ID: 1163404345

View in Genome Browser
Species Human (GRCh38)
Location 19:17113041-17113063
Sequence GGGAAGCCAGCATTTGTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163404339_1163404345 16 Left 1163404339 19:17113002-17113024 CCTCAGAAGGCAGAAGTCACCCA 0: 1
1: 0
2: 2
3: 27
4: 275
Right 1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 202
1163404342_1163404345 -3 Left 1163404342 19:17113021-17113043 CCCATGTCACGAGGAGCAAAGGG 0: 1
1: 0
2: 0
3: 3
4: 104
Right 1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 202
1163404338_1163404345 22 Left 1163404338 19:17112996-17113018 CCAAGGCCTCAGAAGGCAGAAGT 0: 1
1: 0
2: 3
3: 29
4: 357
Right 1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 202
1163404344_1163404345 -4 Left 1163404344 19:17113022-17113044 CCATGTCACGAGGAGCAAAGGGA 0: 1
1: 0
2: 0
3: 9
4: 105
Right 1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG 0: 1
1: 0
2: 0
3: 20
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163404345 Original CRISPR GGGAAGCCAGCATTTGTTTG AGG Intronic
902752894 1:18529726-18529748 GTGAAGCCAGCATCTGGTTCTGG + Intergenic
903515039 1:23904645-23904667 GGGAAGTATGCATTTGTCTGGGG + Intronic
909268631 1:73594511-73594533 GGCAGGCCAGCAGGTGTTTGGGG - Intergenic
910075363 1:83270845-83270867 GGGAGGCCAGCATTTCCTTGGGG + Intergenic
910762190 1:90744737-90744759 GATATGGCAGCATTTGTTTGGGG - Intergenic
910800448 1:91139635-91139657 GTGAAGTCAGCATTAGTGTGAGG + Intergenic
912047907 1:105483680-105483702 TGGGAGCCAGCATTCCTTTGTGG + Intergenic
913411973 1:118562087-118562109 TTGAAGCCACCATATGTTTGTGG + Intergenic
915446798 1:155978659-155978681 GGGACGCCAGGGTTTGTGTGGGG + Intronic
915632379 1:157162547-157162569 GGGAATCCATCAGTTGGTTGGGG + Intergenic
917705109 1:177624584-177624606 GGGAAGCAAGCATGTCTATGTGG + Intergenic
918180784 1:182084830-182084852 TGCAAGTCAGCATGTGTTTGTGG - Intergenic
918923202 1:190743251-190743273 GGGAAGAAAGAATATGTTTGAGG - Intergenic
920316049 1:205076206-205076228 GGGCAGGCAGAATTTGTTTGAGG + Exonic
921511320 1:216034158-216034180 GGGAAACCAACATTTGTGCGTGG + Intronic
921673322 1:217950544-217950566 GTGAAGCCAGCATTCATTAGTGG - Intergenic
923378301 1:233388958-233388980 GTGAATCCAGCATTTGTCTGTGG + Intergenic
924744040 1:246816011-246816033 GGCAAGCCAGCTTTTTCTTGGGG - Intergenic
1064210944 10:13360023-13360045 TGGAAGCCAGCATTTTCCTGTGG + Intergenic
1064389372 10:14928452-14928474 GGGCATCCAGGATTTATTTGAGG - Intronic
1064815670 10:19259182-19259204 TGGAAGCTATCATTAGTTTGAGG - Intronic
1067463851 10:46479020-46479042 GGGAAGCCAGAAGTTGTTAATGG - Intergenic
1067623344 10:47905631-47905653 GGGAAGCCAGAAGTTGTTAATGG + Intergenic
1067971426 10:50975221-50975243 AGTAAGCCAGAATTTGTATGTGG + Intergenic
1068658684 10:59601377-59601399 AGGAAGCCATCTTTTCTTTGGGG - Intergenic
