ID: 1163417235

View in Genome Browser
Species Human (GRCh38)
Location 19:17194214-17194236
Sequence GCCTCCTAGAAAAAGACCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163417235 Original CRISPR GCCTCCTAGAAAAAGACCCA AGG Intronic
900542578 1:3211463-3211485 GACTCCTAAGAAAAGACTCAAGG + Intronic
901002554 1:6155778-6155800 GCCTCCTAGGCAGAGACCCTGGG - Intronic
911008916 1:93257901-93257923 GACTCATACAAAAAGAACCAAGG - Intronic
912448995 1:109758230-109758252 GCCTCCTAGAAAAAGAGGGAGGG + Intronic
913555822 1:119966043-119966065 GCCTTCAAGAATATGACCCATGG + Intronic
915606530 1:156955471-156955493 GGTTCCTAGACTAAGACCCAGGG + Intronic
918292482 1:183122285-183122307 CCCTTCTATAAAAAGACCTAGGG + Intronic
918855400 1:189749031-189749053 GCCAACTTGAAAAAGTCCCATGG + Intergenic
920170173 1:204067138-204067160 GCCTCTGAGAAGAAGCCCCACGG + Intergenic
921558149 1:216624073-216624095 AACACCTAGAAAAATACCCAGGG + Intronic
922860064 1:228808958-228808980 GGCTCCTGTAAAAAGATCCAAGG + Intergenic
1065571670 10:27076862-27076884 GCCAACAAGAAAAAAACCCAGGG + Intronic
1066223275 10:33356998-33357020 GGCTCCTAGGAAAATGCCCAGGG - Intergenic
1068523050 10:58098647-58098669 GGCTCCTGGAAAAACAGCCATGG + Intergenic
1069960080 10:72074281-72074303 GCCTCCTGGACAAAGGCCGAAGG + Intronic
1071016763 10:81006488-81006510 TCCACCTAGAAGAAGACTCATGG - Intergenic
1075644248 10:124087180-124087202 GCCTCCTAGCAAAGGTGCCACGG + Intronic
1078326255 11:10383615-10383637 GACTCCTAGAGAGAGACTCACGG - Intronic
1078827646 11:14945505-14945527 GCCTCCAAGAAAAAGATGAAAGG + Intronic
1079309016 11:19348034-19348056 GACTCCTAGAAAAAAACAAAAGG + Intergenic
1082794332 11:57368910-57368932 CCCTCTTAGAAAAATGCCCAGGG - Intronic
1084855203 11:71980058-71980080 GTCTCCTAGAAAATGACACCTGG + Intronic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1088888776 11:114028646-114028668 GCTTCCTAGAAAGGGACTCAAGG - Intergenic
1089319149 11:117613267-117613289 GCACCCCAGAAAAAGACACAAGG + Intronic
1091277516 11:134362519-134362541 CCCTTCTTGAAAAAGCCCCACGG - Intronic
1099458841 12:82898196-82898218 GCCACCTAGGAAAAGTCACATGG - Intronic
1100427876 12:94504044-94504066 GCCTCCTAGAAACTGATCAAGGG - Intergenic
1102189157 12:110973134-110973156 TCCTCCCAGCAAAAGTCCCAGGG - Intergenic
1106453979 13:29910571-29910593 GGCTCCCAGACAAAGAGCCAGGG - Intergenic
1109047973 13:57437837-57437859 TCCACCTAGAAATAGACTCAAGG - Intergenic
1111913291 13:94335348-94335370 GACTCCTGGAAAAAGATCCCAGG - Intronic
1112027648 13:95426406-95426428 GCCTACTTGAAAAAGACCTCAGG + Intergenic
1113293298 13:108929270-108929292 GCCTTCTGGAAAAGGAACCATGG - Intronic
1113462132 13:110489826-110489848 GGCTCCTAGACAAAGGCTCAGGG - Intronic
1113657155 13:112073947-112073969 GCCCCCCAGAAATAGATCCAGGG - Intergenic
1113675165 13:112202119-112202141 GCCGCCGTGAAAGAGACCCAGGG + Intergenic
1113978061 13:114246733-114246755 GTCTCCTTGAGAAAGAGCCATGG + Intronic
1118050233 14:62018609-62018631 GCATTTTAGAAGAAGACCCAAGG - Intronic
1121354575 14:93203172-93203194 GAGTCCTTGAAAGAGACCCAAGG - Exonic
1121999987 14:98639613-98639635 TCCTCCTTGACAAAGATCCAAGG - Intergenic
1122261922 14:100528568-100528590 GCCTCATAGAAAGAAAGCCAAGG - Intronic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1128905815 15:71466726-71466748 GCCTCCTAGAAAGACAGCCCTGG - Intronic
1129049843 15:72771643-72771665 GCTTCCTAACAAAAGACCCAGGG + Intronic
1130758627 15:86794090-86794112 CACTCCTAGAAATATACCCAAGG + Intronic
1130893101 15:88150042-88150064 GCCTCCCTGAACAAAACCCATGG + Intronic
