ID: 1163418502

View in Genome Browser
Species Human (GRCh38)
Location 19:17201389-17201411
Sequence GGGAGCTGCACAGCGGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 241}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163418494_1163418502 27 Left 1163418494 19:17201339-17201361 CCCCGTGGGGGTGGGGGGTGGGC 0: 1
1: 2
2: 10
3: 97
4: 743
Right 1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG 0: 1
1: 0
2: 0
3: 24
4: 241
1163418497_1163418502 1 Left 1163418497 19:17201365-17201387 CCTGCAGCAGATAGAGCTACATT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG 0: 1
1: 0
2: 0
3: 24
4: 241
1163418496_1163418502 25 Left 1163418496 19:17201341-17201363 CCGTGGGGGTGGGGGGTGGGCAA 0: 1
1: 0
2: 9
3: 89
4: 584
Right 1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG 0: 1
1: 0
2: 0
3: 24
4: 241
1163418495_1163418502 26 Left 1163418495 19:17201340-17201362 CCCGTGGGGGTGGGGGGTGGGCA 0: 1
1: 1
2: 17
3: 116
4: 1140
Right 1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG 0: 1
1: 0
2: 0
3: 24
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163418502 Original CRISPR GGGAGCTGCACAGCGGGCAC AGG Intronic
900684328 1:3938390-3938412 GAGAGCTGCACAGAGAGCTCTGG - Intergenic
900848962 1:5126919-5126941 GTCTGCTGCACAGCGGGCTCGGG + Intergenic
900901169 1:5517004-5517026 GGGCTCAGCACAGCGGGCAGGGG + Intergenic
901109955 1:6785926-6785948 GGGGGCCGCGCAGCGGGCTCGGG - Intronic
901317372 1:8318140-8318162 GGCAGCAGCCCAGCGGGGACAGG + Intronic
902142227 1:14366483-14366505 GGGAACTGGAGGGCGGGCACTGG + Intergenic
903138068 1:21322269-21322291 GGGAGCTGCACTCCGGGCTCAGG - Intronic
903628073 1:24745453-24745475 GCGAGCAGCACGGCGGGAACCGG + Exonic
906210648 1:44010708-44010730 GGGAGGTACCCAGTGGGCACAGG - Exonic
906656652 1:47553136-47553158 GGGAAGAGCACACCGGGCACTGG - Intergenic
911647696 1:100353187-100353209 GGGAGCTGCAGAGGGAGCAAGGG - Intronic
914878604 1:151530548-151530570 GGCAGCAGCCAAGCGGGCACTGG + Exonic
915289223 1:154871632-154871654 GGGAGCTGGACAGAGGCCAAAGG - Intergenic
916677666 1:167077295-167077317 GGGAGCTGGGCAGACGGCACTGG - Intronic
917003766 1:170388772-170388794 GGAAGCTGCACTGTGGGCCCAGG + Intergenic
919291846 1:195643170-195643192 GGGAGGGGCACAGGGGGCACTGG + Intergenic
919326988 1:196120552-196120574 GTAAGCTGCTCAGCTGGCACTGG + Intergenic
919943780 1:202305707-202305729 AGGAGCTGCCCAGCCTGCACAGG + Exonic
920252870 1:204633742-204633764 GAGAGCTGGGCAGCGGGGACTGG - Intronic
1062946081 10:1463157-1463179 GGGGGCTGCAGCGGGGGCACAGG + Intronic
1067155300 10:43776417-43776439 GGGAGCTCTACAGCAAGCACAGG - Intergenic
1068856285 10:61800700-61800722 GGGAGCTGCTCAGCCGGTGCAGG + Intergenic
1069664153 10:70143847-70143869 TGGAAGTGCTCAGCGGGCACAGG + Exonic
1069709318 10:70478789-70478811 GGGAGCAGCGCGGCGCGCACGGG + Intergenic
