ID: 1163411843

View in Genome Browser
Species Human (GRCh38)
Location 19:17159766-17159788
Sequence TATTAGCAAAACCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 305}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163411843_1163411848 -4 Left 1163411843 19:17159766-17159788 CCCTCCACCTGGTTTTGCTAATA 0: 1
1: 0
2: 4
3: 44
4: 305
Right 1163411848 19:17159785-17159807 AATAAAGTTTTATTGGCACATGG 0: 15
1: 72
2: 136
3: 192
4: 864

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163411843 Original CRISPR TATTAGCAAAACCAGGTGGA GGG (reversed) Intronic
901073574 1:6537127-6537149 TAATAACAAAACAAGGGGGAAGG + Intronic
905265337 1:36749748-36749770 TATTTACAAAAGCAGGTGGTGGG + Intergenic
905372017 1:37487407-37487429 TGTCAGCAAAACGAGGTGGGAGG + Intergenic
905491609 1:38348656-38348678 TATCACCAAAACCAGGAGAATGG - Intergenic
905935409 1:41820042-41820064 TATTGACAAAAACAGGTGGTGGG + Intronic
906155303 1:43610565-43610587 TATTTACAAAAACAGGTGGTGGG - Intronic
906676364 1:47696597-47696619 TATTTACAAAAGCAGGTGGCAGG + Intergenic
907382941 1:54106071-54106093 TATTTACAAAAACAGGTGGTGGG + Intronic
908444208 1:64186591-64186613 GTGTAGCAAACCCAGGTGGAAGG + Intergenic
908455000 1:64295003-64295025 TATTTACAAAAACAGGTGGTGGG + Intergenic
908507109 1:64815095-64815117 TATTTACAAAACCAGGTGGTGGG - Intronic
908649118 1:66312741-66312763 TATTTGCAAAAACATGTGGCTGG - Intronic
908872844 1:68634432-68634454 TATTTGCAAAAACAGGTGGTGGG + Intergenic
910862345 1:91754216-91754238 TTTTAGCAAATTCAGGTTGAAGG + Intronic
911661300 1:100504552-100504574 TATTAACAAAAATAGGTGGTGGG + Intronic
911786312 1:101953298-101953320 TATTTACAAAAACAGGTGGAGGG - Intronic
913259011 1:116981793-116981815 TATTTACAAAAGCAGGTGGTGGG + Intronic
913313365 1:117527315-117527337 TATTTACAAAAGCAGATGGAGGG + Exonic
915919723 1:159965621-159965643 TATTAGAAAAATGAGGTGGGTGG - Intergenic
918372468 1:183874886-183874908 GATTAGGAGAACAAGGTGGAGGG + Intronic
919459493 1:197859316-197859338 TATTTTCAAAACTAGGTGGCAGG + Intergenic
920517426 1:206596469-206596491 TATTTACAAAAACAGGTGGCAGG + Intronic
920902405 1:210124044-210124066 TCTTTACAAAAACAGGTGGAAGG - Intronic
921231703 1:213079814-213079836 TAGAAGCAAAAGTAGGTGGAGGG - Intronic
1063544748 10:6969857-6969879 TATTTATAAAAACAGGTGGAGGG + Intergenic
1063778627 10:9294215-9294237 AATTTGCAAAAACAGGTGGTTGG + Intergenic
1064117705 10:12593172-12593194 TATTTACAAAAACAGGTGGTGGG + Intronic
1067488751 10:46677952-46677974 TTTTAGGAGAAGCAGGTGGATGG + Intergenic
1067605918 10:47662424-47662446 TTTTAGGAGAAGCAGGTGGATGG - Intergenic
1067708152 10:48626584-48626606 TATTAGCAAATGCACATGGAGGG - Intronic
1068686125 10:59871640-59871662 TAACAGCAAAACCAGGACGAGGG - Intronic
1068693922 10:59945735-59945757 TGTCAGCAAAACCAGGCGGTAGG + Intergenic
1070682406 10:78457638-78457660 TCTTAACAAATCCAGGAGGAAGG + Intergenic
1071009693 10:80923598-80923620 TATTTACAAAACCAGGTGGAAGG + Intergenic
1071599554 10:86951608-86951630 TGTTAGCAAAAACAGGTGATGGG + Intronic
1071621473 10:87123783-87123805 TTTTAGGAGAAGCAGGTGGATGG - Intronic
1072518774 10:96212030-96212052 TAGTAGAAAAGCCAGGAGGAAGG - Intronic
