ID: 1163405786

View in Genome Browser
Species Human (GRCh38)
Location 19:17121462-17121484
Sequence TATCCAAGAGCTGCCGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163405783_1163405786 23 Left 1163405783 19:17121416-17121438 CCCACACTTACAGCAGATATGTA 0: 1
1: 0
2: 0
3: 7
4: 122
Right 1163405786 19:17121462-17121484 TATCCAAGAGCTGCCGCCACAGG 0: 1
1: 0
2: 0
3: 1
4: 67
1163405784_1163405786 22 Left 1163405784 19:17121417-17121439 CCACACTTACAGCAGATATGTAT 0: 1
1: 0
2: 1
3: 12
4: 127
Right 1163405786 19:17121462-17121484 TATCCAAGAGCTGCCGCCACAGG 0: 1
1: 0
2: 0
3: 1
4: 67
1163405785_1163405786 -2 Left 1163405785 19:17121441-17121463 CCAAATATATATATATATATATA 0: 153
1: 1795
2: 2021
3: 4661
4: 10502
Right 1163405786 19:17121462-17121484 TATCCAAGAGCTGCCGCCACAGG 0: 1
1: 0
2: 0
3: 1
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163405786 Original CRISPR TATCCAAGAGCTGCCGCCAC AGG Intronic
901175112 1:7293261-7293283 TCTCCAGGAGCTCCCGCCAGAGG + Intronic
901332698 1:8423527-8423549 GAGCCAGGAGCTGCCCCCACCGG - Intronic
901744254 1:11362133-11362155 TTTCCAGGTGCTGCAGCCACAGG - Intergenic
906041363 1:42789960-42789982 TAGCCAAGAGCTGGAGCCAATGG + Intronic
907604642 1:55804587-55804609 TGCCCAAGAGCTTCTGCCACAGG - Intergenic
910292475 1:85612785-85612807 TATCCAGGAGTAGCCTCCACAGG - Intergenic
910361129 1:86414432-86414454 TCTCCAAGAGCTGCCACAGCAGG + Intergenic
911676319 1:100662369-100662391 TCTACAAAAGCTGCCACCACAGG - Intergenic
913319444 1:117578064-117578086 TTTCCAAGAGGTCCCGCCCCTGG - Intergenic
914431106 1:147620675-147620697 TATCCAAGGGCTTCCGCCCCAGG - Exonic
920604053 1:207362599-207362621 TTTCCAAAAGCTGCCACCATGGG - Intergenic
1064971557 10:21072177-21072199 GAGCCAAGGGCTGCAGCCACTGG - Intronic
1067433069 10:46256616-46256638 TTCCCAGGAGCTGCCACCACAGG + Intergenic
1067440196 10:46304808-46304830 TTCCCAGGAGCTGCCACCACAGG - Intronic
1067530247 10:47065967-47065989 TCTCCAAGATCTGCCGCCTGAGG + Intergenic
1072041468 10:91611078-91611100 TAGCCAAGACTTGCTGCCACTGG + Intergenic
1104074836 12:125379840-125379862 TTTCCAAGTGCTGCCACTACAGG + Intronic
1106067453 13:26369152-26369174 CAGCCATGAGCTGCCGCCCCTGG - Intronic
1117572133 14:57058050-57058072 TACCCAACAGCTGCCACCCCAGG + Intergenic
1129821594 15:78605811-78605833 TCTCCACGAGCTGCTGCCTCTGG - Intronic
1135533462 16:23274501-23274523 TATCAGAGAGCTCCAGCCACTGG + Intergenic
1136606297 16:31336349-31336371 TGTCCAACACCTGCAGCCACTGG + Intergenic
1139330943 16:66189456-66189478 TATCTCAGAGCTACAGCCACAGG + Intergenic
1139892830 16:70265021-70265043 TATCGAAGAGCTCCGGGCACGGG - Exonic
1141759858 16:86021050-86021072 TATACAAGGGCTGCAGCCAGAGG - Intergenic
1147665808 17:42147207-42147229 TATCCAAGTACTGCAGGCACAGG + Intronic
1148887611 17:50785223-50785245 TATCCAAGACCTAGCTCCACTGG + Intergenic
1149218804 17:54390269-54390291 TATCCAAGAGTGTCTGCCACAGG + Intergenic