1070305424 10:75236186-75236208 GGCACCTGGACTGCGGGCACAGG - Intergenic
1073969368 10:109029935-109029957 GGGAGCTGCTCAGAGAGCACTGG + Intergenic
1075688549 10:124380156-124380178 GGGAGGAGCACAGAGGACACAGG - Intergenic
1076911816 10:133394232-133394254 CGGCGCTGCACAGCGCGCGCGGG - Exonic
1076944152 10:133632695-133632717 GGGAGCTGCACAGGGGGCCTTGG + Intergenic
1077332055 11:1988146-1988168 GGCAGCTGCACAGTGGCCCCAGG - Intergenic
1077508729 11:2944210-2944232 GGCAGCTTCACTGCGGGCCCAGG - Intergenic
1081720619 11:45285953-45285975 GGCAGCTGCAGAGGGGGAACTGG - Intronic
1081773369 11:45663140-45663162 GAGAGATCCACAGCGGGCAAGGG + Intronic
1083225175 11:61280623-61280645 GGGTGCTGCCCATCGTGCACAGG - Exonic
1083677627 11:64335375-64335397 GGGAGCTGCTGGGCGCGCACAGG + Intergenic
1083718106 11:64590780-64590802 GGTAACAGCAAAGCGGGCACAGG + Intronic
1084465449 11:69320553-69320575 GGCATCTGCACACAGGGCACTGG - Intronic
1084770562 11:71340410-71340432 GGGGGCTGCACAGCAGGCAGTGG + Intergenic
1085261263 11:75205960-75205982 GGGAGCTGCTCAGAAGGCAAGGG - Exonic
1087548435 11:99614598-99614620 GGGAGATGCACAGTGGATACTGG - Intronic
1089584579 11:119502327-119502349 GGGGGCTGCCCAGGGGGCTCAGG + Intergenic
1089626790 11:119755990-119756012 GGGAGCTGCACAGCAGGACAGGG - Intergenic
1089634830 11:119805390-119805412 GGGAGCTCCAGAGACGGCACTGG - Intergenic
1089932728 11:122330345-122330367 TGGAGCAGGACAGAGGGCACAGG - Intergenic
1091218659 11:133918378-133918400 GGGAGGGGCACAGCGAGCACCGG + Intronic
1202815036 11_KI270721v1_random:43322-43344 GGCAGCTGCACAGTGGCCCCAGG - Intergenic
1091751344 12:3023025-3023047 GGGAGCTGCTCACCGGGAGCCGG - Intronic
1092125485 12:6072303-6072325 GGGGGCTGCGCAGCGTGCTCTGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1099156795 12:79187314-79187336 GGCAGCTGCTCAGAGAGCACTGG + Intronic
1102090572 12:110183957-110183979 GGGAGCTGAAAACCAGGCACAGG - Intronic
1104901126 12:132190086-132190108 GGGAGCTGGGCGGAGGGCACAGG - Intergenic
1105571547 13:21607819-21607841 GGGAGCTGCACTGCGAGGAAGGG - Intergenic
1105927334 13:25019261-25019283 GGCAGCTGCACCTAGGGCACGGG + Intergenic
1112871667 13:103978483-103978505 GGGAGTTGTTCAGCGGGTACCGG + Intergenic
1114555315 14:23558893-23558915 GGGAGAGGCACAGTGGGCCCAGG - Exonic
1116028022 14:39537618-39537640 GGGAGTTGCAGAGCTGCCACTGG - Intergenic
1118312594 14:64704677-64704699 GGTAGCTGCCCCGCGGGCTCGGG - Exonic
1118437534 14:65785147-65785169 GGGATCTGGACAGAGGACACTGG + Intergenic
1118615204 14:67570244-67570266 GAGAGCTGTAAAGCGGGCATAGG - Intronic
1119761417 14:77154679-77154701 GGCAGCTGCACAGCAGGGACAGG + Intronic
1120189099 14:81423719-81423741 GGCAGCTGCACAGGGGCCCCTGG + Intronic
1122036654 14:98953993-98954015 GGGAGCTGCTCAGCCAGCACAGG - Intergenic
1122075355 14:99231738-99231760 GGGAGGTGGGCAGGGGGCACTGG + Intronic
