ID: 1163413767

View in Genome Browser
Species Human (GRCh38)
Location 19:17173028-17173050
Sequence TCTTAAAGTGAACACTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2516
Summary {0: 1, 1: 6, 2: 108, 3: 514, 4: 1887}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163413759_1163413767 22 Left 1163413759 19:17172983-17173005 CCCACAAAAGCGTCACTGTCGAG 0: 1
1: 0
2: 0
3: 2
4: 32
Right 1163413767 19:17173028-17173050 TCTTAAAGTGAACACTTCAGTGG 0: 1
1: 6
2: 108
3: 514
4: 1887
1163413760_1163413767 21 Left 1163413760 19:17172984-17173006 CCACAAAAGCGTCACTGTCGAGA 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1163413767 19:17173028-17173050 TCTTAAAGTGAACACTTCAGTGG 0: 1
1: 6
2: 108
3: 514
4: 1887

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163413767 Original CRISPR TCTTAAAGTGAACACTTCAG TGG Intronic
Too many off-targets to display for this crispr