1149602081 17:57899495-57899517 AATCCCAGTGCTGCAGCCACTGG - Intronic
1152208065 17:78986805-78986827 GGTCCTAGTGCTGCCGCCACGGG + Intergenic
1152785251 17:82244589-82244611 ACTCCAAGAGCTGCCACCGCTGG - Exonic
1153667877 18:7382514-7382536 ATTCCAAGAACTGCAGCCACTGG + Intergenic
1160717259 19:582021-582043 TTTCCAGGAGCTGCCATCACAGG - Intronic
1163405786 19:17121462-17121484 TATCCAAGAGCTGCCGCCACAGG + Intronic
1163870259 19:19815387-19815409 TTTCCCACAGCTGCCACCACAGG - Intronic
1163948342 19:20561422-20561444 TTTCCCACAGCTGCCACCACAGG - Intronic
1164000291 19:21092210-21092232 TTTCCCACAGCTGCCACCACAGG + Intronic
1164022657 19:21322235-21322257 TTTCCCACAGCTGCCACCACAGG - Intronic
1164306441 19:24007880-24007902 TTTCCCACAGCTGCCACCACAGG - Intergenic
1164778209 19:30871354-30871376 TTACCTAGAGCTGCCGCCAGTGG + Intergenic
1166746736 19:45145331-45145353 TAGCCAGGCGCTCCCGCCACAGG + Exonic
928692042 2:33810189-33810211 TATCCAACAGCTACAGCCTCAGG - Intergenic
929324577 2:40592978-40593000 TATCCCAGAGCTGCAGCTGCAGG - Intronic
930621870 2:53652332-53652354 TCTCCAAGAGCTGCCCTCAGGGG + Intronic
935066589 2:99653598-99653620 TTGCCAACAGGTGCCGCCACTGG - Intronic
937157445 2:119730947-119730969 TTTACAAGAGCTGACGCCAGTGG - Intergenic
938585630 2:132687631-132687653 AATCCAAAAGCTGCTCCCACTGG + Intronic
945115430 2:206403704-206403726 TATCCATGAGCTGCCAACTCTGG - Intergenic
948656960 2:239482349-239482371 ATTCCAAGAGCTGCAGCCTCAGG - Intergenic
1171824087 20:29878719-29878741 TTTCCTAGATCTGGCGCCACTGG - Intergenic
1174389771 20:50211303-50211325 TATCCAAGTGCTGCTCACACTGG - Intergenic
1176169083 20:63689070-63689092 TATGCAAGGGTTGCCGCCCCTGG + Exonic
1184262164 22:43324652-43324674 TATCCAGGAGTCGCCGCCCCTGG + Intronic
1184868240 22:47215999-47216021 GCTCCAAGGGCTGCAGCCACAGG - Intergenic
951710013 3:25577631-25577653 TACCCAGGAGCTGCCTCCAGTGG + Intronic
953824570 3:46239780-46239802 CATCCCAGAGCTGCCTCCATGGG - Intronic
961059376 3:123815510-123815532 CATTCCAGAGCTGCCCCCACTGG - Intronic
1000928933 5:167229256-167229278 TAGCCAACAACTGCCACCACTGG - Intergenic
1018911464 6:168102676-168102698 CCTCCAAGAGCTGCTGGCACTGG + Intergenic
1028606703 7:92663301-92663323 GGACCAAGAGATGCCGCCACAGG + Intronic
1035091959 7:156320102-156320124 TGTCCAAGAGCTGCTGCACCGGG - Intergenic
1035260924 7:157661334-157661356 AGGCGAAGAGCTGCCGCCACGGG - Intronic
1046557200 8:115790031-115790053 TATCTAAATGCTCCCGCCACAGG - Intronic
1049226258 8:141451925-141451947 CATCCAAGGGCTGCCGTCAGGGG + Intergenic
1049386747 8:142346778-142346800 TTTCCAAGAGCTGCTGCTTCAGG - Intronic
1061756973 9:132821316-132821338 TAAGCAAGTGATGCCGCCACAGG + Intronic
1186133364 X:6493647-6493669 TATCAAAGAACTGCCGTCTCTGG - Intergenic
1192718014 X:73664063-73664085 TCTCTCAGAGCTGCCACCACTGG - Intronic
1198159135 X:133989665-133989687 TGTTCAACAGCTGCCGCCATGGG + Intergenic