ID: 1163409526

View in Genome Browser
Species Human (GRCh38)
Location 19:17145375-17145397
Sequence CCTGCAAGGAAATCAAAAGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163409526_1163409535 27 Left 1163409526 19:17145375-17145397 CCTGCTTTTGATTTCCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 212
Right 1163409535 19:17145425-17145447 ACAACAACTCCAGCCGGTTTGGG 0: 1
1: 0
2: 1
3: 3
4: 56
1163409526_1163409534 26 Left 1163409526 19:17145375-17145397 CCTGCTTTTGATTTCCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 212
Right 1163409534 19:17145424-17145446 AACAACAACTCCAGCCGGTTTGG 0: 1
1: 0
2: 1
3: 8
4: 73
1163409526_1163409532 21 Left 1163409526 19:17145375-17145397 CCTGCTTTTGATTTCCTTGCAGG 0: 1
1: 0
2: 0
3: 8
4: 212
Right 1163409532 19:17145419-17145441 CCCACAACAACAACTCCAGCCGG 0: 1
1: 0
2: 0
3: 20
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163409526 Original CRISPR CCTGCAAGGAAATCAAAAGC AGG (reversed) Exonic
900002485 1:22297-22319 CATGGAAGGAAAGCAAAACCAGG + Intergenic
901903308 1:12386163-12386185 CCTGAAAGGAAACCAAAATATGG - Exonic
903261706 1:22135097-22135119 GCTGCTAGGACATCAAGAGCTGG + Intronic
907576858 1:55534533-55534555 CCTGCATTTAAATCAGAAGCTGG - Intergenic
908441252 1:64156922-64156944 GCTGCTAGTAAGTCAAAAGCTGG - Intronic
909932888 1:81518149-81518171 CGTGAAAGGAAATAAAGAGCAGG + Intronic
910669309 1:89757140-89757162 CCTGCAAGGAAATCAGTTCCTGG + Intronic
911147349 1:94565489-94565511 CCTGGAAGAAAAGCAAAATCAGG - Intergenic
911396129 1:97313052-97313074 TCTGCAAGGAAATGCAAACCAGG + Intronic
915219191 1:154360345-154360367 CAGGCAAGGGAATCAAAGGCAGG + Intergenic
915663925 1:157427530-157427552 CCTAGAAGGATATCAAATGCAGG - Intergenic
918400067 1:184154195-184154217 CCTGGGAGGAAATGAAAAGGAGG - Intergenic
920688995 1:208131499-208131521 CCTGGAAGGAGCTGAAAAGCAGG + Intronic
921006806 1:211101605-211101627 TCAGCAAGCAAATCACAAGCTGG + Intronic
921632268 1:217449233-217449255 ACTGCAGGTAAAACAAAAGCAGG - Exonic
1063123537 10:3121690-3121712 CCTCCAAGGGAAGTAAAAGCAGG - Intronic
1063957071 10:11277011-11277033 CAGGCTAGGAAATCAAATGCTGG + Intronic
1064142109 10:12799199-12799221 ACGGCAAGGAGACCAAAAGCGGG - Intronic
1064278178 10:13926528-13926550 CCTGCAAGTAAATCTCTAGCAGG - Intronic
1065140116 10:22713013-22713035 CATCCATCGAAATCAAAAGCAGG + Intronic
1065674115 10:28155946-28155968 GCAGCAAGGAAAACAATAGCTGG - Intronic
1067364163 10:45609689-45609711 CCTGAAAGGAAATCCACAACAGG - Intergenic
1068735275 10:60407163-60407185 CCTGAGAGAAACTCAAAAGCAGG - Intronic
1072207482 10:93217046-93217068 CCTTCAAAGACATCAATAGCAGG + Intergenic
1072960665 10:99926443-99926465 ACTGAAAAGCAATCAAAAGCAGG + Intronic
1073315842 10:102580274-102580296 CCTGCAAGGAGAGGAAAAGATGG - Intronic
