ID: 1163421580

View in Genome Browser
Species Human (GRCh38)
Location 19:17216324-17216346
Sequence AGGGCTCCTTCCCTGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 344}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163421574_1163421580 11 Left 1163421574 19:17216290-17216312 CCAGCGAGATGCGGAGTGAGCTA 0: 1
1: 0
2: 0
3: 1
4: 23
Right 1163421580 19:17216324-17216346 AGGGCTCCTTCCCTGGTCCCTGG 0: 1
1: 0
2: 2
3: 41
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163421580 Original CRISPR AGGGCTCCTTCCCTGGTCCC TGG Intronic
900314699 1:2050890-2050912 CGGGCTCCTTCCCCGGGACCGGG + Intronic
901084728 1:6603288-6603310 AGGGCGCCGGCCCAGGTCCCGGG + Intronic
901332711 1:8423564-8423586 GGGGCTCCCAGCCTGGTCCCGGG + Intronic
901923031 1:12549404-12549426 TGGCCTCCTTCCCTGGCCCTGGG + Intergenic
902044593 1:13514935-13514957 AGAGACCCTTCCCTGGCCCCTGG + Intergenic
902659964 1:17894146-17894168 AATCCCCCTTCCCTGGTCCCGGG + Intergenic
902761043 1:18580913-18580935 TGGGATCCTGCCCTGATCCCTGG + Intergenic
903273929 1:22208967-22208989 AGGGCCCCATCCTTTGTCCCAGG - Intergenic
903329284 1:22588933-22588955 TGGGCCCCTCCCCTGGACCCAGG + Exonic
903392092 1:22971706-22971728 AGTCCTACTTCCCTGGCCCCAGG - Intergenic
903652566 1:24930541-24930563 AGGGCGCCTTCCGTGGGACCCGG - Intronic
904521766 1:31101313-31101335 AGGGCTCCTCCCCAGGTCAGGGG - Intergenic
904801128 1:33093583-33093605 AGGGTCCCTTCCCCAGTCCCAGG + Intronic
905253795 1:36666701-36666723 AGGGCCCCTACTCTGGCCCCTGG + Intergenic
905875715 1:41431063-41431085 TGGGCTCCTTCCTTGGTCTCTGG - Intergenic
905889281 1:41509596-41509618 AGGGCTCCTTCCCCAGCCCAGGG + Exonic
907809273 1:57852198-57852220 AGGTGTCCTGCCCTGTTCCCTGG + Intronic
908023425 1:59922131-59922153 AGGGCTCTTTCTTTGTTCCCAGG - Intronic
908423266 1:63980452-63980474 AGAATTTCTTCCCTGGTCCCAGG - Intronic
908903541 1:68982955-68982977 AGGGCTCCTACCCTATACCCAGG - Intergenic
909049583 1:70752416-70752438 AGGGCTCTTTCTTTGTTCCCAGG - Intergenic
910981360 1:92962007-92962029 GGGGCTCCTTCCCTGGGGACTGG + Intergenic
913439785 1:118885195-118885217 AGGACTCCATCCCTGATCTCAGG - Exonic
913569898 1:120109920-120109942 GGGGCTTCTCCCCTGGTTCCAGG + Intergenic
914290706 1:146270885-146270907 GGGGCTTCTCCCCTGGTTCCAGG + Intergenic
914551750 1:148721668-148721690 GGGGCTTCTCCCCTGGTTCCAGG + Intergenic
914814831 1:151055775-151055797 AGGGCTCTTTCCCTGGTGTTTGG + Exonic
916084632 1:161259404-161259426 AGAACTCCATCCCTGGCCCCCGG + Intronic
917125006 1:171679306-171679328 AGTGCTCCTACCCTGAGCCCTGG + Intergenic
919818140 1:201454931-201454953 ATGGCTGCTGTCCTGGTCCCTGG - Intergenic
919935500 1:202248120-202248142 CAGGCTCCTTCCCTGGCCACCGG + Intronic
920850019 1:209622435-209622457 AGCCCTCCCTCCCTAGTCCCAGG - Intronic
922189353 1:223303578-223303600 GGGGCTCTTTCCTTGTTCCCAGG + Intronic
