ID: 1163406448

View in Genome Browser
Species Human (GRCh38)
Location 19:17126038-17126060
Sequence CACAAGGAAGACCCTGCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163406448_1163406462 30 Left 1163406448 19:17126038-17126060 CCCTTCGCAGGGTCTTCCTTGTG No data
Right 1163406462 19:17126091-17126113 CACTAACCTCCTCATTCCCTCGG 0: 1
1: 1
2: 1
3: 17
4: 265
1163406448_1163406454 3 Left 1163406448 19:17126038-17126060 CCCTTCGCAGGGTCTTCCTTGTG No data
Right 1163406454 19:17126064-17126086 GGCTGGCATCATCCCCGACATGG 0: 1
1: 0
2: 0
3: 8
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163406448 Original CRISPR CACAAGGAAGACCCTGCGAA GGG (reversed) Intronic
No off target data available for this crispr