intronic
1047425956 8:124747373-124747395 GGAAAGAAAGAAAAGGAGGGAGG - Intergenic
1047427873 8:124763233-124763255 AAAAAGGAAAAAAAGGTGGGGGG - Intergenic
1047708207 8:127523669-127523691 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1048146323 8:131847663-131847685 TTGAAAAAAAAAAAAGTTGGAGG + Intergenic
1048391578 8:133970725-133970747 GAAAAGAAAATAAAGGAGGGAGG + Intergenic
1048667030 8:136673861-136673883 GAGAAGAAAGAAAAAGTGGAGGG + Intergenic
1048733784 8:137474618-137474640 AAAAAGAAAAAAAAGGTGCGGGG - Intergenic
1048766413 8:137848930-137848952 GTCAAAAAAAAAAAGGAGAGAGG + Intergenic
1048768663 8:137871025-137871047 AAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1048912843 8:139152628-139152650 TTAAAAAAAAGAAAGGTGGGGGG + Intergenic
1049781705 8:144432124-144432146 GTTTAGAAAAAACAGCTGGGGGG - Intronic
1050017489 9:1250230-1250252 TTAAAAAAAAAAAAGTTGGGGGG - Intergenic
1050017490 9:1250231-1250253 GTTAAAAAAAAAAAAGTTGGGGG - Intergenic
1050126675 9:2363179-2363201 GAGAAGAAAGAAAAGGTGTGAGG + Intergenic
1050513668 9:6420052-6420074 AAGAAAAAAAAAAAGGTGGCGGG - Intronic
1050739090 9:8799844-8799866 GAAAAGAAAAAAAAAGTGTGTGG - Intronic
1050739961 9:8808454-8808476 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1050907069 9:11017511-11017533 ATGAAAACAAAAAAGGGGGGAGG - Intergenic
1050938825 9:11432935-11432957 GAGAAGAGAAGAAAGGTGGTAGG - Intergenic
1051613707 9:18986608-18986630 GAGAAAAAAAAAAGGGGGGGCGG + Intronic
1051623692 9:19078120-19078142 AAAAAAAAAAAAAAGGTGGGTGG + Intronic
1051630394 9:19135375-19135397 ATGAAAAAAAAAAAGTTGGCTGG + Intronic
1051990866 9:23151387-23151409 GTTAAAAAAAAAAAACTGGGGGG - Intergenic
1052330736 9:27265264-27265286 CTCAAAAAAAAAAAGGGGGGGGG - Intergenic
1052376269 9:27721230-27721252 TAAAAGAAAAAAAAGGTAGGGGG + Intergenic
1052414872 9:28165377-28165399 GTGAAGAATAAAAGGATGGGAGG + Intronic
1052415007 9:28167146-28167168 CTGGAGAAAAGAAAAGTGGGGGG - Intronic
1052604929 9:30687195-30687217 TTAAAGAAAAAAAGGGGGGGGGG + Intergenic
1052728358 9:32257335-32257357 TTCAAGAAAGAAATGGTGGGTGG + Intergenic
1053076196 9:35136918-35136940 GTTAAAAAAAAAATGGGGGGTGG - Intergenic
1053460807 9:38269796-38269818 TGGAAGAAAAGAAAGGTGAGAGG + Intergenic
1054675295 9:67851457-67851479 GTCTCAAAAAAAAAGGTGGGGGG - Intergenic
1054723856 9:68630629-68630651 GTGAAGGAGAAAAAGGAGGAGGG + Intergenic
1054760934 9:69003464-69003486 GTTAAAAAAAAAAAAGGGGGGGG + Intronic
1054760935 9:69003465-69003487 TTAAAAAAAAAAAAGGGGGGGGG + Intronic
1054862580 9:69968882-69968904 AAAAAGAAAAAAAAGATGGGGGG - Intergenic
1055060700 9:72065850-72065872 AAAAAAAAAAAAAAGGTGGGGGG - Intronic