1069071695 10:63996166-63996188 GGGAGCCCTGCATTTCTTTGGGG + Intergenic
1069790355 10:71015659-71015681 AGGAAGCCAGCATAGGTTTTGGG + Intergenic
1071094672 10:81959189-81959211 GGGGACCCAGCATTGGCTTGAGG + Intronic
1073178192 10:101569215-101569237 GGGAAGCCAGCATTGATTGAGGG - Intergenic
1073192672 10:101662900-101662922 GAGAAGGCAGCATATGATTGAGG - Intronic
1073897040 10:108173810-108173832 GGGGAGTCAGAAGTTGTTTGTGG + Intergenic
1075326317 10:121534796-121534818 AGGAAACCAGCATTTGTTGCTGG + Intronic
1075432310 10:122397392-122397414 GAGAAGCAAACATTTTTTTGTGG + Intronic
1075679173 10:124320385-124320407 GGGCAGCCAGCATTTGCTGGAGG - Intergenic
1076571480 10:131436070-131436092 GGGAGGCAAACATCTGTTTGGGG + Intergenic
1076824836 10:132961665-132961687 GGGGAGCCAGCATGTGGTAGGGG - Intergenic
1077089739 11:773011-773033 GGACAGGCAGCAATTGTTTGTGG - Intronic
1078067405 11:8087437-8087459 GGGAAGCCAGCACTGTCTTGTGG + Intronic
1078333562 11:10445809-10445831 TGGAAGCCAATATCTGTTTGGGG - Intronic
1079445367 11:20552156-20552178 GGGACGCCAGCCTTAATTTGGGG - Intergenic
1079499951 11:21091943-21091965 GGGAAGGCAGAACTTTTTTGTGG + Intronic
1079738273 11:24025065-24025087 GGTTTGCCAGTATTTGTTTGAGG - Intergenic
1080638104 11:34140908-34140930 AGGAAGACAGCATTTCTTGGTGG + Intronic
1083031785 11:59599103-59599125 GTTAAGCCAACATTTGTTTAAGG + Intronic
1085961199 11:81464325-81464347 TGCAATTCAGCATTTGTTTGTGG + Intergenic
1086844720 11:91734182-91734204 GAGTAGCTAGCATTTTTTTGAGG - Intergenic
1087911169 11:103755339-103755361 TGGATGCCAGTATCTGTTTGGGG + Intergenic
1088552294 11:111025433-111025455 GGGAAGACAGCAGAAGTTTGTGG + Intergenic
1089795224 11:120974937-120974959 GGGATGCCAGCATCTGTGAGTGG - Intronic
1089841019 11:121417562-121417584 GGGCAGGAAGCATTTGTGTGGGG - Intergenic
1090006059 11:123003229-123003251 GGGAAGGCAGCAATGGCTTGAGG - Intergenic
1090498057 11:127234000-127234022 TGCAAGCCAGCATATATTTGAGG - Intergenic
1090522206 11:127491275-127491297 TGAAAGCAAACATTTGTTTGGGG - Intergenic
1090585501 11:128207669-128207691 TGGAAGCCACCATTAGATTGAGG + Intergenic
1093485115 12:19643639-19643661 GAGAAGCCAGAATTTGCGTGTGG - Intronic
1093880066 12:24394144-24394166 GGGAAGCCTGCATTTCTCTTGGG + Intergenic
1095147102 12:38743474-38743496 GGGAAGCCATACTTTTTTTGTGG - Intronic
1097329083 12:58313506-58313528 GGTAGGCCAGCATTTTGTTGAGG + Intergenic
1101806314 12:108067312-108067334 AGGAAGCATGCATGTGTTTGTGG + Intergenic
1102835283 12:116051974-116051996 GGCAAGCTAGAATTTGATTGTGG - Intronic
1104342205 12:127960886-127960908 GGGATGCTAGCATCTCTTTGAGG + Intergenic
1106055265 13:26231311-26231333 GGGAAGGGAGAATTTGTATGGGG - Intergenic
1106326156 13:28692468-28692490 GGAAACCCAGCCTTTGTTTCTGG + Intergenic