1074625082 10:115174725-115174747 TATTTACAAAAACAGGTGGTGGG + Intronic
1075106105 10:119541404-119541426 AATTTGCAAAACCTGATGGATGG + Intronic
1076037015 10:127207811-127207833 TATTTACAAAACCAGGAGGTGGG + Intronic
1076343649 10:129766274-129766296 CATTTGCAAAAGCAGGTGGTGGG + Intronic
1078703767 11:13717808-13717830 TATTTACAAAAACAGGTGGTGGG + Intronic
1079478455 11:20856625-20856647 TATTAGCAAAAGTACATGGAAGG - Intronic
1079614152 11:22470001-22470023 TATTTACAAAAACAGGTGAAAGG + Intergenic
1079874720 11:25842505-25842527 TATTTTCAAAAACAGGTGGCAGG + Intergenic
1079911957 11:26321307-26321329 TCTCAGCAAATCCAGGTGGTTGG - Intronic
1080208075 11:29754383-29754405 AAAGAGCAAAACCAGGTGCATGG + Intergenic
1080445373 11:32333335-32333357 TCTTATTAAAACCAGGTGCACGG + Intergenic
1081186788 11:40052762-40052784 CATTAGCAAAACAACTTGGATGG - Intergenic
1081828410 11:46081766-46081788 TATTTGCAAAAACAGGTGGTGGG - Intronic
1085833629 11:79929576-79929598 TATTTCCAAAATCAGGTGGCGGG + Intergenic
1087115152 11:94516782-94516804 TATAGGCAAAACCAGGAGAAAGG + Intergenic
1088579678 11:111302328-111302350 AATTAACAAAACCAGGTACAAGG + Intronic
1089425899 11:118374488-118374510 TATTTACAAAAACAGGTGGCAGG - Intronic
1089951411 11:122531220-122531242 TATTTACAAAAACAGGTGGCAGG + Intergenic
1092585971 12:9901636-9901658 TATTAGAAAAGCCAGGTGCCAGG + Intronic
1093639953 12:21514583-21514605 TATTATCACAAACAGGTGGCTGG - Intronic
1097631286 12:62066351-62066373 TGTTAGCACAACTGGGTGGATGG - Intronic
1097702896 12:62838581-62838603 CATCAGCAAATCCAGCTGGATGG + Intronic
1098135925 12:67401679-67401701 TATTGACAAAAACAGGTGGCAGG - Intergenic
1098909530 12:76194931-76194953 TATTTACAAAAGCAGGTGGTAGG + Intergenic
1098924082 12:76329787-76329809 TATTAGCAATAATAGGTGGCAGG - Intergenic
1099648354 12:85390541-85390563 TATTTGCAAAAACAGATGGTGGG + Intergenic
1099680819 12:85825467-85825489 TATTTACAAAAACAGGTGGTGGG - Intronic
1100665317 12:96745923-96745945 TATTTTCAATCCCAGGTGGATGG + Intronic
1101936873 12:109065328-109065350 TATTGACAAAAACAGGTGGTGGG - Intronic
1102630473 12:114274402-114274424 TATTTACAAAAACAGGTGGCAGG + Intergenic
1102818894 12:115891353-115891375 TATTTTCAAAAACAGGTGGCAGG + Intergenic
1102825419 12:115944325-115944347 TATTCACAAAAACAGGTGGCGGG + Intergenic
1102872133 12:116422318-116422340 TATTAACAAAAACAAGTGGTGGG + Intergenic
1102965759 12:117124344-117124366 TTTTAGAAAAACCAGGTAGGAGG + Intergenic
1103045171 12:117730147-117730169 TATTTACAAAAACAGGTGGTGGG + Intronic
1103058339 12:117839005-117839027 TATTTACAAAAGCAGGTGGAGGG + Intronic
1103115563 12:118327156-118327178 TATTATTAAAACCAGATGCAGGG - Intronic
1103873888 12:124112292-124112314 TATTTACAAAAACAGGTGGAGGG - Intronic
1103922497 12:124406237-124406259 TATTTACAAAAGCAGGTGGTGGG + Intronic
1108290087 13:48950672-48950694 TTTAAGCAAAACAAGGTGAAAGG + Intergenic
1108629102 13:52263578-52263600 TATTCCCAAACTCAGGTGGAAGG - Intergenic
1108656954 13:52542898-52542920 TATTCCCAAACTCAGGTGGAAGG + Intergenic
1109807460 13:67462289-67462311 TATTTACAAAAACAGGTGGTGGG + Intergenic
1113303948 13:109056012-109056034 TATTTACAAAAACAGGTGGTAGG - Intronic
1114778214 14:25510490-25510512 GATTTGCAGAACCAGTTGGAAGG - Intergenic