923769717 1:236927827-236927849 AGTGCCCCTGCCCTGGTCTCTGG - Intergenic
1064156338 10:12906296-12906318 AGAGCTGCTTCCCTGGTGCCAGG + Intronic
1064809390 10:19177855-19177877 AGGGGTCCTTTCCTGTTCCCAGG - Intronic
1065006654 10:21386767-21386789 AGGGGTCCTGCCCTGTACCCGGG + Intergenic
1067316811 10:45175428-45175450 AGGGCTCCTTCTTTGTTCCCAGG + Intergenic
1067839606 10:49665328-49665350 AGGACTCCTTCTGTGGTCCTTGG + Intergenic
1069573627 10:69509160-69509182 AGGTCACCTTACCTGGACCCTGG + Intergenic
1069796139 10:71053145-71053167 AGGCCTCCTTCCTTCCTCCCAGG - Intergenic
1071118447 10:82250803-82250825 ATAGCTCCTTGCCTGGTGCCTGG + Intronic
1071553364 10:86584380-86584402 AGGGCTGCTCCTCTGCTCCCAGG - Intergenic
1071553369 10:86584400-86584422 AGGGCTGCTCCTCTGCTCCCAGG - Intergenic
1071553724 10:86586503-86586525 AGGGCTGCTCCTCTGCTCCCAGG - Intergenic
1071574977 10:86718613-86718635 AGATCTCCTGCCCTGTTCCCTGG + Intronic
1072037255 10:91574933-91574955 AATGCTCCTTCCCTGGCCCAAGG + Intergenic
1072693559 10:97587100-97587122 AGGGTCCCTTCCCTGCTTCCAGG + Intronic
1072699399 10:97629598-97629620 AAGGCTCCTTCACTGATGCCTGG - Intronic
1073336624 10:102714671-102714693 AAGGCCCCTTACCTGGTCCCGGG - Exonic
1074190400 10:111130474-111130496 GGGGGTCCTGCCCTGATCCCAGG + Intergenic
1075014902 10:118903494-118903516 GGGGCTCCTTCCCTTGGCCCAGG - Intergenic
1075722075 10:124593165-124593187 ATGCCCCCTGCCCTGGTCCCTGG + Intronic
1076568241 10:131413280-131413302 AGTGCTGCTTCCCTTTTCCCAGG - Intergenic
1076697189 10:132252564-132252586 GGGGCTCCTTCCCAGGAACCAGG + Intronic
1077018014 11:405493-405515 GGGCCTCCTTGCCTGGTCCCTGG - Intergenic
1077035918 11:494402-494424 TGGGCTGCTTCCCTGGTGCGGGG + Intergenic
1077227793 11:1445930-1445952 GGGCCTCCCTCCCTGGGCCCTGG + Intronic
1077230235 11:1455380-1455402 CGGGCGCCCTCCCTGGCCCCAGG + Intronic
1077243147 11:1522026-1522048 AGGGCTCTTTCCCAGGGCTCGGG + Intergenic
1077288457 11:1778015-1778037 AGGGGCCCTCCCCTGGCCCCAGG + Intergenic
1077289549 11:1782559-1782581 GGGACTCCTGCCCTGCTCCCTGG - Intergenic
1077316568 11:1922011-1922033 TGGCCGCTTTCCCTGGTCCCGGG - Intronic
1077338102 11:2014352-2014374 GGGCCTCCTTCCCTGGTACTAGG - Intergenic
1077411321 11:2405219-2405241 GGGGCTGCTTTCCTAGTCCCAGG - Intronic
1078012118 11:7580443-7580465 AGGGCTCCTGCTCTGGCACCAGG - Intronic
1078544760 11:12239314-12239336 AGGGCTCCCTCCATGGTCTGAGG - Intronic
1079145301 11:17846006-17846028 AAGGATACTTCCCTGGTCCCAGG - Intronic
1079331238 11:19534641-19534663 ATTGCTCCTTCCCTGCTCCCTGG - Intronic
1080587932 11:33698151-33698173 GGGGTTCCCTCCCTGGTCTCGGG + Intergenic
1081688316 11:45057999-45058021 GGGCCTCCCTCCCTGGGCCCGGG + Intergenic
1081693233 11:45092369-45092391 AGGGCTGCTCTGCTGGTCCCAGG + Intergenic
1082010669 11:47447984-47448006 TGGGCACCTGCCCTGGTACCAGG + Exonic
1083475243 11:62911034-62911056 AGGGACCCTTTCCTGGTGCCAGG + Exonic