1075669064 10:124250755-124250777 CCAGGAAGGAAAGCAAAGGCAGG + Intergenic
1076947768 10:133664131-133664153 ACAGCAAGGAAAATAAAAGCAGG - Intergenic
1077180783 11:1213852-1213874 CCTTCAATGAAACCAAAAGTTGG + Intergenic
1077749676 11:4952650-4952672 ACAGAGAGGAAATCAAAAGCTGG - Intronic
1079712270 11:23700218-23700240 GCTGCAAGGCCATTAAAAGCAGG + Intergenic
1079801253 11:24872099-24872121 CATACAAGGAAATCAGAACCCGG - Intronic
1079983738 11:27178598-27178620 ACTGGAAGCAATTCAAAAGCAGG + Intergenic
1080659650 11:34285448-34285470 CCTGCAAGATAATTAAAAGAGGG - Intronic
1081743365 11:45456377-45456399 CCTCTGAGGAACTCAAAAGCAGG + Intergenic
1087128623 11:94650419-94650441 GAGGCAAGGAAAGCAAAAGCAGG - Intergenic
1087868863 11:103266601-103266623 ATGGCAAGGAAAGCAAAAGCTGG + Intronic
1088985082 11:114898849-114898871 GCTGCAATGAAAGCAAAACCAGG + Intergenic
1089722048 11:120434663-120434685 TCTCCAAGGTAAGCAAAAGCAGG - Intronic
1089994998 11:122898170-122898192 GCAGCAAGGAAAACAGAAGCAGG - Intronic
1090448655 11:126786828-126786850 CCTGTTAGGAAATCAAATGAGGG - Intronic
1092191800 12:6526648-6526670 CCTGCAGGGAGAACAGAAGCTGG - Intronic
1093589567 12:20885180-20885202 CTTCAAAGGAAATCAAAGGCAGG - Intronic
1094326162 12:29241790-29241812 CCTCCTCGGAAATGAAAAGCAGG - Intronic
1094543646 12:31383938-31383960 CCTGCAAATAAATTAAATGCTGG - Exonic
1100241617 12:92715265-92715287 GCTGCCAGCAAATCTAAAGCAGG - Intergenic
1100593322 12:96049863-96049885 CTTGCATGGAAATAAAAAACAGG + Intergenic
1101543379 12:105685120-105685142 GCTGCCAGGAAATATAAAGCAGG + Intergenic
1101938979 12:109084874-109084896 CTTTCAAGGTAATCAAAACCAGG + Intronic
1102735276 12:115153635-115153657 CCTGCAAGGTCATCAGAACCTGG - Intergenic
1103197379 12:119056508-119056530 CCTGCAAGGCATTCAAAACCTGG + Intronic
1103344221 12:120238507-120238529 CCTGCAATAAAATCCAAACCAGG - Intronic
1103649413 12:122421977-122421999 CTTGAGAGGAAAACAAAAGCCGG + Intronic
1104424945 12:128668500-128668522 CCTTCAAGGATACTAAAAGCAGG - Intronic
1108453008 13:50586182-50586204 CCTGCAAGGCCAACAAAAGGGGG - Intronic
1108816416 13:54296907-54296929 GCTGAAAGCAAACCAAAAGCAGG - Intergenic
1113228040 13:108180393-108180415 CCTTAGAGGAAATGAAAAGCAGG + Intergenic
1115470029 14:33758935-33758957 CATGCAATTAATTCAAAAGCTGG - Intronic
1119376853 14:74201619-74201641 CCTTCTAGGAACTCAAAGGCAGG - Intergenic
1119953386 14:78769302-78769324 CCTGTAAGGAAATTAAAATAAGG + Intronic
1120534947 14:85683307-85683329 CCTGTAAGTAAATAAAAAGAGGG + Intergenic
1121845073 14:97165533-97165555 CCTTCAAGGCATTGAAAAGCTGG - Intergenic
1125640443 15:41225939-41225961 CCTGCTATCATATCAAAAGCAGG + Intronic
1125800207 15:42439345-42439367 CCTGTAAGGAAAGTAAAAGCTGG - Exonic