1115289943 14:31758965-31758987 TTTTACCATAGCCAGGTGGACGG + Intronic
1118831385 14:69436729-69436751 TGTTTGCAAAACAATGTGGAAGG - Intronic
1120520114 14:85517484-85517506 TATTTACAAAACAAGGTGGGTGG - Intergenic
1120574633 14:86167303-86167325 AATTAGCAAAACCAGATTGATGG - Intergenic
1121276228 14:92669730-92669752 TATTTGCAAAATCAGGTGGTAGG - Intronic
1121591935 14:95121542-95121564 TATTAGGAAAAAAAGGGGGAGGG + Intronic
1121662386 14:95645192-95645214 TATTTGCAAAAACAGGTGGTGGG - Intergenic
1122429916 14:101634055-101634077 TATTAGCAAATCCATGAGGCAGG - Intergenic
1125284652 15:38079369-38079391 TATTTACAAAAACAGGTGGAAGG - Intergenic
1126576489 15:50202172-50202194 TATTTACAAAAACAGGTGGGAGG - Intronic
1127929914 15:63587728-63587750 TATTTACAAAACCAGGTGGCTGG + Intronic
1128928991 15:71686851-71686873 TATTTACAAAAGCAGGTGGCAGG + Intronic
1129173698 15:73823916-73823938 TATTTACAAAAACAGGTGGCAGG - Intergenic
1129979143 15:79850532-79850554 TATTTACAAAAACAGGTGGAGGG + Intronic
1130918833 15:88327103-88327125 TATTTACAAAAACAAGTGGAAGG - Intergenic
1131883102 15:96879535-96879557 TATTTACAAAAACAGGTAGAAGG - Intergenic
1132223385 15:100122244-100122266 TATTAGCTATAACAGGTGGTTGG - Intronic
1132327520 15:100984234-100984256 TATAGGGAAAACCATGTGGAGGG - Intronic
1133984920 16:10661164-10661186 TATTTACAAAAACAGGCGGAGGG + Intronic
1134296565 16:12951508-12951530 TATTTGCAAAAACAGGTGTTGGG + Intronic
1134349080 16:13419807-13419829 TATTTACAAAGCCAGGTGGCAGG + Intergenic
1134824110 16:17270738-17270760 TATTGACAAAAGCAGGTGGTAGG - Intronic
1134826566 16:17289234-17289256 TATTTCTAAAAACAGGTGGAGGG + Intronic
1135121936 16:19773680-19773702 TATTCACAAAAACAGGTGGTGGG + Intronic
1135815247 16:25626740-25626762 TATTTACAAAAACAGGTGGCAGG + Intergenic
1137361157 16:47816723-47816745 TATTTACAAAAACAGGTGGCAGG + Intergenic
1138306286 16:55978814-55978836 TAGTAGCAAAATCAGGTGAGAGG - Intergenic
1139471680 16:67181256-67181278 TATGGGTAAAGCCAGGTGGATGG - Intronic
1141436004 16:84000196-84000218 TTTAAACAAAACCAGGTGGCTGG - Intronic
1142495969 17:306461-306483 GATTAGCAAAACCACCTGGGAGG - Intronic
1144733639 17:17542773-17542795 GATGAGCAAACCCAGGTTGAGGG + Intronic
1144816003 17:18035744-18035766 TATTTACAAAAACAGGTGGCAGG + Intronic
1146147380 17:30432213-30432235 TATTTACAAAAACAGGTGGTGGG - Intronic
1146495934 17:33322293-33322315 CAGTAGCAAAGCCAGTTGGAAGG + Intronic
1146602377 17:34229028-34229050 TTTAAGCAAAACTTGGTGGACGG - Intergenic
1146640818 17:34540090-34540112 TATTGACAAAAACAGGTGGCAGG + Intergenic
1147417524 17:40304103-40304125 TATTTCCAAAACCAGGGGAAAGG - Exonic
1147547200 17:41411259-41411281 TATTTGCAAAAGCAGGTGGTGGG + Intergenic
1149007072 17:51817238-51817260 TATTTACAAAAACATGTGGATGG - Intronic
1149287969 17:55187166-55187188 TCTCTGCAAAACCAGTTGGAGGG - Intergenic
1150107586 17:62473705-62473727 TATTTGCAAAAACAGGTTGCTGG - Intronic
1150136510 17:62698363-62698385 AATTAGCCAAGCCTGGTGGAGGG - Intergenic
1150192745 17:63260415-63260437 TATTAACAAAAACAGGTAGCAGG + Intronic
1152853666 17:82651467-82651489 TATAAAGAAAACCAGGAGGATGG + Intergenic
1153740408 18:8120167-8120189 TATTTGCAAAAGCAGGTGGTAGG + Intronic