1107461913 13:40612264-40612286 GGGAAGCCTGGATTTTGTTGGGG - Intronic
1117350226 14:54874089-54874111 GGTTAGCCAGCATTTTTTTGAGG - Intronic
1119794490 14:77383572-77383594 GGGAAGGCCACATTTGTCTGAGG - Intronic
1121023205 14:90594447-90594469 GGGAAGCAAGCCTCTGTTTAAGG - Intronic
1121915757 14:97835792-97835814 GGCATGCTAGCATTTGTATGGGG - Intergenic
1123493799 15:20802836-20802858 GGAAAGCCAGCATTTAGTTGGGG + Intergenic
1123550298 15:21371918-21371940 GGAAAGCCAGCATTTAGTTGGGG + Intergenic
1125454336 15:39842248-39842270 GGGAAGCCAGCATATTTTACAGG + Intronic
1128799643 15:70489423-70489445 GGGAACCCAGCGGGTGTTTGAGG - Intergenic
1130893855 15:88155400-88155422 GGGAGGTCAGCATTTCTTTCTGG - Intronic
1131057083 15:89381436-89381458 GAGAAGCCAGCCATTATTTGGGG - Intergenic
1131944914 15:97609146-97609168 GGGAAGACACCTTCTGTTTGAGG + Intergenic
1132285946 15:100662467-100662489 GGCAAGCCAGGACTTGTCTGGGG - Intergenic
1132332467 15:101022384-101022406 GGTAAGACAGCATTGCTTTGGGG - Exonic
1202958640 15_KI270727v1_random:99172-99194 GGAAAGCCAGCATTTAGTTGGGG + Intergenic
1134869730 16:17640948-17640970 AGGGAACCAGCTTTTGTTTGTGG + Intergenic
1136665374 16:31806712-31806734 GGGAAACCTGCCTTTGTATGTGG + Intergenic
1137757176 16:50912066-50912088 GAGAAGCCAGTCTTTGCTTGTGG + Intergenic
1140191463 16:72820636-72820658 GGGAAGACAGCATATTTTGGGGG - Intronic
1141751409 16:85960963-85960985 GGGAGGTCAGCAAATGTTTGTGG + Intergenic
1146409754 17:32572394-32572416 GGAAAGAGAGGATTTGTTTGTGG - Intronic
1148331608 17:46817148-46817170 GGGATGGCAGCATTTGTGTCTGG - Intronic
1148839505 17:50485739-50485761 GGGAAACCAGAATATGTTTGGGG + Exonic
1148921222 17:51036558-51036580 AGGAAGGCAGCATCTGTGTGTGG - Intronic
1149139978 17:53420516-53420538 GGCTAGCCAGCATTTCTCTGTGG - Intergenic
1152168506 17:78726949-78726971 GGGAAGTCAGTAGTGGTTTGGGG - Intronic
1152911122 17:83005382-83005404 GGGATGCCTGCTTTTGCTTGGGG + Intronic
1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG + Intergenic
1153940811 18:9974975-9974997 TGGAACCCTGCTTTTGTTTGGGG + Intergenic
1154054957 18:11003990-11004012 TGGAAACCATCATTTGTTTAGGG - Intronic
1156716522 18:40018984-40019006 GGGCAGCCAGAATATGTTTTGGG + Intergenic
1157828196 18:50831549-50831571 CGGAAGCAAACAATTGTTTGAGG + Intergenic
1159632934 18:70769671-70769693 GGGCAGACAGCATGTGTTGGGGG + Intergenic
1159944879 18:74436936-74436958 GAGAAGCCAACATCTGTGTGAGG + Intronic
1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG + Intronic
1166402604 19:42494640-42494662 GGGAAGCCAGAAGTTGTTCATGG + Intergenic
1166720443 19:44993057-44993079 GGCAGGCCAGGGTTTGTTTGTGG + Exonic
1168629270 19:57944486-57944508 GGGAAGCCAGGATTTGCCTGTGG - Intronic
925456327 2:4019603-4019625 GGCAAGACAGCATTTGTGGGGGG + Intergenic
928288914 2:30020142-30020164 GGAAAGCCTGCCATTGTTTGTGG + Intergenic