1083893847 11:65610622-65610644 TGGGCACCTCCCCTGGTGCCAGG + Intronic
1084161662 11:67353554-67353576 AGGCGTCCCTCCCTGGACCCCGG - Intronic
1084557583 11:69884033-69884055 AGGGCTCAGGCCCTGGCCCCTGG - Intergenic
1084708419 11:70829419-70829441 AAGGCTCCTTCCCTTCTCCCTGG - Intronic
1084774988 11:71369180-71369202 CGGGCACCTGCCCTGCTCCCTGG - Intergenic
1085416410 11:76321781-76321803 AGGACGCCTTCCCTGAGCCCCGG + Intergenic
1086529938 11:87773061-87773083 AGGCCTTCTTCACAGGTCCCAGG - Intergenic
1087153738 11:94881471-94881493 ATTGATCCTTCCCTTGTCCCTGG + Intergenic
1087473089 11:98601562-98601584 AATGCTCCTTCCATAGTCCCTGG + Intergenic
1089157681 11:116414759-116414781 GGGGCTCCTGTCCTGGTCCTGGG - Intergenic
1089197218 11:116701335-116701357 AGGGCCCCTTCCCAGGTCAAGGG + Intergenic
1089587900 11:119521665-119521687 TGGGCTCCTTCCCTAGGTCCAGG + Intergenic
1089677876 11:120102336-120102358 AAGCCTCAGTCCCTGGTCCCTGG - Intergenic
1089793023 11:120958081-120958103 AGGGCTTCTGCCCAGGTTCCCGG - Intronic
1091369045 11:135043574-135043596 AGGGCAGCTTCCCTTCTCCCTGG - Intergenic
1202821086 11_KI270721v1_random:69534-69556 GGGCCTCCTTCCCTGGTACTAGG - Intergenic
1092860423 12:12715575-12715597 ATGGCTCCTTCCCAGGCCCTGGG - Intronic
1092947766 12:13472577-13472599 AGGGATTCTACCCTGGTGCCTGG - Intergenic
1095953441 12:47793839-47793861 AGCGCCCCTCCCCTGGTTCCTGG - Intronic
1096382848 12:51173334-51173356 AGGGCTCCTTCCATGGCTCAGGG - Intergenic
1097157818 12:57025675-57025697 AGCCCTGCTTCCCTGGTGCCAGG - Intronic
1102787475 12:115616567-115616589 AGGGCTGCTGCCCTAGACCCAGG - Intergenic
1104636838 12:130442776-130442798 GGGGCTCCTCCGCTGTTCCCAGG + Intronic
1105518537 13:21111684-21111706 AGGGCTCCCTCCCTCCTGCCTGG - Intergenic
1108020723 13:46125206-46125228 GGGGGTCCTGCCCTGATCCCTGG + Intergenic
1113483211 13:110636761-110636783 AGGGCTCCGTCCCTGGGAGCTGG + Intronic
1113910243 13:113838280-113838302 TGGGCTCCCTCCCTGCTCCAGGG - Intronic
1113910292 13:113838438-113838460 TGGGCTCCCTCCCTGCTCCAGGG - Intronic
1113910324 13:113838519-113838541 CGGGCTCCCTCCCTGCTCCAGGG - Intronic
1113910356 13:113838600-113838622 CGGGCTCCCTCCCTGCTCCAGGG - Intronic
1113910387 13:113838681-113838703 CGGGCTCCCTCCCTGCTCCAGGG - Intronic
1114351851 14:21861481-21861503 ATGGCTCCTTGCCTGGTTGCTGG - Intergenic
1118822814 14:69355970-69355992 AGGTTTCCTTTCCTGTTCCCTGG - Exonic
1118827698 14:69398851-69398873 AGGACTCCTTTCCTCATCCCAGG + Exonic
1119445479 14:74659857-74659879 AGGGCTCCTTCCCTCTACTCTGG - Intronic
1119540587 14:75435575-75435597 AGGGCTCGACTCCTGGTCCCAGG - Intronic
1121539109 14:94711738-94711760 AGGTCACCTTCCCCTGTCCCAGG - Intergenic
1122152330 14:99731802-99731824 TGGGCTCTTGCCCTGGGCCCAGG - Intergenic
1122276602 14:100593956-100593978 AGGCCTCCTGCCCGGGCCCCAGG + Intergenic
1122859242 14:104575151-104575173 TGGGCGCCATCCCTGGTCTCCGG - Intronic