1055074938 9:72204392-72204414 GCAAAGAAAAAAAAGGGGGAAGG + Intronic
1055305670 9:74926711-74926733 GTAAAGAAAACAAAGCAGGGAGG + Intergenic
1055520554 9:77076558-77076580 TTTAAAAAAAAAATGGTGGGGGG - Intergenic
1055601839 9:77927572-77927594 CTGAAGAAAAAAAAGGGGGTGGG + Intronic
1056142318 9:83695193-83695215 AAAAAAAAAAAAAAGGTGGGAGG - Intronic
1056368301 9:85928483-85928505 AAAAAAAAAAAAAAGGTGGGGGG + Intergenic
1056545145 9:87606777-87606799 GGGAAGGAGAAAAAGGAGGGAGG - Intronic
1056651688 9:88470593-88470615 CTCAAAAAAAAAAAGGGGGGGGG - Intronic
1056774013 9:89498281-89498303 GGGAGGAAAAGAAAGGTTGGGGG - Intergenic
1056835794 9:89954157-89954179 GTCAAGAAAAATAAGGAGGGGGG - Intergenic
1057366670 9:94428592-94428614 GTAAAAAAAAAAAAGGGGGGGGG - Intronic
1057525436 9:95795520-95795542 GAAAAGAAAGAAAAGGTGTGAGG + Intergenic
1057619263 9:96620019-96620041 CAGAAGAAACAAAAGTTGGGGGG - Intergenic
1057696982 9:97330076-97330098 AAAAAAAAAAAAAAGGTGGGGGG + Intronic
1057949808 9:99360738-99360760 GTACAGAAAATAAAGCTGGGAGG + Intergenic
1058141093 9:101357543-101357565 GTGAAGATAAAAGATTTGGGAGG - Intergenic
1058274741 9:103025402-103025424 GAAAAGAAAAAAAATGTGTGAGG - Intergenic
1058292207 9:103256797-103256819 GTGCAGAAGAAAAATGTGGTTGG - Intergenic
1058293867 9:103280197-103280219 GAGAAAAAAAAAAAAGAGGGAGG + Intergenic
1058423392 9:104854836-104854858 TTGATGAGAACAAAGGTGGGTGG - Intronic
1058575012 9:106391649-106391671 TTGAAGCAGAAAGAGGTGGGTGG + Intergenic
1058596495 9:106621281-106621303 GGGAAGAAAGAAAAGAAGGGGGG + Intergenic
1058734538 9:107882420-107882442 GAAAAGAAAAAAAAGAGGGGAGG - Intergenic
1058879797 9:109276547-109276569 TTGAGGCAAAAACAGGTGGGAGG - Intronic
1059159107 9:112017289-112017311 CAAAAAAAAAAAAAGGTGGGGGG - Intergenic
1059268448 9:113057489-113057511 AAGAAAAAAGAAAAGGTGGGAGG + Intergenic
1059324891 9:113498066-113498088 GGGAAGAAACTAAAGGTAGGTGG + Exonic
1059431533 9:114253417-114253439 GAGGAGAAAAAAGAGGAGGGAGG + Intronic
1060041231 9:120303458-120303480 GTGGAGAGAATAGAGGTGGGAGG - Intergenic
1060087009 9:120713071-120713093 TGGAAGAAAAAAATGGTGCGAGG + Intronic
1060087762 9:120716775-120716797 CTCAAAAAAAAAAAAGTGGGGGG - Intergenic
1060446166 9:123690104-123690126 GGGAGGAAGAAAAAGGAGGGAGG + Intronic
1060446205 9:123690665-123690687 TTAAAGAAAGAAAAGGAGGGGGG - Intronic
1061095288 9:128453334-128453356 TTAAAAAAAAAAAAGGCGGGGGG - Intergenic
1061394254 9:130334846-130334868 GTGAAGAAAAATAAAGGGTGAGG - Intronic
1061450333 9:130664044-130664066 GAGAAGGAAAAACAGGAGGGGGG + Intergenic
1061534234 9:131237711-131237733 ATAAAAAAAAAAAAGGTGGGGGG + Intergenic
1061673851 9:132204294-132204316 TTGAGGAAAAAACAGGTTGGGGG - Intronic
