ID: 1163413760

View in Genome Browser
Species Human (GRCh38)
Location 19:17172984-17173006
Sequence TCTCGACAGTGACGCTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163413760_1163413767 21 Left 1163413760 19:17172984-17173006 CCACAAAAGCGTCACTGTCGAGA 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1163413767 19:17173028-17173050 TCTTAAAGTGAACACTTCAGTGG 0: 1
1: 6
2: 108
3: 514
4: 1887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163413760 Original CRISPR TCTCGACAGTGACGCTTTTG TGG (reversed) Intronic
904997159 1:34640019-34640041 TCTGGACAGTGCAGGTTTTGGGG - Intergenic
905306636 1:37023720-37023742 TCTGAATAGTGAAGCTTTTGGGG - Intronic
909491125 1:76227426-76227448 TCTAGACAGTGAAGCACTTGAGG + Intronic
920912179 1:210229331-210229353 TCTCTACAGTCACTCTCTTGTGG - Intergenic
924452567 1:244191343-244191365 TCCAGACAATGATGCTTTTGAGG - Intergenic
1066687205 10:37992646-37992668 TTTGGAAAGTGACTCTTTTGGGG - Intergenic
1073059516 10:100724888-100724910 TCATGACAATGACGCTTATGAGG + Intergenic
1078688010 11:13550777-13550799 TCGAGACAGTGATGCTTTTTAGG + Intergenic
1082205763 11:49432086-49432108 TCTCTAGAGTGATGCTTCTGAGG + Intergenic
1086585302 11:88444509-88444531 TCACCCCAGTGACACTTTTGTGG + Intergenic
1088859458 11:113786077-113786099 TCTAGACAATGACAGTTTTGGGG + Intergenic
1089880387 11:121767849-121767871 TCTCTGCAGTGAGGCCTTTGGGG - Intergenic
1091861522 12:3789576-3789598 TCTCAACAGTGGCCCTTTTACGG - Intergenic
1095798357 12:46245822-46245844 TCTCAACAGTGGCCCATTTGGGG - Intronic
1096330283 12:50705952-50705974 TTTATACAGTGATGCTTTTGGGG + Intronic
1105412424 13:20182303-20182325 TGGAGACAGTGACACTTTTGTGG + Intergenic
1105569258 13:21585027-21585049 TCTATACAGTGACTCTTCTGGGG - Intronic
1113399688 13:109979475-109979497 TCGTGACTGTGACACTTTTGAGG - Intergenic
1119201259 14:72754574-72754596 TGTGCACAGTGACACTTTTGTGG - Intronic
1126341157 15:47642530-47642552 ACTAGACAGTGAAGCCTTTGAGG - Intronic
1127659062 15:61083063-61083085 TTTTGAGAGGGACGCTTTTGTGG - Intronic
1131682576 15:94739224-94739246 TCTCTGCAGTAAGGCTTTTGTGG - Intergenic
1140828590 16:78730214-78730236 TCCTGACAGAGACGCTTTTTGGG - Intronic
1143390129 17:6555472-6555494 TCTCGGCAGTGCCTCTTGTGAGG - Intronic
1155347913 18:24876739-24876761 TCTCAACAGTGAGGGATTTGCGG - Intergenic
1162043214 19:7982810-7982832 TCGTGACTGTGACGGTTTTGAGG + Intronic
1163413760 19:17172984-17173006 TCTCGACAGTGACGCTTTTGTGG - Intronic
1168525309 19:57083996-57084018 TCCCGACACTGGCGTTTTTGAGG + Intergenic
926321855 2:11754048-11754070 GCTTGACAGGGACGATTTTGGGG - Intronic
929617714 2:43325198-43325220 TCTAGACACTGGGGCTTTTGTGG - Intronic
936674490 2:114699423-114699445 GCTCCACAGTGAGGCCTTTGGGG + Intronic
942857669 2:180569402-180569424 ACTGTACAGTGAGGCTTTTGAGG - Intergenic
947864402 2:233386248-233386270 TCTTCACAGTGAGGCCTTTGAGG + Intronic
1179287513 21:39990893-39990915 TCTCGACAGTGACGTTTGCAGGG - Intergenic
1180016807 21:45092129-45092151 TCTGGAGAGTGATGCTTTGGAGG + Intronic
1182839556 22:33377053-33377075 ACTGAACAGTGACACTTTTGGGG + Intronic
949621002 3:5811477-5811499 TCTCCACAGGAAAGCTTTTGTGG + Intergenic
967776518 3:193391733-193391755 TCTCAAAGGTGACCCTTTTGGGG - Intergenic
990199489 5:53355205-53355227 TCTCTACAGTGCTGCTATTGTGG + Intergenic
999638417 5:153646546-153646568 TCTCTACAATGACCCTATTGAGG - Intronic
1032668767 7:134064619-134064641 TCTCTACAGTGATACTTTAGTGG + Exonic
1033666683 7:143447212-143447234 TCTCTTCAGTGAAGCTTTTCTGG + Intergenic
1044537058 8:93369526-93369548 TCTCTACAGTGAAGCTATTGGGG - Intergenic
1047674698 8:127187659-127187681 TCATGACAGTGACCCTCTTGGGG + Intergenic
1048449219 8:134517748-134517770 TCATGACCTTGACGCTTTTGAGG + Intronic
1059477139 9:114556529-114556551 TCTCAACAGTGCTGCATTTGGGG - Intergenic
1060735998 9:126066921-126066943 TCTAGACAGCGAGGCATTTGGGG + Intergenic
1194274915 X:91866656-91866678 TCTCTTCAGTGCCTCTTTTGGGG + Intronic
1200592157 Y:5088059-5088081 TCTCTTCAGTGCCTCTTTTGGGG + Intronic