1126249749 15:46553598-46553620 ACTGGAAGGAAAACAAAGGCAGG + Intergenic
1126361774 15:47853934-47853956 ACTCCAAGGAAAACAAAAGAAGG - Intergenic
1127408000 15:58673241-58673263 CCAGCATGAAAATCTAAAGCAGG + Intronic
1128237060 15:66075366-66075388 CCAGCAGAGAAATCAGAAGCAGG + Intronic
1128445812 15:67759250-67759272 CCTCCCAGAAATTCAAAAGCGGG + Intronic
1131003204 15:88954911-88954933 CCAGCAAGGCCATCAAAAGGCGG + Intergenic
1131025170 15:89135284-89135306 CTGGCATGGAAATTAAAAGCAGG - Intronic
1132451025 15:101968642-101968664 CATGGAAGGAAAGCAAAACCAGG - Intergenic
1133569083 16:7023925-7023947 CCCTCATGGGAATCAAAAGCAGG - Intronic
1133903980 16:10004033-10004055 CATGAAAGGGAATCAAAAGGGGG + Intronic
1135360799 16:21812727-21812749 CTTGGAAGGAAATCAAAACTGGG + Intergenic
1136262018 16:29084305-29084327 CTTGGAAGGAAATCAAAACTGGG - Intergenic
1136358692 16:29763582-29763604 CCTGCAAGAAAAGCACCAGCAGG + Intergenic
1138339361 16:56278689-56278711 GCTGCAAGGAAAACAAAATAAGG + Intronic
1138889444 16:61124254-61124276 CCCGTAAGGAGCTCAAAAGCTGG + Intergenic
1140244050 16:73232252-73232274 CCTGAAAGGGAATCAGGAGCAGG - Intergenic
1144001228 17:11057083-11057105 CTGGCAAGGATACCAAAAGCTGG + Intergenic
1146919432 17:36700457-36700479 CCCACAAGGAAACCAGAAGCAGG - Intergenic
1149315003 17:55430764-55430786 CCTGACAGGAACTCAAAAGGGGG - Intergenic
1149709154 17:58723225-58723247 AGTGCAAGGAAATGAAAAGGTGG - Intronic
1151345550 17:73499259-73499281 CCAGCAAGGGACACAAAAGCAGG - Intronic
1157878011 18:51291678-51291700 CCTGCAAGGGAATCTAAGGGAGG + Intergenic
1160119365 18:76113979-76114001 CCTGCAGGGAAATTAAAGGAAGG + Intergenic
1160634237 19:63905-63927 CATGGAAGGAAAGCAAAACCAGG + Intergenic
1161583531 19:5093209-5093231 CCTGCAGGGACATGACAAGCAGG - Intronic
1163409526 19:17145375-17145397 CCTGCAAGGAAATCAAAAGCAGG - Exonic
1164605659 19:29596154-29596176 CCTGGGAGGAGATAAAAAGCAGG - Intergenic
1165896503 19:39144670-39144692 CCTGCAAGGAAGACAAAGGCCGG - Intronic
1168130038 19:54312148-54312170 CCTGGAAGGAAATCAGAGTCTGG + Exonic
1168169038 19:54574279-54574301 CCTGGAAGGAAATCAGAGGTCGG - Exonic
1168173729 19:54608072-54608094 CCTGGAAGGAAATCAGAAACTGG - Intronic
1168181132 19:54663732-54663754 CCTGGAAGAAAATCAGAGGCTGG - Exonic
1168185350 19:54696758-54696780 CATGGAAGGAAATCAAAGCCTGG - Intronic
930846982 2:55917042-55917064 CCTCCAAGGTAATGAGAAGCAGG + Intronic
931276100 2:60745238-60745260 CCTGCAAGAAAATCAGAGGTTGG + Intergenic
935847619 2:107183879-107183901 CCTGCAGGGAAGTCAAAAACTGG + Intergenic
936509330 2:113132638-113132660 ACTGCCTGGAAATCAAAAGATGG - Exonic
936567238 2:113591122-113591144 CATGGAAGGAAAGCAAAACCAGG - Intergenic
936874704 2:117174375-117174397 TCTACAAGGAATTCAAAAACAGG - Intergenic