1122145629 14:99687446-99687468 GGGAGCCCCACAGCTGGCTCTGG + Intronic
1122268826 14:100559191-100559213 GGGAGCTGCGCGGTGGGCCCAGG + Intronic
1122779931 14:104139254-104139276 GGAAGCTGGTCAGCGGGCCCGGG + Exonic
1122806959 14:104264654-104264676 GGGAGCTGCAGAGCAGGAAGTGG + Intergenic
1123082150 14:105700316-105700338 GGGAGCGGCCGAGCGGGCGCTGG - Intergenic
1202927070 14_KI270724v1_random:36382-36404 GGGAGCTGCACAGGGGGCCTTGG - Intergenic
1126694972 15:51318074-51318096 GGGAGCTACACAGGAGGCCCAGG - Intronic
1129109487 15:73329281-73329303 TGGAGCAGCACGGAGGGCACAGG + Intronic
1129871938 15:78946140-78946162 GGGAGGTGCAAGGCGGGGACAGG - Intronic
1130063278 15:80584699-80584721 CAGGGCTGCACAGAGGGCACTGG - Intronic
1132127436 15:99240555-99240577 GGGAGCTGCCCTGGGGGCAAGGG + Intronic
1132186576 15:99806561-99806583 GGGAGCTGCGCGGCGGCCTCGGG - Intergenic
1132429110 15:101746150-101746172 GGGAGCTGCGCGGCGGCCTCGGG + Intergenic
1132796647 16:1727741-1727763 GGAAGCTGCACTGCTGGCGCGGG - Intronic
1132876904 16:2144010-2144032 GGGAGGTGCCCTGGGGGCACAGG + Intronic
1133019994 16:2963167-2963189 GGGGGCTGCAGGGCGGGGACTGG + Intergenic
1135752342 16:25067141-25067163 GGGAGCTGCTCCCCGGGCAGTGG - Intergenic
1136067012 16:27766260-27766282 GGGGGCGGCTCAGTGGGCACAGG - Intronic
1136563548 16:31055847-31055869 TGTAGCTGCACAGCAGGCAAAGG - Intergenic
1137384516 16:48029183-48029205 AGGAGCTGGACAGAGGGCATGGG - Intergenic
1138137195 16:54533289-54533311 GGGAGCTGCTCAGCTGGAGCTGG + Intergenic
1138559882 16:57795080-57795102 GCGAGCTGCACTTCGGGCACTGG + Exonic
1138587174 16:57978124-57978146 GGGAGCAGCAGAGCTGGGACTGG - Intronic
1139323553 16:66134487-66134509 TGGAGCTGCACAGCGGAAGCAGG - Intergenic
1140930896 16:79626795-79626817 GGGAGCTGCACTGTGGTTACAGG - Intergenic
1141079619 16:81038538-81038560 AGGAGCTGCTCAGGGGCCACTGG - Intronic
1142027979 16:87824559-87824581 GCGAGCTGCACACCTGGGACAGG - Intergenic
1142348984 16:89571194-89571216 GGGAGCAGGTGAGCGGGCACGGG + Intergenic
1144697580 17:17315643-17315665 AGGAACTGGACAGCTGGCACTGG + Intronic
1144828982 17:18121362-18121384 GGGAGCTGCGCCGCGGGCTGTGG - Exonic
1146940015 17:36837926-36837948 GGGAGCTGAAATGCAGGCACCGG - Intergenic
1147139914 17:38454986-38455008 GGGAGTTGCTCAGGGGACACAGG - Intronic
1147561153 17:41510048-41510070 GGGAGCTGCCCAGAGGGCCTGGG - Intergenic
1148794905 17:50192317-50192339 GGGAGCAGCACAGAGGGAAGTGG - Intronic
1149227800 17:54495793-54495815 GGTAGTTGCACAACTGGCACTGG + Intergenic
1149470798 17:56913823-56913845 CGGCGCGGCACTGCGGGCACAGG + Exonic
1151562117 17:74876127-74876149 GGCAGCTGCACAGAGGCCACTGG - Intergenic
1152084621 17:78210403-78210425 AGGGGCTGCGCAGCGGGCTCGGG + Intergenic
1152086081 17:78219594-78219616 GGGAGCTGCAGCGTGGGAACTGG + Intronic
1152191231 17:78889143-78889165 GGGGGCTGCACAGCTGGCAAAGG + Intronic