1122923502 14:104889652-104889674 CGGGCTCGTTCCCGGGCCCCCGG + Exonic
1123038424 14:105480637-105480659 AGGACCCCTCCTCTGGTCCCCGG - Intergenic
1125535282 15:40438767-40438789 AGGTCTCCTTCCCTGCCACCAGG + Intergenic
1125893272 15:43281701-43281723 AGGGGTCCTTCCTGGATCCCAGG - Intronic
1125933900 15:43618317-43618339 GGGCCTCATTCCCTGGACCCTGG - Exonic
1125946997 15:43717779-43717801 GGGCCTCATTCCCTGGACCCTGG - Intergenic
1126358699 15:47823339-47823361 AGAGCTCCTTCCTTGGGCCCTGG - Intergenic
1128325325 15:66720401-66720423 AGGGCTCCTTCCCTCACCCAGGG - Intronic
1128479281 15:68023331-68023353 AGCACTCATTCCCTGGGCCCCGG - Intergenic
1128604868 15:69029148-69029170 ATGCCTCCTCCCCTAGTCCCTGG + Intronic
1128815019 15:70602108-70602130 AGGGGTCCTTCCTTGATTCCAGG - Intergenic
1128816617 15:70614459-70614481 AGGGCTCATTCTCTTCTCCCTGG + Intergenic
1129198573 15:73985306-73985328 AGGGCTCCTCACCTGGCCCCGGG + Exonic
1129220312 15:74128497-74128519 AGGGGGTCTTCCCTGGTCCTCGG + Exonic
1129252748 15:74318013-74318035 AGGGCCCCACGCCTGGTCCCTGG - Intronic
1129638194 15:77345095-77345117 AGGCATCCTTGCCTTGTCCCTGG + Intronic
1129689525 15:77705439-77705461 AGGGCTCCCGTCCTGGTCCAGGG + Intronic
1130025565 15:80267855-80267877 AGGGTTCCTGCCCTCTTCCCTGG - Intergenic
1130124985 15:81085659-81085681 AGGGCTCCTCCCCAGGGCCTTGG - Intronic
1131150954 15:90046915-90046937 TGGCCTCCTCCCCTGGGCCCAGG - Intronic
1131486589 15:92825890-92825912 AGGGGTCCTTCCCTATACCCAGG - Intergenic
1132718550 16:1304368-1304390 AGGGCTCCTCCCGAGCTCCCTGG - Intergenic
1134008650 16:10835074-10835096 GGGGCTCACACCCTGGTCCCTGG + Intergenic
1134453758 16:14379203-14379225 AGGGCTCCTTCCGATGGCCCAGG - Intergenic
1135382916 16:22008681-22008703 AGGGCTGCTCCCCTCCTCCCCGG - Intronic
1136048039 16:27631037-27631059 AAGTCTCCTTCCCTCGTCTCTGG + Intronic
1136926732 16:34381492-34381514 AGAGCTCCCTCCCGGTTCCCAGG + Intergenic
1136977842 16:35030315-35030337 AGAGCTCCCTCCCGGTTCCCAGG - Intergenic
1137712415 16:50575518-50575540 AGGGCTCCTTCCCCGGGCTGTGG + Intronic
1139029393 16:62860671-62860693 AGAGCTCCATCCCTAGCCCCAGG + Intergenic
1139304237 16:65969577-65969599 TGGGCACCTTCCCTTGCCCCAGG + Intergenic
1139517719 16:67461646-67461668 AGTTCTCCTTCCTCGGTCCCTGG + Intronic
1140431568 16:74908834-74908856 AGTGGTCCTTCCCAGGTCTCTGG + Intronic
1141143034 16:81509672-81509694 AGGGCTCCAACCCTGGTTTCAGG + Intronic
1141239051 16:82248090-82248112 GGGGCTCCTTCCCAGCTCCCCGG + Intergenic
1141764809 16:86051474-86051496 AGGGCTCCTCCCGTGGGCCCAGG + Intergenic
1142504863 17:356895-356917 GGGGCTCCTTCCCCAGCCCCTGG + Intronic
1142615280 17:1130634-1130656 AGGTCACATTCCCAGGTCCCAGG - Intronic
1142933331 17:3307157-3307179 AGGCCTCCTAGCCTGGCCCCAGG + Intergenic
1143185331 17:5006769-5006791 AGGGCTCCTTGCCTGGTAGGAGG + Intronic