939452433 2:142391366-142391388 CCTACAAGCACATCAAAGGCAGG - Intergenic
940171769 2:150836269-150836291 GCTGCTAGGAAATATAAAGCAGG - Intergenic
941433586 2:165440481-165440503 TCTGCCTGGAAATCACAAGCTGG - Intergenic
945447716 2:209957846-209957868 CCTCCAAGGAAAAGAAAAGAAGG + Intronic
1169754481 20:9029068-9029090 ACAGCAAGTAAATCAAATGCCGG + Intergenic
1169948833 20:11019202-11019224 CATTTAAGGAAATCAAAAGAGGG + Intergenic
1172218709 20:33256850-33256872 CCTGCAAAGGAAGCAAAACCAGG + Intergenic
1174242551 20:49149291-49149313 CCAGCAAGAACAACAAAAGCAGG + Intronic
1174350683 20:49965391-49965413 CCTGAAAGGTGATCAAAACCAGG + Intergenic
1176253813 20:64140084-64140106 CCACCAAGGAAAACAAAAGAAGG - Intergenic
1179014663 21:37585837-37585859 ACTTACAGGAAATCAAAAGCTGG - Intergenic
1180133908 21:45848122-45848144 AAAGCAAGGAAAGCAAAAGCAGG + Intronic
1182916698 22:34039743-34039765 CCTGAAAGGAAATCGGAACCAGG - Intergenic
1183760201 22:39809617-39809639 CCTCCAAGGCAATTAAAAGGTGG - Intronic
951447162 3:22796158-22796180 CCTGCAAGCCACTCAAAAGTGGG - Intergenic
952144801 3:30520245-30520267 CCTGCAAGTAGGTAAAAAGCAGG - Intergenic
952903904 3:38127324-38127346 CCAGAGAGGAAAGCAAAAGCAGG - Intronic
953001794 3:38940966-38940988 CCTGGAAGGTAAACAAAAGGAGG + Intronic
955429362 3:58826771-58826793 CCTTCAAGGAATTCACAACCAGG + Intronic
955565868 3:60245232-60245254 GCTACAAGGAAATTAAAAGTGGG - Intronic
955582169 3:60435573-60435595 CCTGAAAAGAAACCAAAAGAAGG - Intronic
956003547 3:64754290-64754312 TCTGAGAGGAAATCACAAGCAGG - Intergenic
956030406 3:65030974-65030996 CCTTCAAGGCATTCAAAAGATGG + Intergenic
956711792 3:72044622-72044644 CCAGCACGGAAATCAGAAACAGG - Intergenic
958719253 3:97823734-97823756 TCTGCAAGGAAATCCCAAGTAGG + Intronic
959463369 3:106653766-106653788 ATTGCAAGAAAAGCAAAAGCTGG + Intergenic
960488903 3:118285754-118285776 CCTCCAAGGAACTCCAAAGAAGG + Intergenic
961060560 3:123824981-123825003 TCTACAAAGAATTCAAAAGCTGG + Intronic
962384851 3:134924502-134924524 CCAGCAAGGAAATGAAAATTAGG + Intronic
962649131 3:137471020-137471042 CCTGTGAGGTAAACAAAAGCAGG - Intergenic
962686181 3:137850031-137850053 CCTTCAAGGACATCACAATCTGG + Intergenic
963874982 3:150465395-150465417 CGTGCATACAAATCAAAAGCTGG + Exonic
966286976 3:178308997-178309019 CCTGGAAGGAATTCAAGAACTGG + Intergenic
966364636 3:179171454-179171476 AAATCAAGGAAATCAAAAGCTGG + Intronic
967374869 3:188789587-188789609 TTTGCAAGCACATCAAAAGCTGG - Intronic
967741917 3:193012445-193012467 AATTCAAGGAAGTCAAAAGCTGG - Intergenic
968785603 4:2620043-2620065 CCAGTAACGAAACCAAAAGCAGG - Intronic
969993934 4:11292523-11292545 CCTGGGAGTACATCAAAAGCTGG - Intergenic
970450990 4:16166267-16166289 ACTGCAGAGAAAACAAAAGCAGG - Intronic
971728938 4:30350991-30351013 CCCTCAAGGAAGTTAAAAGCTGG - Intergenic