930114362 2:47706268-47706290 GGGAAGCCAGCAGATGATAGTGG - Intronic
931642766 2:64396218-64396240 GGGAAGCCAGCAGGTGAGTGGGG + Intergenic
931787846 2:65637122-65637144 GGGAAGCGGGCTCTTGTTTGGGG + Intergenic
932412510 2:71555639-71555661 GGGAAGCCAGGCCTGGTTTGAGG + Intronic
933480598 2:82852271-82852293 GGCTAGCCAGCATTTCTTTATGG + Intergenic
940180751 2:150929946-150929968 AGGAAGTCATCATTTGTTTCTGG - Intergenic
940499235 2:154474086-154474108 GGGAAGCCAGAAGTTGTATATGG + Intergenic
940747071 2:157579604-157579626 GTGAAGCCATCATCTGTTTCTGG + Intronic
941994052 2:171584928-171584950 TGGAAGCCAGCACTTCTCTGGGG - Intergenic
942867636 2:180695339-180695361 GGGATGAAAGCAATTGTTTGTGG - Intergenic
946027033 2:216678201-216678223 GGGAAGCCTCCATGTGTCTGCGG + Exonic
1169209322 20:3756953-3756975 GTGAGGCCAGCTTTTGTTTTTGG + Intronic
1169404152 20:5309342-5309364 GGCAAGGCAGCATTTCTTTCTGG + Intronic
1170394164 20:15908151-15908173 GGGAAGCAAACATTTGTTCTTGG - Intronic
1171440355 20:25156255-25156277 GGGAAGCCACTTTGTGTTTGTGG - Intergenic
1171475299 20:25404014-25404036 GGAAAGCCATCTTTTGTGTGGGG + Intergenic
1172095345 20:32457568-32457590 GGGAGGCCAGCAATTGGTTGGGG - Intronic
1172355572 20:34277314-34277336 CAGAACCCAGCATTTGTATGTGG - Intergenic
1173159956 20:40645022-40645044 CTGCAGCCAGCACTTGTTTGTGG - Intergenic
1174796269 20:53525099-53525121 GGGAATCCAGCATCTGTGTGAGG + Intergenic
1176688099 21:9872889-9872911 GGGAACCCAGCATGGGATTGTGG + Intergenic
1177543918 21:22532181-22532203 GTGAAGCCAGCATGTGCTTCTGG - Intergenic
1177957852 21:27623109-27623131 AGGAAGCCAGCCTTAGTGTGAGG - Intergenic
1178567230 21:33698980-33699002 GTGGAGGCAGTATTTGTTTGGGG + Intronic
1178673147 21:34609757-34609779 GGGAACCAAGCAGTTGTTAGGGG + Intronic
1179008486 21:37534713-37534735 ATGATGCCTGCATTTGTTTGAGG + Intergenic
1179575179 21:42303646-42303668 GGGAAGCCAGCGTGTGGGTGTGG - Intergenic
1180939788 22:19652362-19652384 GGGAAGACATCCTGTGTTTGTGG + Intergenic
1183076188 22:35428686-35428708 GGCAACCCAGCATCTGTTGGCGG + Intergenic
1183724223 22:39579528-39579550 GTGATGCCAGCATCTGTTTCTGG + Intronic
1184039717 22:41935594-41935616 GGGAAGCCAGCCTCTGCTTGAGG - Intergenic
950634913 3:14307835-14307857 GGGAAGCCAGTATGTGCTGGAGG - Intergenic
950716269 3:14849851-14849873 CAGAAGCCAGCATTTTTTTTAGG - Intronic
951125843 3:18982602-18982624 GGCAAGACTCCATTTGTTTGGGG - Intergenic
951868136 3:27330263-27330285 GGGAAATCATCATTTGCTTGAGG + Intronic
952049996 3:29373339-29373361 GGGAAGCCAAAATTTCTTTTAGG - Intronic
954219196 3:49142387-49142409 GGGCTGCCAGCATGAGTTTGTGG - Intergenic
955107256 3:55909932-55909954 GAGAAGGCCTCATTTGTTTGAGG + Intronic
955959162 3:64321122-64321144 GAAAAACCAGCATTTTTTTGAGG - Intronic
956168696 3:66415868-66415890 GAAAAAGCAGCATTTGTTTGGGG - Intronic