1154229326 18:12540220-12540242 GATTACCAAAACAAAGTGGAAGG - Intronic
1156092753 18:33491269-33491291 TATTATCACAACCAGGAGAATGG - Intergenic
1156848627 18:41699778-41699800 CATAAAGAAAACCAGGTGGATGG + Intergenic
1158614259 18:58971439-58971461 TATTTACAAAAACAGGTGGCAGG - Intronic
1158807606 18:60993714-60993736 TTTTAGGAAAAACAGGTGAAAGG + Intergenic
1159035007 18:63268309-63268331 TCTTAGTAAAACCATGTGGTAGG - Intronic
1161202396 19:3022949-3022971 TATTTGCAAAAACAAGTGGAGGG + Intronic
1161235792 19:3197408-3197430 TATTTACAAAAGCAGGTAGAGGG - Intronic
1161597019 19:5155762-5155784 TATTGACAAAAACAGGTGGCGGG - Intergenic
1161883701 19:6976356-6976378 TATTTACAAAAGCAGGTGGCAGG - Intergenic
1162991553 19:14305939-14305961 TATTTACAAAAACAGGTGGTGGG - Intergenic
1163411843 19:17159766-17159788 TATTAGCAAAACCAGGTGGAGGG - Intronic
1163472173 19:17504100-17504122 TATTTACAAAAACAGGTGGAGGG + Intronic
1164956167 19:32387793-32387815 TATTTGCCAAAACAGGTGGCAGG - Intergenic
1166540357 19:43601148-43601170 TATTTGCAAAACCAGGCAGCAGG - Exonic
1167355643 19:49002362-49002384 TATTTGCAAAAACAGGTGGCTGG + Intronic
1167565198 19:50251893-50251915 TATTTGCAAAAAGAGGTGGCAGG + Intronic
1167954324 19:53051936-53051958 TATTAGCCAAACGTGGTGGCGGG + Intergenic
925363868 2:3297731-3297753 TATTCACAAAACCAGGTAGTGGG + Intronic
925639114 2:5970584-5970606 TATTAGCAAAACTGAGTGGAAGG + Intergenic
925671626 2:6316006-6316028 TATTTACAAAAACAGGTAGAGGG + Intergenic
926684598 2:15689392-15689414 TCTCAGCAATACCAGGTGGTAGG + Intergenic
927173505 2:20389653-20389675 TATTTACAAAACTAGGTGGTGGG + Intergenic
928223859 2:29430555-29430577 TATTTATAAAACCAGGTGGCTGG + Intronic
928224215 2:29433670-29433692 AATTTACAAAACCAGGTGGCTGG + Intronic
928540121 2:32276898-32276920 TATTAGCCAAACATGGTGGCAGG + Intergenic
929063193 2:37944455-37944477 TATTTACAAAAACAGGTGGCTGG + Intronic
929413635 2:41725214-41725236 TATTTACAAAAACAGGTGGTGGG - Intergenic
929849387 2:45570019-45570041 TATTCACAAAAACAGGTGGCAGG - Intronic
932858427 2:75263469-75263491 TATTTGCAAAAACAGGTGGCAGG - Intergenic
932923708 2:75945543-75945565 TATTTATAAAACCAGGTGGCAGG + Intergenic
933147643 2:78874537-78874559 TATTTGCAAAATCAGGTAGTGGG + Intergenic
933150122 2:78904337-78904359 TATTTACAAAAGCAGGTGGTAGG - Intergenic
933627563 2:84618952-84618974 TATTTACAAAAACAGGTGGTGGG + Intronic
934535988 2:95133935-95133957 CATTAGGAAAACTAGGTGAAGGG + Intronic
936933787 2:117818292-117818314 TATTTACAAAAACAGGTAGAAGG - Intronic
938045428 2:128114747-128114769 TAGAAGCAAAACCAGATGAATGG - Intronic
938606647 2:132900384-132900406 TATTATCAAAACTAGGTGAAGGG - Intronic
939288984 2:140168932-140168954 TATTAGCCAAACGTGGTGGCGGG + Intergenic
939827057 2:147027630-147027652 TATAAGCAAAAACAGCTGCATGG - Intergenic
940162971 2:150733561-150733583 TATTGTCAAAACCAGGAGCAAGG + Intergenic
942624186 2:177881691-177881713 TATTAATAAAAACAGGTGGTAGG - Intronic
943059946 2:183031881-183031903 TACTAGCAAAACCAGCTCCATGG - Intronic
946041825 2:216789308-216789330 TATTTACAAAAACAGGTGGTGGG + Intergenic
947143306 2:227040232-227040254 AATGAGCAAAGGCAGGTGGAAGG + Intronic
