ID: 1163413759

View in Genome Browser
Species Human (GRCh38)
Location 19:17172983-17173005
Sequence CTCGACAGTGACGCTTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163413759_1163413767 22 Left 1163413759 19:17172983-17173005 CCCACAAAAGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1163413767 19:17173028-17173050 TCTTAAAGTGAACACTTCAGTGG 0: 1
1: 6
2: 108
3: 514
4: 1887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163413759 Original CRISPR CTCGACAGTGACGCTTTTGT GGG (reversed) Intronic
912695408 1:111838002-111838024 CTCGACAGTGACGCGTTATGTGG - Intronic
913347831 1:117825796-117825818 CTGGTCAGTGAGGCTTTTGCTGG - Intergenic
919699927 1:200621021-200621043 CATGACAGTGACACTCTTGTCGG + Intergenic
1068961412 10:62870188-62870210 CTCACCAGTGATGCTATTGTTGG - Intronic
1074382564 10:112992388-112992410 CCCGACAGAGAGGCCTTTGTTGG + Intronic
1084677956 11:70647699-70647721 CTCAGCAGTTAAGCTTTTGTTGG + Intronic
1091263239 11:134250482-134250504 CTCCACAGAGACACTTTTGCTGG + Intronic
1091263544 11:134253178-134253200 CTCCACAGAGACACTTTTGTTGG + Exonic
1093396980 12:18694486-18694508 CTCCACAATTAGGCTTTTGTAGG - Intronic
1096474736 12:51901402-51901424 CTGGACAGGGCAGCTTTTGTTGG - Intergenic
1104410613 12:128554656-128554678 CTCGACTGTGCCTCTTTTGGAGG + Intronic
1109440499 13:62365277-62365299 CTACACAGTGAGTCTTTTGTTGG - Intergenic
1110751660 13:79121996-79122018 CTCCAGAGTGAGGCTATTGTGGG + Intergenic
1126341156 15:47642529-47642551 CTAGACAGTGAAGCCTTTGAGGG - Intronic
1142268285 16:89075461-89075483 CTCGCCACTGACGCTCTTGCTGG + Intergenic
1146128956 17:30253419-30253441 CTAGACTGTGAGGTTTTTGTGGG - Intronic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1165380580 19:35476653-35476675 CTCCACAGTGCCGCCATTGTTGG + Intergenic
926381821 2:12298575-12298597 CTCTAGAGTGATGTTTTTGTTGG + Intergenic
940298550 2:152155375-152155397 CTCAGCAGTGAAGCTTTGGTTGG - Intronic
945346567 2:208724778-208724800 CTAGACAATGATGCATTTGTAGG - Intronic
1177121994 21:17149249-17149271 CTCTAGATTGACTCTTTTGTGGG - Intergenic
1180916616 22:19493205-19493227 CTAGACAGAGCAGCTTTTGTGGG + Intronic
955336249 3:58088657-58088679 CTGGACAGGGGAGCTTTTGTTGG - Intronic
967686942 3:192428568-192428590 CTTGACAGTGACTCTTCTCTTGG + Intronic
982458074 4:155634457-155634479 CACGAGAGTGACGCTGTTGCAGG - Intergenic
1025997325 7:66536259-66536281 CTGGACAGTGACGCCTTTGGTGG - Intergenic
1026990189 7:74580736-74580758 CTGGACAGTGACACCTTTGGTGG - Intronic
1042559332 8:70061204-70061226 CTCTGCAGGGATGCTTTTGTAGG - Intronic
1043765102 8:84121085-84121107 CTCGAATGTCAAGCTTTTGTTGG - Intergenic
1046260640 8:111763256-111763278 CTCTACAGTAATGCTTTTTTAGG - Intergenic
1190500342 X:51069978-51070000 ATCTACAGTGAGTCTTTTGTTGG - Intergenic
1191929583 X:66355875-66355897 CTCAACAGTGACACGTTTGAAGG - Intergenic
1192316215 X:70053720-70053742 CTCCACAGCGACGCTGTTGGAGG - Intergenic
1198397459 X:136234775-136234797 CTGGCTAATGACGCTTTTGTTGG + Intronic