1152924240 17:83080123-83080145 GGGCGGGGGACAGCGGGCACCGG - Intronic
1154070661 18:11149141-11149163 CGGAGCTGCCCGGCGGGCTCCGG + Intergenic
1156401746 18:36745720-36745742 GGGAGGTGCACAGAGGGTACGGG - Intronic
1158522746 18:58185123-58185145 TGCAGCTGAACAGTGGGCACAGG + Intronic
1158941148 18:62406668-62406690 GGGAGCTGCACGGCCGCTACTGG - Intergenic
1158953787 18:62522322-62522344 GGGAGGTGCGCAGCGGGACCCGG - Intergenic
1159051716 18:63426642-63426664 GGGGGCTGCACTGCAGGAACTGG - Intergenic
1159911209 18:74148056-74148078 GGCCGCTGCAAAGCAGGCACCGG - Intergenic
1160089976 18:75817889-75817911 CGAGGGTGCACAGCGGGCACTGG + Intergenic
1160998713 19:1897767-1897789 GGCAGCTGCACCCCGGTCACGGG - Intergenic
1161453013 19:4357220-4357242 AGGCGCAGCTCAGCGGGCACAGG - Intronic
1161885971 19:6995877-6995899 GGCAGCTGCACATCATGCACTGG + Intergenic
1161951276 19:7469428-7469450 GGGATCAGCACAGCCGGGACAGG + Intronic
1163418502 19:17201389-17201411 GGGAGCTGCACAGCGGGCACAGG + Intronic
1165136503 19:33673177-33673199 GGAAGCTGCTTGGCGGGCACGGG - Intronic
1165766807 19:38356667-38356689 GGGAGGGGTACAGCTGGCACAGG + Intronic
1166076114 19:40414709-40414731 GGGGGCGGCACAGGGAGCACAGG + Intergenic
1166293374 19:41877430-41877452 GGAGGCTGCAGAGAGGGCACAGG + Intronic
1166524701 19:43503953-43503975 GGGAGCTGAGCAGCAGGCAGAGG - Exonic
1167476025 19:49701386-49701408 GTGTCCTGCACAGAGGGCACGGG - Exonic
1168587448 19:57604883-57604905 GAGAGGTGCACAGCCAGCACTGG - Intronic
925033439 2:669526-669548 GGGAGCTGCACTGGGTGGACGGG + Exonic
926133469 2:10320038-10320060 GGGAGCTGCAAAGGGGACTCGGG - Intronic
926802574 2:16672079-16672101 GGGAGCAGCACAGAGGGGATGGG + Intergenic
930177411 2:48314860-48314882 GGGAGCTGCGCCGCGGGCTGGGG - Intronic
930939521 2:56997584-56997606 GGGAGTTGCAGAGCTGCCACTGG + Intergenic
931757508 2:65387161-65387183 GGGAGGTGCACAGTGGGTGCTGG + Intronic
932492033 2:72128388-72128410 TGGAGCTGCACACTGGGAACCGG - Intergenic
932702746 2:74002520-74002542 GGGAGCGGCACGGCGGGCCTGGG + Intronic
933769510 2:85734189-85734211 AGGAGCTGGACACCGGGCATTGG + Intergenic
934613038 2:95754881-95754903 GGGAGCTGCAAAGCTGGCTGGGG + Intergenic
934647866 2:96069541-96069563 GGGAGCTGCAAAGCTGGCTGGGG - Intergenic
934841238 2:97625362-97625384 GGGAGCTGCAAAGCTGGCTGGGG - Intergenic
936674794 2:114702463-114702485 TGGACCTGCAGAGAGGGCACAGG + Intronic
938011320 2:127831318-127831340 CGGAGCAGCACAGCTGCCACCGG - Intergenic
938102188 2:128504721-128504743 GGCAGGTGCTCAGTGGGCACAGG + Intergenic
938500616 2:131829898-131829920 GCGCGCGGCACAGCGGGCTCCGG + Intergenic
942077975 2:172374456-172374478 GGGACCTGTACAGTGGGGACTGG - Intergenic
944817206 2:203390046-203390068 GGGAGCAGCACAAGGGCCACAGG - Intronic
944981071 2:205120612-205120634 GGCAGCTGCACAGCCGCCAGTGG + Intronic
945925223 2:215796430-215796452 GGGAACAGCACAGCAGGAACTGG - Intergenic