948990800 2:241552955-241552977 TTTTTGCAAAACCAGGCAGAGGG - Intergenic
1169776163 20:9255827-9255849 TATTTGCAAAAATAGGTGGCAGG + Intronic
1170415172 20:16132079-16132101 TATTTACAAAATCAGGTGGTAGG - Intergenic
1170819621 20:19745295-19745317 TATTGACAAAAACAGGTGGCAGG + Intergenic
1170992733 20:21319830-21319852 TAATAGCAAAAAGGGGTGGATGG - Intronic
1171058777 20:21934950-21934972 TATTAGCAAAAAGATGTGGGAGG - Intergenic
1173408351 20:42786975-42786997 TATGTGCAAAAACAGGTGGTGGG - Intronic
1173899425 20:46576312-46576334 TATTTACAAAAGCAGGTGGTGGG + Intronic
1173955580 20:47030084-47030106 TATTTACAAAAGCAGGTGGTGGG + Intronic
1174307681 20:49626005-49626027 TATTTACAAAAACAGGTGGGTGG - Intergenic
1174409397 20:50324108-50324130 TATTTACAAAAACAGGTGGTGGG + Intergenic
1174529300 20:51198437-51198459 TATTTGCAAAATCAGGTAGTAGG + Intergenic
1175095261 20:56536007-56536029 TATTTACAAAAACAGGTGGAGGG + Intronic
1178269951 21:31180463-31180485 TATTTACAAAAACAGGTGGTGGG + Intronic
1179938103 21:44617770-44617792 TGTCTGCAACACCAGGTGGATGG + Intronic
1179987464 21:44929667-44929689 TATTGACAAAAACAGGTGGAGGG + Intronic
1180885879 22:19242920-19242942 TCTTAGCAAAACCGTGTGGTTGG - Exonic
1181754676 22:25015316-25015338 TATTTGCAAAACCAGGCAGTGGG + Intronic
1182677593 22:32051892-32051914 TATTTGCAAAAATAGGTGGAGGG + Intronic
1182742549 22:32578954-32578976 TATTAACAAAATCAGGTTGTGGG + Intronic
1183204368 22:36408503-36408525 AATTAGCCAAACCTGGTGGCAGG - Intergenic
1184422058 22:44387752-44387774 GATGAGCAAGATCAGGTGGAGGG + Intergenic
951041417 3:17992608-17992630 TATTAACAAAACAAGGTGGTGGG + Intronic
951142936 3:19188463-19188485 TATTAACAAAAACATGTGGTGGG + Intronic
951345695 3:21544871-21544893 TATTCGCAAAGCCAGGTGCCAGG - Intronic
951409161 3:22341283-22341305 TATTTACAAAAGCAGGTGGCAGG - Intronic
952027787 3:29104028-29104050 TATTTACAAAAACAGGTGGCAGG + Intergenic
952037388 3:29219443-29219465 TATTTGCAAAAACAGGTGGCAGG + Intergenic
952337076 3:32413052-32413074 TATTTACAAAAACAGGTGGCAGG - Intronic
955486279 3:59438060-59438082 TATTTACAAAAGCAGGTGGCAGG - Intergenic
955887037 3:63611398-63611420 TATTACCAAAAGCAGGGGAAAGG + Intronic
957321994 3:78643297-78643319 TATTTACAAAAACAGGTGGCAGG + Intronic
957801792 3:85093932-85093954 AATTAGCAAAGCTAGGTGGGAGG + Intronic
959254908 3:103996913-103996935 TAGTAGCAAAACCAAAAGGATGG - Intergenic
959643124 3:108664181-108664203 TATTAGCAATTCCAGGTTGAAGG - Intronic
959823971 3:110770858-110770880 TATGAGCAAAACCAGTCAGATGG - Intergenic
961435603 3:126914396-126914418 TATTCACAAAAACAGGTGGCAGG + Intronic
962101559 3:132347988-132348010 TATTTACAAAACCAGGTAGTGGG - Intronic
962425957 3:135269687-135269709 TATTGATAAAAACAGGTGGAGGG + Intergenic
963940807 3:151094422-151094444 TCTGAGAAAAACCAGGTGGAGGG + Intronic
968248006 3:197174102-197174124 TATTTACAAAAACAGGTGGCAGG + Intronic
968526000 4:1057506-1057528 TATTTACAAAAACAGGTGGCAGG - Intronic
969640037 4:8392211-8392233 TATTTGCAAAAACAGGTGGCAGG + Intronic
971282578 4:25253096-25253118 TAATAGCCAAACACGGTGGAAGG + Intronic
971454491 4:26831488-26831510 CATTTGCAAAACCAGGTGGAAGG + Intergenic
971497853 4:27286835-27286857 TATTTACAAAAACAGGTGGTGGG + Intergenic