962269649 3:133968291-133968313 GGGCAGCCTGAGTTTGTTTGTGG - Intronic
963204453 3:142618243-142618265 GGGTAGGCAGAGTTTGTTTGAGG - Intronic
969400513 4:6952388-6952410 GGGCAGCCAACATTTGATTCGGG - Intronic
971895911 4:32593637-32593659 ATGATGCCAGCATTTGTTTCTGG - Intergenic
972094211 4:35328034-35328056 GGGAAGTCAGTATGTGTTTAGGG - Intergenic
973180314 4:47259189-47259211 GTGAAGGCTGGATTTGTTTGTGG - Intronic
974137628 4:57838390-57838412 TAGAAACCAGCATTGGTTTGAGG - Intergenic
974358971 4:60851371-60851393 GGGTTGCCAGCATTTTATTGAGG - Intergenic
980342154 4:131564660-131564682 AGGAAGCAAGCATATATTTGAGG - Intergenic
980351471 4:131690728-131690750 GGGAACCCAGCATGGGGTTGTGG + Intergenic
982303957 4:153909357-153909379 GTGATGCCAGCATTGGTTTGGGG - Intergenic
983177971 4:164614227-164614249 GGGAAGTCAGCTTTGTTTTGGGG - Intergenic
984369357 4:178842407-178842429 GGCAAGCCAGTCTGTGTTTGGGG - Intergenic
985590860 5:764401-764423 GGGAACCCAGCACTAGTTCGGGG + Intronic
985870912 5:2556295-2556317 GGGAAAACAGCACATGTTTGGGG + Intergenic
985996112 5:3597913-3597935 GGGAACCCTGCCTGTGTTTGCGG + Intronic
986942047 5:12965520-12965542 GGGAAGAAAGCATTTATTAGTGG + Intergenic
987450687 5:18080186-18080208 GGGAAGCCAGGATTTCAATGTGG - Intergenic
994636357 5:102349097-102349119 GGTTAGCTAGCATTTTTTTGAGG - Intergenic
995182518 5:109241987-109242009 GGTAAGCCAGAGTTTGTGTGGGG + Intergenic
995463983 5:112431906-112431928 GGCTAGCCAGCATTTCTCTGTGG + Intergenic
997303786 5:132824459-132824481 TGGAGGCCACCATTTGTTTGTGG - Intronic
999244105 5:150144287-150144309 GAGAAGCCAGCCTTTGCCTGAGG - Intronic
1002889894 6:1323599-1323621 GGGAAGTCAACATTTGTAGGAGG + Intergenic
1005437945 6:25835512-25835534 GGGAAGGCAGCAGTTGATTTTGG - Intronic
1007281194 6:40713668-40713690 GGGAAGCCAGCATCCGTGGGAGG - Intergenic
1007772293 6:44201490-44201512 GGGAAATCAGCATTGGTGTGGGG - Intergenic
1008294250 6:49756864-49756886 GGCAGCCCAGCATTTGTTTGAGG - Intergenic
1008932730 6:56956099-56956121 GGAAAGCCAGCATTGCCTTGGGG - Intronic
1012050962 6:94343487-94343509 GAGAAGCCAGCCTTTGATTAAGG - Intergenic
1014738470 6:125122037-125122059 GGGAAGCCAGAAGTTGTTCATGG - Intronic
1015778569 6:136839937-136839959 GGGAAGGGAGGATTTGTCTGGGG + Intronic
1016749530 6:147617618-147617640 TGTAACCCAGCATTTGTTTCCGG - Intronic
1022108033 7:27210701-27210723 AGGGAGCCAGCATTTGATTCTGG - Intergenic
1023496708 7:40805621-40805643 TGGAAGCCAAAATATGTTTGGGG + Intronic
1023940312 7:44765216-44765238 TGGAAGCAAGCATTTGAGTGGGG + Intronic
1024163841 7:46709823-46709845 AGGCAGCCTGCATTTGTTGGAGG + Intronic
1025600190 7:62986950-62986972 AGGATGCCAGCAATTGTTTAGGG - Intergenic
1027293085 7:76735722-76735744 GGGAGGCCAGCATTTCCTTGGGG + Intergenic
1032762184 7:134953766-134953788 GGGAAGCCAGCATCTGGCTGAGG - Intronic