946443982 2:219722416-219722438 CAGAGCTGCCCAGCGGGCAGAGG - Intergenic
948562420 2:238863500-238863522 GGGAACTGCCCAGCGGGTAAAGG - Intronic
948944528 2:241212748-241212770 GTCAGCTGCACAGCTGGCCCTGG - Intronic
948983873 2:241508468-241508490 GGGCGCTGCAGAGCGGGCCGGGG - Exonic
949016783 2:241717893-241717915 GGGAGCTGGACAGCAGGAAGAGG - Intronic
1169002598 20:2178801-2178823 AGGAGCTGCTCAGCCTGCACGGG - Intergenic
1169256888 20:4106475-4106497 GGGAGCAGCACAGCGCCTACTGG + Intergenic
1169983879 20:11420460-11420482 GGGAGCTGAACAATGGGCACAGG - Intergenic
1170125737 20:12961550-12961572 GAGACCTGCACAGGGGCCACGGG + Intergenic
1171781510 20:29422852-29422874 GGGAGCTGCACAGAGGGCCTTGG + Intergenic
1175230536 20:57470895-57470917 CGGAGCTGCTCAGCGCCCACAGG + Intergenic
1175760103 20:61556709-61556731 GGGACCTCCACTGGGGGCACTGG - Intronic
1175775504 20:61650982-61651004 GCGTGCAGCACAGAGGGCACTGG + Intronic
1175979827 20:62732902-62732924 TGGAGGACCACAGCGGGCACAGG + Intronic
1176029562 20:63005424-63005446 AGGAGCTGGACCGCGGGCGCAGG - Intergenic
1178943783 21:36929268-36929290 GGGAGCCTCAGAGCAGGCACTGG + Intronic
1179576473 21:42311301-42311323 GGGAGCAGCACAGGAGGCCCAGG + Intergenic
1180168037 21:46040189-46040211 GGGGGCTGCACAGCTGTCCCTGG + Intergenic
1181047514 22:20222658-20222680 GGGGAGTGCACAGTGGGCACTGG + Intergenic
1182436977 22:30337114-30337136 GGGGGATGCACAGGGGGCATTGG + Exonic
1183186257 22:36293267-36293289 GGGAGCTGCTGGCCGGGCACTGG - Intronic
1183660216 22:39215720-39215742 AGGAGCTGCTCAGCTGGCAAGGG - Intergenic
1183831268 22:40419417-40419439 GGCAGCTGGACACAGGGCACTGG + Intronic
1184069352 22:42138429-42138451 AGCAGCTGCAGAGGGGGCACCGG + Intergenic
1185018249 22:48358189-48358211 AGGAGGTGCACAGAGGGCATGGG + Intergenic
1185222954 22:49638116-49638138 GGCAGCTGCCCAGCAGGCAGCGG - Intronic
1185382253 22:50515136-50515158 GGGAGCGGCACAGAGGCCCCAGG + Intronic
952158770 3:30672221-30672243 GGGAGCTGCCCAGCTTGCGCAGG - Exonic
952976868 3:38704134-38704156 GGGAGCTGCACAGCAAGCAGAGG + Intronic
954363776 3:50135789-50135811 GGGAGCTGGACAGTGGGGCCAGG + Intergenic
954926801 3:54243134-54243156 GGGAGCTGGAGAGTGGGGACAGG - Intronic
955004904 3:54959297-54959319 GGGAGCTCCACAGGGGACTCAGG + Intronic
955033549 3:55243874-55243896 GGGAGCTGGCCAGCAGGCTCAGG - Intergenic
955076694 3:55620655-55620677 GACAGCTGCACAGAGGGAACTGG + Intronic
963583339 3:147154233-147154255 AGCAGCTGCAGAGGGGGCACTGG + Intergenic
964145942 3:153463517-153463539 GGGAGGGGCACAGCAGACACCGG + Intergenic
967776552 3:193391926-193391948 GGGAGCTTCACAGGTGGCCCAGG - Intergenic
972446513 4:39149501-39149523 GGGAGCTGAACAATGGACACAGG + Intergenic
972466868 4:39366082-39366104 AGGGGCCGCACACCGGGCACTGG - Intronic
974147713 4:57967344-57967366 AGCAGCTGCAGAGGGGGCACCGG + Intergenic