971552200 4:27971663-27971685 TTCTAGCAAAACCAGCTGGTGGG + Intergenic
972052929 4:34763657-34763679 TATTTGCAAAAACATGTGTAAGG - Intergenic
972336508 4:38111672-38111694 TAGTAGGAAAAGCAGGGGGAGGG + Intronic
973582757 4:52360355-52360377 TATTTACAAAGCCAGGTGGCAGG - Intergenic
973990357 4:56399906-56399928 TATTTTCATAACCAGGTAGATGG - Intronic
974164796 4:58187679-58187701 TATTAACAAAAGAATGTGGAAGG - Intergenic
979407582 4:120332138-120332160 TATTCACAAAAACAGGTGGCAGG + Intergenic
982456229 4:155612130-155612152 TATTAGGAAGACCAGTTAGAAGG - Intergenic
983280266 4:165671987-165672009 TATTGACAAAATCAAGTGGAGGG - Intergenic
983438559 4:167750213-167750235 TAATGGCAAAACCAGATGGGGGG - Intergenic
984834149 4:184003609-184003631 TATTTACAAAAACAGGTGGTGGG - Intronic
986589324 5:9352764-9352786 TATTAACAAAAACAGGTGATGGG - Intronic
986627199 5:9733228-9733250 TATTCACAAAAACAGATGGAAGG - Intergenic
986891010 5:12305622-12305644 TATTATGAAAACCATGTGGAGGG + Intergenic
987308668 5:16661925-16661947 TATTCACAAAAACAGGTGGCAGG + Intronic
987812417 5:22855119-22855141 TATTTACAAAAGCAGGTGGCTGG - Intergenic
988920071 5:35932967-35932989 TATTTACAAAACCAGGTGGAGGG - Intronic
991149525 5:63350403-63350425 TATTAGCAAAATCAGGATAAAGG - Intergenic
992035636 5:72772531-72772553 TATTTACAAAAACAGGTGGCAGG + Intergenic
992243911 5:74797968-74797990 TATTCACAAAACCAGGTGGCAGG + Intronic
993971118 5:94421253-94421275 TATTTACAAAAACAGGTGGCGGG + Intronic
994047130 5:95322738-95322760 TATTTACAAAAACAGGTGGTGGG - Intergenic
995344272 5:111093440-111093462 TATTAGCAAAAAGAGCTGGGAGG + Intronic
995384163 5:111570262-111570284 TATTTACAAAAACAGGTTGAGGG + Intergenic
995544465 5:113216058-113216080 TATTCACAAAAACAGGTAGAAGG - Intronic
995753793 5:115480301-115480323 TAGTAGCAGAAGCAGGAGGAAGG - Intergenic
997025668 5:130058204-130058226 TATTATCAAATCTAGGTGCAAGG + Intronic
998196881 5:140081247-140081269 TATTTGCAAAAACAGGTGGCAGG + Intergenic
998566221 5:143218064-143218086 TATTTACAAAAACAGGTGGCGGG - Intronic
998874853 5:146588916-146588938 GGTTACCAAAACCAGGAGGAGGG + Intronic
1000697745 5:164409713-164409735 TATTAGCATAACTAGGCGCATGG + Intergenic
1001200305 5:169709987-169710009 TTTTAGCCAAAGCAGGTGGGAGG + Intronic
1001235407 5:170025267-170025289 TATTTACAAAAGCAGGTGGAAGG - Intronic
1002086352 5:176778070-176778092 TATTTGTAAAAACAGGTGGTAGG - Intergenic
1002415332 5:179117499-179117521 TATTTACAAAACCAGGTGGAGGG - Intronic
1002429847 5:179196902-179196924 TATTTACAAAAACAGGTGAAGGG + Intronic
1003194778 6:3904764-3904786 GATTACCAAAACCCGCTGGAAGG - Intergenic
1004470114 6:15921498-15921520 TATTTACAAAAACAGATGGAGGG + Intergenic
1005197852 6:23309941-23309963 TATCTGCAAAACCAGGGGGATGG + Intergenic
1007059729 6:38926762-38926784 TATAAGCAAAAACATGGGGACGG - Intronic
1008438894 6:51509757-51509779 TATTTGCAAAAATAGGTGGTAGG + Intergenic
1009938202 6:70258367-70258389 AATCAAGAAAACCAGGTGGACGG + Intronic
1010024447 6:71199396-71199418 AAATAGCAAAACCAGGAGGCAGG + Intergenic
1010776762 6:79895670-79895692 TATTACCAAAAACAGGAGGGTGG + Intergenic
1011097676 6:83684131-83684153 TATTGGGAAACCCAGGTTGAAGG - Intronic
1011207671 6:84917769-84917791 TATTTACAAAAACAGGTGGTAGG - Intergenic