971965358 4:33548323-33548345 CCTAAAAGGAAATCAAAGGAGGG - Intergenic
972162443 4:36243987-36244009 TCTGAAAGGAAACCAGAAGCCGG - Intronic
973176662 4:47214323-47214345 ACTGCAAGGAAATGAGAAGAGGG - Intronic
974354559 4:60795557-60795579 CCTGGAATGAAAACAAAAGAAGG - Intergenic
975651951 4:76602071-76602093 CCTTCAAGGAAAGGGAAAGCTGG + Intronic
978260674 4:106753588-106753610 ACTGCAAGGAAAAGAGAAGCAGG - Intergenic
980026905 4:127778923-127778945 CAGGCAAGAAAACCAAAAGCTGG + Intergenic
981257470 4:142679202-142679224 CCTCCAAAGAAATCACATGCAGG - Intronic
985056993 4:186044905-186044927 CCGGCAATGTAATCAAGAGCAGG + Intergenic
985424982 4:189821165-189821187 CCTCCATGGAAATCAAACACTGG + Intergenic
987425510 5:17768230-17768252 CCTAGATGGAAATGAAAAGCAGG - Intergenic
990988069 5:61659408-61659430 CCGGCAAGGAAGTCACCAGCCGG - Intronic
991516277 5:67439088-67439110 CCTCCAAGGAGGCCAAAAGCAGG - Intergenic
992480556 5:77147397-77147419 CTGGCAAGGAAATTTAAAGCAGG + Intergenic
993035170 5:82748302-82748324 CCTGCTGAGGAATCAAAAGCAGG - Intergenic
993209057 5:84923501-84923523 CCTTCTAGGAAATGAAAATCTGG + Intergenic
994919227 5:106020866-106020888 CATCCAAGGAAAGCAAAATCAGG + Intergenic
995791099 5:115888072-115888094 TCCTCAAGGAATTCAAAAGCTGG - Intronic
997085990 5:130799328-130799350 CTTGCAAGGAATGCAAAAGGGGG + Intergenic
997712727 5:136019510-136019532 TCTGAAAGGAAAACACAAGCAGG + Intergenic
998566600 5:143221455-143221477 TTTGCAAGGAAATTAGAAGCAGG + Intronic
999286932 5:150399739-150399761 CCTGCAAGGAAAATGAAATCTGG - Intronic
1002150946 5:177230434-177230456 GCTGCAAGGAAATAGAGAGCTGG + Intronic
1003241928 6:4352630-4352652 CTGTCAGGGAAATCAAAAGCAGG - Intergenic
1004057509 6:12154930-12154952 AAGGCAAGGAAACCAAAAGCTGG - Intronic
1004358232 6:14948553-14948575 CGTGGAAGGAAATCAATAGGAGG - Intergenic
1005201949 6:23357197-23357219 CCTGCCATGAAATCAAAGGAAGG + Intergenic
1011669826 6:89672688-89672710 CCTGCTAGGAAATCAAATGTTGG - Exonic
1013439688 6:110150639-110150661 CTTGAAAGGAAAACAGAAGCAGG + Intronic
1013974937 6:116066198-116066220 GCTGCCAGCAAATAAAAAGCAGG + Intergenic
1017137441 6:151160832-151160854 ACTGCAGGGAAATGAAAAGAAGG + Intergenic
1017592728 6:155994262-155994284 CATGCTAGGAAATCCAAAGAAGG + Intergenic
1019115013 6:169752734-169752756 CCTGCAAAGAAGTCAAATTCAGG - Intronic
1020487751 7:8739446-8739468 CATGGAAGGCAATCAGAAGCAGG - Intronic
1023858576 7:44201742-44201764 CCCGCAAGAAAATCAAAATATGG - Intronic
1027559349 7:79707584-79707606 TCTATAAGAAAATCAAAAGCAGG - Intergenic
1027602484 7:80256294-80256316 GCTGCCTGGAAATCAAAAGAAGG + Intergenic
1028452741 7:91004203-91004225 ACTGCGATGAAATCAATAGCTGG + Intronic
1028511933 7:91634792-91634814 CCTGCAGGGAAAGCACATGCTGG + Intergenic