1061867165 9:133498839-133498861 CTGATGAAAGACAAGGTGGGAGG + Intergenic
1062151958 9:135024228-135024250 GTCAAGGAAGCAAAGGTGGGAGG + Intergenic
1062659536 9:137622114-137622136 AAAAAGAAAAAAAAGGGGGGAGG - Intronic
1203524794 Un_GL000213v1:77671-77693 GTGAAGGAATAAAGGGTGGTTGG + Intergenic
1203453496 Un_GL000219v1:143649-143671 AAAAAGAAAAAAAAGGGGGGTGG - Intergenic
1203570683 Un_KI270744v1:126955-126977 GTTTAAAAAAAAAGGGTGGGGGG - Intergenic
1203626745 Un_KI270750v1:32541-32563 GTGAAGAAAGAAAAGACGGTGGG - Intergenic
1185431185 X:13006-13028 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185431987 X:16686-16708 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185440452 X:225403-225425 CTGAAAAAAAAAAGGGAGGGAGG - Intergenic
1185501747 X:602075-602097 GAGAAGAAGAAAAAGGAAGGAGG - Intergenic
1185602303 X:1348783-1348805 GTGAAGAAAAGAAAGAAGGGAGG - Intronic
1185704269 X:2254947-2254969 AAAAAGAAAAAAAAGGGGGGGGG - Intronic
1185711673 X:2308818-2308840 GGGAAGAAAGAAAGGGAGGGAGG + Intronic
1185861535 X:3583914-3583936 GTGAAGAAAGGAAGGGAGGGAGG + Intergenic
1186239282 X:7548909-7548931 TGCAAGAAAAAAAAGGGGGGAGG - Intergenic
1186316969 X:8381728-8381750 GAGAAGAGAAGAAAGTTGGGGGG - Intergenic
1186393383 X:9183201-9183223 GTGAAGGAGAAAAATGGGGGTGG - Intergenic
1186458016 X:9725992-9726014 AAAAAAAAAAAAAAGGTGGGAGG + Intronic
1186478679 X:9879031-9879053 GTGAAGGAAAGAAAGGAGAGAGG + Intronic
1186590120 X:10921408-10921430 GAGGAGAAATAAAAGGAGGGAGG - Intergenic
1186623805 X:11270235-11270257 GTGAATAAAGAAAAGGTTGCTGG - Intronic
1186774608 X:12852605-12852627 GGAAAGAAAAAAAAGGGGGGGGG - Intergenic
1186854613 X:13613893-13613915 TTGAAGAAAAAAAATGGGGATGG - Intronic
1187188348 X:17009425-17009447 CTCAAAAAAAAAAAGTTGGGAGG - Intronic
1187233621 X:17445743-17445765 CTAAAAAAAAAAAAGGGGGGGGG + Intronic
1187372113 X:18718128-18718150 GTAAAGAATAAAAAGGTTGTTGG - Intronic
1187496350 X:19799095-19799117 GTGAAGAAATAAAGGGGGTGGGG - Intronic
1187716307 X:22105690-22105712 GTGAAGAAAACAAAGGTAAGAGG - Intronic
1187750822 X:22462900-22462922 GTAAAGCAAAAAAAGGTGAAAGG + Intergenic
1187804218 X:23100570-23100592 GTGAAGAAAATGAGGGTGGTGGG - Intergenic
1188018688 X:25133798-25133820 GAGATGGAAAAAAAGATGGGTGG - Intergenic
1188465315 X:30472922-30472944 GTAAAAAAAAAAAAAGTTGGGGG - Intergenic
1188469438 X:30521162-30521184 CTGAAGAAAACAAAGGTGTGAGG + Intergenic
1188507890 X:30903101-30903123 GTGAAGAAAAATAAGGACTGAGG + Intronic
1188710242 X:33387888-33387910 TGTAAGAAAAAAAAGGAGGGAGG + Intergenic
1188764535 X:34075671-34075693 GGGAAGAAAAAAAAAGTGAGGGG + Intergenic
1188788699 X:34381597-34381619 GTGAGGAGAAGAAAGGTTGGGGG + Intergenic