1144737660 17:17564036-17564058 AGGGCTCCTTCCCAAGACTCAGG - Intronic
1144971071 17:19110308-19110330 AGGGCACCATCCCTGTTGCCTGG - Intergenic
1144991373 17:19236471-19236493 AGGGCACCATCCCTGTTGCCTGG - Intronic
1146212647 17:30954307-30954329 AGGGCTCCTATCCAGGCCCCAGG + Intronic
1147253905 17:39170281-39170303 AGTGCTAATTCCCTTGTCCCAGG - Intergenic
1147600147 17:41740217-41740239 AGGCCTCCTGCTCTGGTCCCTGG - Intergenic
1149640423 17:58199190-58199212 AGAGCTCCTTACCTGGACCATGG - Exonic
1150640471 17:66946316-66946338 AGGGTTCTTTCCCTGGTCTGGGG - Intergenic
1151197976 17:72445467-72445489 AGGGCTTTTTTCCTGGCCCCTGG - Intergenic
1152061835 17:78082110-78082132 AGGGCTCTTTCTTTGTTCCCAGG + Intronic
1152555305 17:81050045-81050067 TGGGCTCCTCCCGTGGTTCCTGG + Intronic
1152818017 17:82420178-82420200 AGGTCTCATTCACAGGTCCCAGG - Intronic
1155386492 18:25283386-25283408 AGGGGCTCTTCCCTGGTCTCTGG + Intronic
1156406149 18:36784340-36784362 ATGACTCCTTCCCAGGCCCCAGG - Intronic
1160393513 18:78555649-78555671 GGGGCTCCTCCTCTGGCCCCGGG + Intergenic
1160667157 19:336275-336297 AAAGCCCCTTCCCTGGTCACTGG - Intronic
1160808081 19:1001217-1001239 ACAGACCCTTCCCTGGTCCCTGG + Intronic
1161129877 19:2581486-2581508 GGGGCCCCCTCCCTGGTCCCTGG + Intronic
1163157976 19:15449530-15449552 AGGGCTCATCCCCCGGACCCTGG - Intronic
1163300387 19:16441792-16441814 AGGCCTCCTTCCATGGGGCCCGG - Intronic
1163421580 19:17216324-17216346 AGGGCTCCTTCCCTGGTCCCTGG + Intronic
1163611486 19:18304231-18304253 AGGGCCACTTGCCTTGTCCCAGG - Intergenic
1163638638 19:18449579-18449601 AGGGCTCCCACCCTCATCCCAGG + Intronic
1163690885 19:18737600-18737622 AGGTCACCTTCCCAGGTTCCAGG - Intronic
1164593319 19:29517993-29518015 TGGGTTCCTTCCCTGCTCCCAGG - Intergenic
1164595600 19:29529155-29529177 AGTGCTCCTCCCCTGCGCCCCGG - Intronic
1166090057 19:40502990-40503012 AAGTCTCCCTCTCTGGTCCCAGG - Intronic
1166450967 19:42900459-42900481 AGGGCTCTTTCTTTGTTCCCAGG + Intronic
1166469008 19:43061265-43061287 AGGGCTCTTTCTTTGTTCCCAGG + Intronic
1166480147 19:43164782-43164804 AGGGCTCTTTCTTTGTTCCCAGG + Intronic
1167339718 19:48907943-48907965 AGGGCTCTTTGCCTGGTCCATGG + Intronic
1167726263 19:51215220-51215242 TGAGCTCCTTGCCTGGTCCTAGG - Intergenic
1168236868 19:55069096-55069118 CTGGCTCCTTCCCAGGTCTCTGG - Intronic
1168671895 19:58246864-58246886 AAGGCTCCCTCCTTGGCCCCTGG - Intronic
925208849 2:2030025-2030047 ATGCCTCCTTCCTTGGTCTCTGG - Intronic
925209945 2:2036910-2036932 ATGGCTCCTTCCTTGGTCTCTGG + Intronic
926297984 2:11582217-11582239 AGGCCACCTTCCCAGGTTCCCGG - Intronic
926698807 2:15788837-15788859 AAGCCTTCTGCCCTGGTCCCAGG + Intergenic
927640214 2:24841198-24841220 AGGGCCCCGGCCCTGGACCCAGG - Intronic
928420810 2:31137051-31137073 AGGCCTCCTTCCGTGTCCCCGGG + Intronic
929608354 2:43251004-43251026 AGGCCTCCTTCCCTGTTTGCTGG + Intronic
933897383 2:86824117-86824139 GGGCCTCCTTCCCTGCTCTCAGG - Intronic