1137674594 16:50298051-50298073 GACTCATAGGAAAAGGCCCAGGG - Intronic
1138436089 16:57000868-57000890 GCCTCCCAGAAAGAGACCAGTGG + Intronic
1138798012 16:59993390-59993412 GCCTCCTGGAAACAGACTCCAGG - Intergenic
1141907868 16:87039618-87039640 GCCTCCAATAATAAGACCCACGG + Intergenic
1143879656 17:10020182-10020204 GCCCCCTAGAAAATCACTCACGG + Intronic
1145758143 17:27407942-27407964 GCCTTCTAGAACAAGACAGAGGG + Intergenic
1148805736 17:50263148-50263170 ACCTCCCAGGAACAGACCCAGGG + Intergenic
1150027060 17:61687857-61687879 GCCTCCCAGAAAAAGACATAAGG - Intronic
1151059464 17:71074506-71074528 GCTTCCTAGAAAAAGAAGCGTGG + Intergenic
1159638091 18:70830308-70830330 TTCTCAAAGAAAAAGACCCAGGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1160087931 18:75796650-75796672 GCCCCCTAGAAATAGATGCATGG - Intergenic
1160557799 18:79737341-79737363 GCATCCAAGGAAAAGACACAGGG - Intronic
1162128438 19:8511616-8511638 GCCGTCTGGAAAAAGAGCCAAGG - Exonic
1162722920 19:12673080-12673102 GGCTCCTGGACAAAGACACAGGG + Exonic
1163417235 19:17194214-17194236 GCCTCCTAGAAAAAGACCCAAGG + Intronic
1164052539 19:21595503-21595525 ACCTCCTAAAAAAAGAGCCCAGG - Intergenic
1166341493 19:42140162-42140184 GCCTCATTGAGGAAGACCCAGGG - Intronic
1166647901 19:44546115-44546137 GCCTCCCAGAAAAAGCCACAGGG - Intergenic
926851107 2:17198294-17198316 GCTTCCTTGAAAATTACCCAAGG + Intergenic
934713453 2:96529975-96529997 GACTCCTAGAAGAGGACACAGGG - Intergenic
936059304 2:109283976-109283998 CTCTCCTGGAAAAACACCCACGG - Intronic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
937469289 2:122161471-122161493 GCCACTTAGAAAAAAACACATGG - Intergenic
938681771 2:133699465-133699487 GCTTCATAGAACAAGACCCCTGG - Intergenic
940881209 2:158948653-158948675 ACTTCCTAGAAAAAGACCACTGG + Intergenic
943164145 2:184296053-184296075 GCCCCCTAGAAAAAGTTCCTAGG + Intergenic
948659179 2:239496610-239496632 TCCTCCTAGGAAAAGGCTCACGG + Intergenic
1169976383 20:11333339-11333361 GCATCCTAGAAAACCTCCCAAGG + Intergenic
1172870659 20:38133591-38133613 GCCTCCTACAAACAGACCCCAGG - Intronic
1175705196 20:61171588-61171610 TCTTTCTAGAAAAAGCCCCATGG - Intergenic
1176636749 21:9252176-9252198 ACCACCAAGAAAAAAACCCAGGG - Intergenic
1183476964 22:38041050-38041072 GCCTCCTGGAAAATAACACAGGG - Intronic
1184243514 22:43223705-43223727 GACTCCTAGGAAAAGACGGACGG + Intronic
954855069 3:53637168-53637190 GCCTCAGAGAAAAAGATCCTTGG - Intronic
954940823 3:54371216-54371238 GACTCCTAGATACACACCCAAGG - Intronic
955461658 3:59189869-59189891 ACCTCCTGGAAACAGACTCAGGG - Intergenic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
956031352 3:65041075-65041097 TCCGCCTGGAAAAAGACCTAGGG - Intergenic
956577150 3:70764557-70764579 GCCTCATTGAAAGAGACCCACGG - Intergenic
956727677 3:72169941-72169963 GCCTCTAAGACCAAGACCCACGG + Intergenic
962329192 3:134462853-134462875 GACTCCAAGACATAGACCCATGG + Intergenic
962955392 3:140261539-140261561 GTCTCCAATAAAAAGAACCAGGG - Intronic
966901516 3:184490083-184490105 GCCTCCCAGCCAAAGACCCTTGG - Intronic
1202750146 3_GL000221v1_random:152843-152865 ACCACCAAGAAAAAAACCCAGGG + Intergenic
971143331 4:23948529-23948551 GCCTCCTAGAGAGAAACCAAAGG - Intergenic
973828065 4:54729258-54729280 GCCTCCCATAAAAATACCCAAGG - Intronic
981268670 4:142818373-142818395 GCCTCTGAGAGAAAAACCCATGG - Intronic
986276688 5:6281396-6281418 GCCTTCTGGAAAAGGACCTAAGG - Intergenic
988786597 5:34570937-34570959 GCCTCTTCTTAAAAGACCCATGG + Intergenic
989269140 5:39511267-39511289 GCCACATACAAAAAGTCCCAGGG - Intergenic