976072824 4:81260913-81260935 GGGAGCTGCAGAGGGTGCACAGG + Intergenic
976258497 4:83123684-83123706 TGGAGCTGAAGAGCTGGCACAGG - Intronic
979045035 4:115852076-115852098 GGGAGCTGCAGAGCTGCTACTGG - Intergenic
979468730 4:121071398-121071420 GGGAGCTGCGCAGCCGGGGCCGG - Intronic
981081525 4:140643201-140643223 GGGAGGTGCGGAGCGGGCCCTGG - Intronic
981286231 4:143022329-143022351 GGGAACTGCACAGTGGTTACTGG - Intergenic
981606584 4:146546682-146546704 GGGAGGTGCAGAGCTGCCACTGG + Intergenic
982568723 4:157021449-157021471 GGGAGATGCAGAGCAGTCACTGG - Intergenic
984752475 4:183291252-183291274 TGGAGCTTCACAGCGGGGAGAGG + Intronic
985447523 4:190033238-190033260 GGGAGCTGCACAGGGGGCCTTGG + Intergenic
985682803 5:1265302-1265324 GGGAGCTGCGCAGCTGGCCGAGG - Intronic
987641351 5:20616055-20616077 GGGAACTGCAGTGCAGGCACTGG + Intergenic
988264302 5:28928808-28928830 GGCAGCTGCACCTAGGGCACGGG + Intergenic
993351273 5:86853290-86853312 GGGAGCTGCAGAGCTGCTACTGG + Intergenic
995661604 5:114489782-114489804 TGGATCTGCACAGTGGGCAATGG - Intronic
1002164479 5:177335983-177336005 GGCAGGTGCTCAGCGAGCACTGG - Intronic
1004199207 6:13532427-13532449 GGGAGCTGCAGAGCCTGCAGAGG - Intergenic
1004709431 6:18155667-18155689 GGGCGCTGCACAGGGGGAAAGGG - Intronic
1005850099 6:29814591-29814613 GGGAGCTGCAAAGTGGACAGAGG + Intergenic
1006840906 6:37027452-37027474 GGAAGCTGCACATCAGGCTCTGG - Exonic
1007977663 6:46118061-46118083 GTGAGATGCACAGTTGGCACTGG - Intergenic
1011272472 6:85593619-85593641 GGAAGCAGAACAGCGGGTACTGG + Exonic
1011277060 6:85642311-85642333 GGGACCTGCACAGCGCGCCACGG - Intronic
1012213311 6:96551090-96551112 GGGCCCTTCACAGCTGGCACTGG + Intronic
1014252139 6:119126406-119126428 GGGAACTGGACTGTGGGCACTGG + Intronic
1018960018 6:168441398-168441420 GGGAGCAGCCCAGCGAGCAGCGG - Exonic
1019193539 6:170267920-170267942 GGGAGCTGCACATGGGGCTGGGG - Intergenic
1019219574 6:170463369-170463391 GGGAGGTGCTCAGCAGGCAGGGG + Intergenic
1019488350 7:1299669-1299691 GGGGGCTGCAGAGGAGGCACTGG - Intergenic
1019779264 7:2929958-2929980 GGGACCTGCAGATCGGGCAGAGG + Intronic
1020283627 7:6664053-6664075 GGGGGCTGCAGAGCGGGCGCGGG + Intergenic
1022094642 7:27130943-27130965 GGGCGCTGCACGTGGGGCACGGG - Intronic
1028253718 7:88566300-88566322 GGAAGCTGCACAGGGGGCCCAGG + Intergenic
1029209966 7:98899340-98899362 GGGTGATGCTCAGTGGGCACTGG + Intronic
1032083067 7:128869665-128869687 TGGAGCTGCACAGCGCGGCCAGG - Intronic
1032186008 7:129727228-129727250 GGCAGCTTCGCTGCGGGCACAGG - Exonic
1032870167 7:135976938-135976960 GGGAGCTGGACTGCGGGGATGGG - Intronic
1033156832 7:138964185-138964207 GGGAGCTGGCCAGGGGCCACAGG + Intronic
1034471287 7:151255704-151255726 GGGAGCTGGACAGGGTGAACTGG - Intronic
1034545315 7:151785328-151785350 GGGACCAGCCCCGCGGGCACTGG - Intronic
1035169807 7:157010925-157010947 CGGAGCCGGACGGCGGGCACTGG + Intergenic