934025746 2:88000335-88000357 ATGGCTCCTGCCCTTGTCCAGGG - Intergenic
936152804 2:110030882-110030904 AGTGCCACTGCCCTGGTCCCAGG - Intergenic
936191876 2:110340530-110340552 AGTGCCACTGCCCTGGTCCCAGG + Intergenic
936438440 2:112529054-112529076 AGAGCTCCTTCCCCTCTCCCCGG + Exonic
936516724 2:113185771-113185793 GGGGCTCCTCCCCTGGAGCCTGG - Intronic
936524578 2:113234127-113234149 TGGCTTCCTTCCCTGGTCCTGGG + Intronic
937214201 2:120300724-120300746 GGGGCTCCGTTCCTGCTCCCAGG - Intergenic
937691047 2:124755609-124755631 GGGGCTGCTTCCGTGGTCCATGG + Intronic
937859552 2:126697115-126697137 AGCTCCCCTTTCCTGGTCCCAGG + Intergenic
942064278 2:172255499-172255521 AGGGCTCTTTCCATGATCTCTGG + Intergenic
942133282 2:172901779-172901801 AGAGCTTCTTCCCATGTCCCAGG + Intronic
945293627 2:208149169-208149191 AGGCCTCCTTACCTGGTACTGGG + Intergenic
946334879 2:219029903-219029925 AGAGCTCCTTCCCTGCTCCTAGG - Intronic
946395724 2:219442778-219442800 CGGGCTGTTGCCCTGGTCCCGGG + Intronic
946395731 2:219442797-219442819 CGGGCTGTTGCCCTGGTCCCGGG + Intronic
947668640 2:231923082-231923104 AGGCCACCTTCCTTGGGCCCCGG - Intronic
947765348 2:232634034-232634056 CCCGCTCCCTCCCTGGTCCCGGG - Intronic
948143435 2:235691245-235691267 AGGGCTCTGTGCCTGGCCCCAGG + Intronic
948395726 2:237643599-237643621 AGGCCTCCCTCCCTTCTCCCAGG + Intronic
948633691 2:239319457-239319479 AGGGCGCCTTGCTCGGTCCCGGG - Intronic
949054931 2:241922397-241922419 ACGTCTCCATCCCTGGTGCCCGG + Intergenic
949054950 2:241922460-241922482 ACGTCTCCATCCCTGGTGCCCGG + Intergenic
1168987622 20:2063967-2063989 TCAGCCCCTTCCCTGGTCCCAGG + Intergenic
1169080931 20:2797394-2797416 TGAGCTCCTTCCCTGGGTCCTGG - Intronic
1170164280 20:13345551-13345573 ATGGCTCCAGCCCTGTTCCCTGG + Intergenic
1172240644 20:33410401-33410423 AGGGTTTCTTCCCAGGTCACTGG - Intronic
1172280975 20:33707889-33707911 AGGGCTACATCCCTGAACCCAGG - Exonic
1175823164 20:61922985-61923007 AGGGCTCATTCACAGGTCCCAGG + Intronic
1178429777 21:32509090-32509112 AGGGCTCTCTCCATGGTCCCAGG - Intronic
1179284853 21:39968520-39968542 AGGGCTCATTTCCTGGTTCATGG + Intergenic
1179512432 21:41882455-41882477 TGGTCTCCTTCCCTGGAACCAGG - Intergenic
1179544303 21:42104226-42104248 AGGGCTACTGCCCTGGCCCCTGG - Intronic
1179998811 21:44985968-44985990 AGGGCACCGTCCCTGCTCCTTGG - Intergenic
1180650698 22:17374447-17374469 AAGTCTCCTACCCTGGTGCCAGG - Intronic
1181021650 22:20106702-20106724 AGGACTCCTTCTCTGCTGCCTGG + Intronic
1181138778 22:20788285-20788307 AGGACTCCTTGTGTGGTCCCTGG - Intronic
1181786632 22:25231786-25231808 ATGCCTCCTTCCCAGGACCCAGG + Exonic
1181818796 22:25459598-25459620 ATGCCTCCTTCCCAGGACCCAGG + Intergenic
1182276237 22:29190424-29190446 AGGGCACCTTCGCAGGTTCCTGG - Intergenic
1182910349 22:33979018-33979040 AGGGCTCTTTCTTTGTTCCCAGG - Intergenic