1011540881 6:88427171-88427193 GCTTAGCAAAACAATGTGGATGG - Intergenic
1011929224 6:92689389-92689411 TAATAGGAAAACTAGGAGGAGGG - Intergenic
1012034945 6:94123598-94123620 TTTTAGCAAAACCAGGTATTTGG - Intergenic
1015309287 6:131748220-131748242 TATTTACAAAAACAAGTGGAGGG + Intergenic
1016879419 6:148896308-148896330 GAAGAGGAAAACCAGGTGGATGG - Intronic
1017756741 6:157535549-157535571 TATGAGCAAAGCAAGCTGGAAGG - Intronic
1019101372 6:169633257-169633279 TGTTGGCAAGAGCAGGTGGACGG + Intronic
1020896626 7:13948557-13948579 CATTTACAAAAACAGGTGGAAGG - Intronic
1021695889 7:23276101-23276123 TATTTACAAAAACAGGTGGTAGG + Intergenic
1021797537 7:24272176-24272198 TATTTACAAAAACAGGTGGTAGG + Intergenic
1021815010 7:24438352-24438374 TGTTTGCAAAAACAGGTGGAAGG + Intergenic
1021922027 7:25495160-25495182 TTTTGGCAAAAGCAGGAGGAAGG + Intergenic
1022182137 7:27931283-27931305 TATTTACAAAAACAGGTGGAGGG + Intronic
1022380116 7:29851690-29851712 TATTGGCAAGACCAGCTGCATGG + Intronic
1022455819 7:30557413-30557435 TATTTGCAAAAACAGGTGGTGGG - Intergenic
1023246958 7:38215373-38215395 TATTTGCAAAATGAGGTAGAGGG - Intronic
1024162284 7:46688952-46688974 TATTAGGAAATCCAAGTGAAAGG + Exonic
1024937834 7:54729624-54729646 TATTTACAAAACCAGGTGATGGG + Intergenic
1024977791 7:55129939-55129961 TATTTGCAAAAACAGGTGGCAGG - Intronic
1025970922 7:66324648-66324670 AATTAGCCAAACCTGGTGGTGGG + Intronic
1027362689 7:77425768-77425790 CATTATCAAAACCGGCTGGAGGG - Intergenic
1027438118 7:78188356-78188378 TATTAGAAAATCCAGCTGAAAGG + Intronic
1028288724 7:89038677-89038699 TAAAAGCAAAACTAGGTGAATGG - Intronic
1028552742 7:92088848-92088870 TATTATCAAAACCAGGAAAATGG - Intronic
1030525100 7:110643229-110643251 TATTTACAAAAACAGGTGGTGGG - Intergenic
1032036637 7:128526261-128526283 TATTTGCAAAAACAGGTTGCTGG - Intergenic
1033668279 7:143464524-143464546 AATTCTCAAAACCAGATGGAGGG + Intergenic
1033783933 7:144706968-144706990 TACTAGCGAAAGCAGGTGGAGGG + Intronic
1033932900 7:146546349-146546371 TATTAGCAAGAGCTGTTGGATGG + Intronic
1034123806 7:148652942-148652964 TATTTACAAAAGCAGGTGGTGGG - Intergenic
1034247383 7:149657364-149657386 TATTTACAAATCCAGGTAGAAGG + Intergenic
1034526146 7:151664041-151664063 TAATCACAAAACCAGGTGGTGGG + Intronic
1035634322 8:1132359-1132381 GACTAGCAAAACCAGCTGGTAGG + Intergenic
1038238055 8:25781118-25781140 TATTAGCAAAACCAAGAAGGAGG - Intergenic
1039419558 8:37424730-37424752 TATTTACAAAAACAGGTGGCAGG + Intergenic
1040520709 8:48173655-48173677 TATGAGTAAAGGCAGGTGGATGG - Intergenic
1041407732 8:57518711-57518733 TATTAGGAAAACCAAAAGGAAGG + Intergenic
1041718699 8:60956501-60956523 TATTTACAAAAACAGGTGGTTGG + Intergenic
1044501306 8:92961602-92961624 TATTACCTATAGCAGGTGGAAGG - Intronic
1045178402 8:99752392-99752414 TATTTACAAAAACAGGTGGTGGG - Intronic
1045751338 8:105487632-105487654 TATTTACAAAAGCAGATGGAGGG + Intronic
1046048717 8:108994525-108994547 TGTTAGAAAAACAAGATGGAAGG + Intergenic
1046800466 8:118420891-118420913 TATTTACAAAAACAGGTGGCAGG - Intronic
1046868268 8:119174942-119174964 TATTAGAAAAAACAAGTGGGAGG + Intronic
1047178403 8:122564216-122564238 TATTTGCAAAAACAAGTGGTGGG - Intergenic