1038805368 8:30786203-30786225 GGGAAACCTGCCTTTGTATGTGG - Exonic
1040835136 8:51723389-51723411 GGGAAGCCAGCATCTGAGTCTGG - Intronic
1041256353 8:55982704-55982726 GAGAAGCCAGCATTTGAAGGTGG - Intronic
1042981806 8:74538011-74538033 GGTTTGCCAGCATTTTTTTGAGG + Intergenic
1043390750 8:79789564-79789586 TGGAAGGAAGAATTTGTTTGGGG - Intergenic
1044115550 8:88328873-88328895 GCGAGGCAAGCATCTGTTTGGGG + Intergenic
1044540044 8:93398617-93398639 AGGGAACCAGCATTTGTTGGTGG - Intergenic
1047560518 8:125982971-125982993 GCAAAGACAGCAGTTGTTTGGGG + Intergenic
1047922514 8:129650178-129650200 GTGAAGCCAGAATTTGAATGCGG - Intergenic
1047963721 8:130029878-130029900 GGGAAGGCAGCATTAAATTGTGG - Intergenic
1048314963 8:133355095-133355117 GGTGAGTCAGCATTTGGTTGTGG - Intergenic
1049150438 8:141031790-141031812 GAGAAGCCAGCATTTGTTGATGG - Intergenic
1049692790 8:143969907-143969929 GGGAGGCCTGCATTGGTCTGGGG + Intronic
1050444901 9:5710492-5710514 GGCCAGCCAGCACTTTTTTGAGG - Intronic
1051434180 9:17013287-17013309 GGGAATTCAGCATTTCTTTGGGG + Intergenic
1051537356 9:18175330-18175352 GGGCAGCCAGCTGGTGTTTGTGG - Intergenic
1051796288 9:20874828-20874850 GAGAAGCTAGCATTTTTTAGTGG + Intronic
1053781244 9:41608984-41609006 GGGAACCCAGCATGGGGTTGTGG - Intergenic
1054169190 9:61819137-61819159 GGGAACCCAGCATGGGGTTGTGG - Intergenic
1054668342 9:67761679-67761701 GGGAACCCAGCATGGGGTTGTGG + Intergenic
1056214018 9:84391537-84391559 GGGAAGCCACCATGGCTTTGAGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058229216 9:102405482-102405504 GGCCAGCCAGCATTTCTCTGTGG - Intergenic
1058657711 9:107239224-107239246 GAGAAGCCAGCAGTGTTTTGGGG + Intergenic
1060845955 9:126837710-126837732 GTGAAACCAGGGTTTGTTTGGGG + Exonic
1061309067 9:129750627-129750649 TGGAGGCCAGCCTTTGGTTGAGG + Intronic
1185517794 X:713989-714011 GGGAAGCCAGCTTACATTTGGGG + Intergenic
1186450669 X:9670880-9670902 TGAAGGCCAGCATTTCTTTGAGG + Intronic
1187032520 X:15502694-15502716 GTGAAGCCAGTATTTGTCTTTGG + Intronic
1188065754 X:25657481-25657503 GGCTAGCCAGCATTTCTTTATGG + Intergenic
1189045276 X:37584213-37584235 GGTTTGCCAGCATTTTTTTGAGG + Intronic
1189195902 X:39152250-39152272 GGGAAGCCAGCAGTTCTGTAGGG + Intergenic
1192055533 X:67769440-67769462 GGCAGGCCAGCATTTCTCTGAGG + Intergenic
1194373299 X:93101057-93101079 GTGAAGCCAGCATGAATTTGTGG - Intergenic
1195368083 X:104146053-104146075 GGTATGCCAGCATTTTATTGAGG - Intronic
1195537297 X:106023377-106023399 GGTATGCCAGCATTTTTATGAGG - Intergenic
1195753335 X:108178312-108178334 GGGCAGCCTGCTTTTGGTTGGGG - Intronic
1195757356 X:108212518-108212540 GGGAAGTCAGGATTAGTATGTGG + Intronic
1200681336 Y:6215098-6215120 GTGAAGCCAGCATCAATTTGTGG - Intergenic
1201689832 Y:16751427-16751449 GGTAACCCAACATTTTTTTGTGG + Intergenic