1188842581 X:35034742-35034764 AAGAAGAAAAAAAGGTTGGGTGG - Intergenic
1188880671 X:35488242-35488264 GGGTGGAAAAATAAGGTGGGTGG - Intergenic
1188895709 X:35665883-35665905 GGGAGGAAAAAAGAGGTAGGAGG - Intergenic
1188923500 X:36009014-36009036 GTGAAGAAAAAGGAAGTGTGAGG - Intergenic
1189834004 X:45002865-45002887 GAGAAGAATGAAAAGGGGGGGGG - Intronic
1189839455 X:45058079-45058101 GGCAAAAAAAAAAAGGGGGGGGG - Intronic
1190088561 X:47417759-47417781 AAAAAGAAAAAAAAGGCGGGGGG - Intergenic
1190187456 X:48248256-48248278 GAAAAGAAGAATAAGGTGGGAGG - Intronic
1190191949 X:48284421-48284443 GAAAAGAAGAATAAGGTGGGAGG - Intergenic
1190303494 X:49069372-49069394 GAGAAAAAAAAAAGGGTGGAAGG - Intronic
1190668053 X:52713495-52713517 AAGAAGAAGAATAAGGTGGGAGG - Intergenic
1190671364 X:52744909-52744931 AAGAAGAAGAATAAGGTGGGAGG + Intergenic
1190727251 X:53197634-53197656 GTGAGAAAAGAACAGGTGGGAGG - Intronic
1190762496 X:53448213-53448235 TTGAAGAAATAAAAGGAGGCCGG - Intergenic
1190855074 X:54286202-54286224 AACAAAAAAAAAAAGGTGGGGGG + Intronic
1191034274 X:56008210-56008232 GTGAAAATAAAAATGGGGGGAGG + Intergenic
1191105663 X:56770637-56770659 GTGAAGAAGAAAAAAGTGAGGGG - Intergenic
1191106656 X:56776039-56776061 GTGAAGAAGAAAAAAGTGAGGGG - Intergenic
1191107644 X:56781617-56781639 GTGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191109098 X:56791147-56791169 GTGAAGAAGAAAAAAGTGAAGGG - Intergenic
1191636674 X:63385155-63385177 GTGAAAAAAAGAAAGGAGAGGGG + Intergenic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1192239609 X:69318983-69319005 CTCAGGAAAAAAAGGGTGGGGGG + Intergenic
1192295566 X:69844081-69844103 TTGAAGAAGAAAAAAGGGGGTGG + Intronic
1192314741 X:70042869-70042891 GTTAAAAAAAAAAAAGAGGGAGG - Intronic
1192327052 X:70141905-70141927 GAGATTAAAAAAAAGGGGGGGGG + Intronic
1192463499 X:71338286-71338308 GTGAACAAACAAAAGTTGAGGGG - Intergenic
1192464925 X:71347952-71347974 GTAAAAAAAAAAAATTTGGGTGG - Intergenic
1192530733 X:71882074-71882096 ATGAAGAAGAACAAGGTGGGAGG + Intergenic
1192533623 X:71910728-71910750 AGAAAAAAAAAAAAGGTGGGTGG + Intergenic
1192925288 X:75749220-75749242 GAGAATAAAAGAAGGGTGGGTGG - Intergenic
1192943485 X:75938063-75938085 GTATAATAAAAAAAGGTGGGGGG + Intergenic
1193194792 X:78619409-78619431 GGGGAGAAAAAAAGGGGGGGAGG - Intergenic
1193293448 X:79805718-79805740 GAGGAGAGAAAAGAGGTGGGAGG - Intergenic
1193490382 X:82142482-82142504 GAGAAGAAAAAGAAGGAGAGTGG - Intergenic
1193541816 X:82781900-82781922 GTGCAGAAAAAAATGTGGGGTGG - Intergenic
1193639509 X:83994854-83994876 CCAAAGACAAAAAAGGTGGGGGG - Intergenic
1193981186 X:88184025-88184047 CTGAAGAAGAAAAAGCTGGAAGG - Intergenic