1029649961 7:101884959-101884981 CCAGCGAGGAAATGAAAAGGTGG - Intronic
1029953946 7:104617394-104617416 CCTGTAAAGACAACAAAAGCTGG + Intronic
1030930976 7:115523157-115523179 GCTGCAAGCAAATTTAAAGCAGG - Intergenic
1032480850 7:132245587-132245609 CCTGCAAAACAACCAAAAGCAGG + Intronic
1032582056 7:133112591-133112613 CCTGGAAGGAGAGGAAAAGCAGG + Intergenic
1033130156 7:138739174-138739196 ACTGCAAGAAAATACAAAGCAGG + Intronic
1033449017 7:141446457-141446479 CCTGGAAGGAAATGCAAAGGAGG + Intronic
1035897377 8:3418637-3418659 CCTGCAACGTAATGAGAAGCAGG + Intronic
1038688798 8:29742564-29742586 CCTGCCAAGAAACCATAAGCCGG + Intergenic
1039739692 8:40370823-40370845 ACGGCATGGAAATTAAAAGCTGG + Intergenic
1040715680 8:50249097-50249119 CCTACAAGGAAAATACAAGCTGG + Intronic
1041193755 8:55379676-55379698 CCTGCAACAAAACCAGAAGCAGG - Intronic
1041982563 8:63879750-63879772 ACTGAAAGGATATCAAAAACAGG + Intergenic
1042143612 8:65704672-65704694 CCTGCAAGGAAGACATAAGGTGG - Exonic
1042654502 8:71081372-71081394 CCTGGAAGGATATAAGAAGCTGG - Intergenic
1044773540 8:95663047-95663069 CCTGCAAGGACTTCAGATGCTGG - Intergenic
1045798843 8:106078359-106078381 ACTGAAATGAAATCAAAAGAAGG - Intergenic
1046167596 8:110457832-110457854 CTTGGTAGGAAACCAAAAGCAGG + Intergenic
1046330152 8:112703277-112703299 CAGGCAAAGAAATCAGAAGCAGG + Intronic
1049885293 9:22410-22432 CATGGAAGGAAAGCAAAACCAGG + Intergenic
1050045597 9:1541572-1541594 CCTGCAGGCAAAGCAAAGGCTGG + Intergenic
1050582019 9:7068619-7068641 CCAGCAAAGAAACCAAAACCAGG - Intronic
1050695032 9:8269284-8269306 CCTGCAATGGAATCAAAAGTGGG + Intergenic
1050801933 9:9626203-9626225 CGTGAAAGGAAATAAAAATCAGG - Intronic
1054823004 9:69542941-69542963 CCTGCAAGGAAAACGAGAACTGG - Intronic
1054828774 9:69600178-69600200 CCTTCAAGGAAATGCAAAGAAGG + Intronic
1055998358 9:82187257-82187279 CCTACAAGGGAATGAAAATCAGG - Intergenic
1057549518 9:96041655-96041677 CCTGCAAAGAAAGCAGAAACTGG + Intergenic
1060001560 9:119963503-119963525 CCTGCAAGCCAATCAAGAACAGG - Intergenic
1060722500 9:125988467-125988489 CCTGTAAAGAAATGAGAAGCAGG - Intergenic
1062288149 9:135782651-135782673 CGTGGAAGGAAAGAAAAAGCTGG - Intronic
1185898509 X:3877343-3877365 TCTGCAAGGAAATCAGTCGCGGG - Intergenic
1185903624 X:3915772-3915794 TCTGCAAGGAAATCAGTCGCGGG - Intergenic
1187164033 X:16787698-16787720 CCTGCAAGGAAAAAAAGAGATGG - Intronic
1191007818 X:55728860-55728882 CTGGAAAGGAAATCAATAGCAGG + Intronic
1191118782 X:56880609-56880631 CCTGCCAGGAAATCCAAAATCGG - Intergenic
1194375135 X:93123032-93123054 GCTGCCAGGAAATACAAAGCAGG + Intergenic
1195207253 X:102614306-102614328 TCTGAAAGGAAAAAAAAAGCTGG + Intergenic
1195482981 X:105369500-105369522 TCTGCAAGGAAAGGAAAAGCTGG - Intronic