994539367 5:101075488-101075510 GCCTTGTCCAAAAAGACCCATGG + Intergenic
994681176 5:102889298-102889320 GCCTACCAGAAAAGGAACCAAGG - Intronic
995022310 5:107380572-107380594 GCCTCCTAGAAAAAAAAAAAAGG + Exonic
995043048 5:107610784-107610806 GGCTGCTAGAAAAAGTGCCAGGG - Intronic
999982217 5:156968441-156968463 TCCTCCCATAAAAAGAACCAGGG + Intergenic
1008206279 6:48662289-48662311 TCCTCCAACAAAAAGAACCAGGG - Intergenic
1008407838 6:51138990-51139012 GCCTCCTCAAAAAAGAGCCAAGG + Intergenic
1010292896 6:74160166-74160188 AAATCCTAGAAGAAGACCCAGGG + Intergenic
1010679290 6:78781087-78781109 GCCACCTGGAAACAGACTCAGGG + Intergenic
1010784933 6:79990112-79990134 GGATCTTAGAAAAAGATCCAAGG - Intergenic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1012812955 6:103984162-103984184 GACACCTGGAAAAAGAACCATGG + Intergenic
1016337137 6:143018955-143018977 GCCACCTGGAGAAAAACCCAAGG - Intergenic
1020924385 7:14306651-14306673 GCCTCTTAAAAGAAAACCCATGG - Intronic
1023367760 7:39481125-39481147 GACTACTAGGAAAAAACCCATGG + Intronic
1032270557 7:130400808-130400830 GACTCTTAGAAAAATGCCCATGG - Exonic
1033712483 7:143962535-143962557 GCTTCCTATAAAAGGACCCTTGG + Intergenic
1035081187 7:156217646-156217668 GCCTCCTGGAGAGGGACCCAAGG + Intergenic
1035114878 7:156516206-156516228 TCTTCATAGAAAAAGCCCCATGG - Intergenic
1038134106 8:24767247-24767269 GCCTTCAAGAAAAAGAAACAAGG + Intergenic
1042770773 8:72379456-72379478 GCATCCTAGAAGAAAAACCAAGG + Intergenic
1043546738 8:81323995-81324017 GCCACTTAGAAAGAGCCCCAGGG + Intergenic
1046270228 8:111886211-111886233 GCCTCATTGAAAAAGATTCAGGG - Intergenic
1048544680 8:135375809-135375831 CCCTCCTGGTAAAAGAACCAGGG - Intergenic
1048857446 8:138696877-138696899 TCCTCCTAGAAAACTACCCATGG + Intronic
1049582072 8:143417319-143417341 GCCTCCTCCAAGAAGACCCCAGG - Intergenic
1049745652 8:144262192-144262214 GCCCCCGAGGAGAAGACCCACGG + Exonic
1051823797 9:21196803-21196825 GCCTCAGAGAAAAAGATCCTTGG - Intergenic
1051922595 9:22285384-22285406 GCCAGCAAGAGAAAGACCCAAGG - Intergenic
1053093510 9:35302816-35302838 ACTTCCAAGAAAAATACCCAAGG + Intronic
1055154232 9:73040806-73040828 TTCTCCTAGAAAAAGAACCTAGG - Intronic
1056233193 9:84567606-84567628 CACTCCTAGGAAATGACCCAAGG - Intergenic
1058647466 9:107143909-107143931 GCCTGCTGCAGAAAGACCCAAGG + Intergenic
1060274842 9:122174521-122174543 CCCACCTAGAAAAATCCCCAAGG + Exonic
1060878963 9:127104399-127104421 GCCTCTTAGAGAATGACCCCTGG + Intronic
1062480482 9:136748605-136748627 GCCTCCTGCAAAATTACCCAGGG + Intergenic
1062602767 9:137326096-137326118 GACTCTTAGAAGAAGACACAGGG + Intronic
1186480219 X:9890959-9890981 TCCTCCTAGAAAAGAACGCAGGG - Exonic
1189592616 X:42530981-42531003 AGCTCCTAGAAAAAGAGCCTAGG + Intergenic
1190095050 X:47472690-47472712 GCCTCCCAAAGAAAGACACATGG + Intronic
1190630623 X:52381818-52381840 GGCTCCTGGCAAAAGACACAGGG - Intergenic
1191885434 X:65883257-65883279 GCCTCCTAAAGAAAAATCCAAGG + Intergenic
1191907577 X:66110022-66110044 GCCCTCTAGAAAATGCCCCACGG - Intergenic
1192979083 X:76319314-76319336 TCCACCTAGAAAAAGACTCAGGG - Intergenic
1194926958 X:99836716-99836738 TCCACCTAGAAACAGACTCAGGG - Intergenic
1195656770 X:107338984-107339006 GCAGGCTAGAAAAAGGCCCAGGG - Intergenic
1195990521 X:110677730-110677752 GGCAGCTAGAAAAAGAGCCAAGG - Intronic
1196579990 X:117367593-117367615 GCCACCTAAGAAAAGACACATGG - Intergenic
1199818657 X:151423060-151423082 GCTTCCCAGAAAGAGACTCAGGG - Intergenic
1200316518 X:155137924-155137946 TCCTCCTAGAAACATACACAGGG - Intronic