1194004178 X:88470216-88470238 GTGAAGAGAAAACAGCGGGGAGG - Intergenic
1194200242 X:90945564-90945586 TTAAAGAAAAAAAAAGTGGGGGG + Intergenic
1194363776 X:92988654-92988676 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1194376362 X:93138168-93138190 GAGAAGAAAATAAATTTGGGGGG + Intergenic
1194511468 X:94801231-94801253 CTAACAAAAAAAAAGGTGGGGGG - Intergenic
1194767220 X:97855775-97855797 GTGAAGAAAAAGGAAGGGGGAGG - Intergenic
1194771007 X:97904906-97904928 GTGATGAACAAAACGGAGGGTGG + Intergenic
1194970057 X:100333028-100333050 GAAAAGAAAAGAAAGGAGGGAGG + Intronic
1195100564 X:101551125-101551147 CTGAAGAAAAAAAAAATGGCAGG - Intronic
1195106341 X:101605263-101605285 GGAAAGAAAAACAAGGTGGGAGG - Intergenic
1195309405 X:103616246-103616268 GGGAAGAAAAAAAAGGAGGATGG - Intronic
1195571731 X:106404338-106404360 GAGAAGGAAAAAAAGGTGAAGGG + Intergenic
1195907712 X:109862144-109862166 GTGGAAAAAGAAAAGGTCGGGGG - Intergenic
1196396733 X:115271682-115271704 GAGAAAAAAAAAAAGGCTGGGGG + Intergenic
1196431568 X:115632743-115632765 AAGAAAAAAAAAAAAGTGGGGGG - Intronic
1196531005 X:116786160-116786182 AAAAAAAAAAAAAAGGTGGGAGG + Intergenic
1196888396 X:120269121-120269143 GCAAAAAAAAAAAAGGTGGGGGG - Intronic
1196915004 X:120524761-120524783 GTTAAAAAAAAAAAGTTGAGGGG - Intronic
1196949178 X:120858780-120858802 GCAATTAAAAAAAAGGTGGGGGG - Intergenic
1196964449 X:121040647-121040669 GCGAAAAGAACAAAGGTGGGGGG + Intergenic
1197007832 X:121524166-121524188 GTGAAGAAAATAAAGCTCAGAGG - Intergenic
1197584447 X:128328028-128328050 GTCTCAAAAAAAAAGGTGGGGGG - Intergenic
1197656912 X:129126761-129126783 GCAAAAAAAAAAAAGGAGGGGGG - Intergenic
1197801016 X:130348785-130348807 TTAAAAAAAAAAAAGGGGGGGGG - Intronic
1198100727 X:133419501-133419523 GAAAAAGAAAAAAAGGTGGGGGG - Intergenic
1198162154 X:134018556-134018578 AGGAAGAAAGAAATGGTGGGTGG - Intergenic
1198381770 X:136090808-136090830 AAGAAGAACAATAAGGTGGGAGG + Intergenic
1198399036 X:136251656-136251678 GTGAAGAAAGGAATGTTGGGGGG - Intronic
1198423724 X:136495022-136495044 GTAACAAAAAAAAAGGGGGGTGG - Intergenic
1198742351 X:139854449-139854471 TTTAGGAAAAAAAAGGGGGGAGG + Intronic
1198870177 X:141170498-141170520 GAGAAAAAAAAAAGAGTGGGAGG + Intergenic
1199559844 X:149150954-149150976 GTGAAGAGCAAGAGGGTGGGGGG + Intergenic
1200336123 X:155353379-155353401 ATTTAAAAAAAAAAGGTGGGGGG + Intergenic
1200350347 X:155487848-155487870 ATTTAAAAAAAAAAGGTGGGGGG - Intergenic
1200546239 Y:4521960-4521982 TTAAAGAAAAAAAAAATGGGGGG + Intergenic
1200672008 Y:6104893-6104915 CTGAAGAAAAAAAAGAAGGAAGG - Intergenic
1202086044 Y:21137977-21137999 GTAAAGAAAAAAAAAGTTGGGGG - Intergenic