1035223760 7:157422392-157422414 AGGACCTGCACAGGGGGCAGAGG - Intergenic
1035672783 8:1432949-1432971 GTCAGCAGCACAGCGGGCCCTGG - Intergenic
1035735818 8:1886968-1886990 GTGAGCTGGACAGCATGCACAGG - Intronic
1036560740 8:9898726-9898748 CGGAGCCGCACTGCGGGCGCCGG + Intergenic
1039852215 8:41378986-41379008 GGGAGCTGCACATGGGGAGCAGG + Intergenic
1042246406 8:66712812-66712834 GGGAGCAGCACCGCGGGGCCAGG + Intronic
1042740007 8:72032574-72032596 TAGAGATGCACAGCGGGCGCTGG + Intronic
1043982450 8:86657903-86657925 GGGAGCTGCACGGTGGTCAGAGG - Intronic
1047760353 8:127949805-127949827 GGTAACTCCACAGCCGGCACTGG - Intergenic
1049344959 8:142133947-142133969 GGGAGCTGCCCAGAGGGCTGGGG + Intergenic
1049642957 8:143723617-143723639 GGAAGCTGCAGAGAGGCCACGGG + Intergenic
1049794303 8:144489420-144489442 GTGAGCTGCACACTGGGCCCTGG + Intronic
1052031685 9:23636363-23636385 AGGAGCTGCCCAGCTGGTACTGG + Intergenic
1053152848 9:35753949-35753971 AGGAGCAGCAGAGAGGGCACAGG - Exonic
1053393367 9:37751877-37751899 GGGAGAGGCACAGGGGGAACCGG + Intronic
1053715733 9:40885359-40885381 GGCAGCTGCACCTAGGGCACGGG + Intergenic
1054076816 9:60545379-60545401 GGCAGCTGCACCTTGGGCACGGG - Intergenic
1055769395 9:79701216-79701238 TTAAGCTGCACAGTGGGCACTGG - Intronic
1057509205 9:95663651-95663673 GGGAGCTGCACAGGGAACACAGG + Intergenic
1060024141 9:120156831-120156853 GTGAGCTGCACAGTGGGAGCTGG - Intergenic
1061062508 9:128257740-128257762 AGGAGCTGCACAGCGGTCGGAGG - Intronic
1061843759 9:133375708-133375730 GGGAGCGGCCCAGCGGGCAGGGG + Intronic
1061923434 9:133794606-133794628 GGGGGCTGCCCAGAGGGCAGGGG + Intronic
1062106150 9:134756105-134756127 GGGGCCTGCACAGTGGGCCCCGG + Intronic
1062431284 9:136527862-136527884 GGGAGCGGCACAGCAGGCGCCGG - Intronic
1062434123 9:136538974-136538996 TGGAACTGCCCAGTGGGCACCGG + Intronic
1062501856 9:136855139-136855161 GGGAGCCGCACTGTGGGCAGGGG + Intronic
1203441255 Un_GL000219v1:10606-10628 GGGAGCTGCACAGGGGACTTTGG + Intergenic
1203512064 Un_KI270741v1:129514-129536 GGGAGCTGCACAGGGGACTTTGG + Intergenic
1190133182 X:47769340-47769362 GGGAGTTGCACAGCTGCTACTGG - Intergenic
1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG + Exonic
1192410585 X:70929583-70929605 GGGAACTGCACAGCCAGCAAAGG - Intronic
1192548952 X:72038238-72038260 AGGGCCTGCACAGCGGGCATAGG - Intergenic
1192606591 X:72525366-72525388 GGGAGGTGCAGAGAAGGCACTGG - Intronic
1192832666 X:74767133-74767155 GGGAGCTGCAGAGCTGCTACTGG + Intronic
1197745801 X:129931844-129931866 GGGGGCTGCACAGACGGGACGGG - Intergenic
1200142829 X:153910309-153910331 GGGTCCTGCCCAGCGGGCACCGG + Exonic
1202255874 Y:22919935-22919957 GGGTGCAGGACAGTGGGCACAGG + Intergenic
1202408865 Y:24553688-24553710 GGGTGCAGGACAGTGGGCACAGG + Intergenic
1202461918 Y:25116390-25116412 GGGTGCAGGACAGTGGGCACAGG - Intergenic