1047289616 8:123518073-123518095 TATTTACAAAAGCAGGTGGAGGG + Intronic
1047676780 8:127211226-127211248 TATTTACAAAAACAGGTGGCAGG + Intergenic
1047805018 8:128350497-128350519 TATTTACAAAATCAGGTGGCAGG - Intergenic
1048574798 8:135682077-135682099 CATTGACAAAAACAGGTGGAGGG + Intergenic
1050710793 9:8460693-8460715 TATTAGCAAAACAGAGGGGAGGG + Intronic
1051632821 9:19156123-19156145 TATTTGCAAAAGCAGGTGGCAGG - Intergenic
1052881810 9:33605249-33605271 TACTAGCAAAACCCTGCGGAGGG - Intergenic
1053191848 9:36078122-36078144 TATTTCCAAAAACAGGTGGCAGG + Intronic
1053494504 9:38540589-38540611 TACTAGCAAAACCCTGCGGAGGG + Exonic
1055267543 9:74514455-74514477 TATTTACAAAAACAGGTGGCAGG + Intronic
1055582915 9:77727024-77727046 TATTCATAAAACCAGGTGGTGGG + Intronic
1056004231 9:82250207-82250229 TATTCACAAAAACAGGTGGCAGG - Intergenic
1057062941 9:92021561-92021583 GATTGACAAAACCAGCTGGAGGG - Intergenic
1058463140 9:105201803-105201825 TATTCACAAAACCAGGTGGCTGG - Intergenic
1058765710 9:108180897-108180919 TATTCACAAAACCTGGTAGAGGG - Intergenic
1058840949 9:108908599-108908621 TCTCAGCAAGACCAGGTGAAGGG + Intronic
1058997799 9:110316955-110316977 TATTTACAAAAACAAGTGGAGGG + Intronic
1059522324 9:114955204-114955226 TATTTACAAAAGCAGGTGGTAGG + Intergenic
1059779487 9:117511235-117511257 TAGTGGCAAAAGCAGGTGAATGG - Intergenic
1062017140 9:134296651-134296673 TCTTTGCAAAACCAGCAGGACGG + Intergenic
1185949286 X:4413172-4413194 TAATAGCAAAATAAGGTGGTGGG + Intergenic
1185971388 X:4668694-4668716 CATTAGGAAAACCTGGTTGAAGG + Intergenic
1186310259 X:8309999-8310021 TATTTACAAAACTAGGTGGTGGG + Intergenic
1186335011 X:8577056-8577078 TATTTGCAAAACCAGGTTGCAGG + Intronic
1186546415 X:10454519-10454541 TATTTACAAAACCAGGTAGCAGG + Intronic
1186893601 X:13984434-13984456 TATTTACAAAATCAGGTGGTAGG - Intergenic
1186953917 X:14659111-14659133 TATTTGCAAAAACAGGTAGTGGG - Intronic
1187042591 X:15612456-15612478 TATTAGTGAAACCAACTGGAGGG - Intergenic
1188010895 X:25054919-25054941 TATTTACAAAAACAGGTGGTGGG + Intergenic
1189050995 X:37645381-37645403 CATCAGGAAAACCAGATGGAAGG + Intronic
1189308381 X:40004254-40004276 TAGTAGCGGAACCAGATGGAAGG + Intergenic
1190284228 X:48951464-48951486 TATTAGCCAGACGAGGTGGCAGG + Intronic
1191998122 X:67118631-67118653 TATTTGCAAAACCAGGCTGTGGG + Intergenic
1192836634 X:74806523-74806545 TATAAGGGAAACCAGGTGCAGGG + Intronic
1193417971 X:81247842-81247864 TATTCCCAAAACAAGGAGGAAGG - Intronic
1195150751 X:102067316-102067338 TATTATCAACACTATGTGGATGG - Intergenic
1195749986 X:108154550-108154572 TATTTACAAAAGCAGGTGGAGGG + Exonic
1195760582 X:108241872-108241894 CATTAGTAAAACCAGGTGATGGG - Intronic
1198184005 X:134236832-134236854 TATTAGCATGACATGGTGGAGGG - Intergenic
1198244019 X:134811780-134811802 TATTTGCAAATCCAGGTGGTGGG - Intronic
1199039821 X:143099487-143099509 TATGTGCAAAACCAGGAAGAGGG - Intergenic
1199145806 X:144365356-144365378 TATTAACAAAAGCAGATGGCTGG - Intergenic
1201736481 Y:17268138-17268160 TAATAGCAAAATAAGGTGGTGGG + Intergenic
1201857445 Y:18560532-18560554 TAAAAGCAAAAACAGGTGGTAGG + Intronic
1201875876 Y:18759848-18759870 TAAAAGCAAAAACAGGTGGTAGG - Intronic