1183226055 22:36550696-36550718 AGGACACCATCCCTGGCCCCAGG + Intergenic
1183232294 22:36590596-36590618 AGGCCACCATCCCTGCTCCCTGG + Intronic
1183478025 22:38046630-38046652 ATGGCTGCTTGGCTGGTCCCAGG + Intergenic
1184117670 22:42431616-42431638 GGCGCTCCTTTCCTGGTTCCAGG - Intronic
1185170672 22:49291938-49291960 AGGCCACCTTCCCTGGTTCCAGG + Intergenic
1185289046 22:50014914-50014936 AAGGCTCCAGCCCGGGTCCCGGG - Intergenic
1185297867 22:50063031-50063053 AAGTTTCCTTCCCTGGTCTCTGG - Intronic
949663287 3:6306970-6306992 AGGGCTCTTTCTTTGCTCCCAGG + Intergenic
950398727 3:12753877-12753899 AGCCCTCCTGCCCTGGGCCCAGG - Intronic
953414021 3:42705323-42705345 TGGGCCCCTCCCCTGCTCCCAGG - Intronic
954807647 3:53229749-53229771 AGGCCTCTTTCCCTAGTACCTGG + Intronic
956606314 3:71076395-71076417 AGGGCTCCTACCTTGGCCTCAGG + Intronic
957046469 3:75378814-75378836 AGGGATCTCTCCATGGTCCCAGG + Intergenic
958160458 3:89811853-89811875 AGGTCTCCTTCCCTGCTCTCTGG - Intergenic
959610776 3:108292599-108292621 AGGGCCCCTCCCCTGTTCCCTGG - Intergenic
961010261 3:123430749-123430771 AGGGATGCTTCCCAGGCCCCAGG + Intronic
961129560 3:124453363-124453385 AGAGCTGGATCCCTGGTCCCTGG + Intronic
961878530 3:130043056-130043078 AGGGCTCTCTCCATGGTCCCAGG + Intergenic
961924693 3:130465365-130465387 AGGGTTCTTTCCCTGGTCTCAGG - Intronic
962282860 3:134065426-134065448 AGGGCTCCTTTCCAGGGCTCAGG - Intronic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962600043 3:136984735-136984757 AGGCCTCCTTCCCAGGCACCAGG + Intronic
963755739 3:149233449-149233471 AGGGCTGCTTCACTGCCCCCAGG + Intergenic
964004022 3:151808655-151808677 AGGGCTCTTTCTTTGTTCCCAGG + Intergenic
965022732 3:163254363-163254385 AGAGCACCTGCCCTGGTCCCAGG - Intergenic
966942618 3:184756526-184756548 AGGGCTGCATCACTGGTTCCTGG + Intergenic
967259769 3:187630610-187630632 AGGGCTACTTCCCTTGCCTCAGG - Intergenic
968067232 3:195765313-195765335 AGGTCTCCTGCCCTTGTTCCTGG - Exonic
968493604 4:903521-903543 AGTGCCCCTTCCTTGGCCCCTGG - Intronic
968990755 4:3909926-3909948 AGGGCTCTCTCCATGGTCCCAGG + Intergenic
969530854 4:7729426-7729448 GGGGATCCTTCCAGGGTCCCAGG - Intronic
969824588 4:9747417-9747439 AGGGCTCTCTCCATGGTCCCAGG - Intergenic
971649180 4:29249907-29249929 GGGGCTCCTTCCCAGTACCCAGG - Intergenic
972276230 4:37560398-37560420 TGGGTTACTACCCTGGTCCCAGG - Intronic
976092318 4:81471526-81471548 AGGGGCCCTCCCCCGGTCCCGGG + Intronic
981528878 4:145733403-145733425 CGGGCTCCTTCCCGCGCCCCAGG - Intronic
984261190 4:177445002-177445024 AGGGCTTCATCCCTGGGCCTGGG + Intergenic
985010193 4:185574078-185574100 AGGGCTGTGTCCCTGTTCCCTGG - Intergenic
985894254 5:2739589-2739611 TCGGCACCTCCCCTGGTCCCGGG + Intergenic
985898397 5:2764701-2764723 GGGGCGGCTTCCATGGTCCCTGG - Intergenic
986079156 5:4371572-4371594 GGGGCTCCCTCCCTTGTTCCTGG - Intergenic
986252339 5:6071967-6071989 TGGGCTCCACCCCTGGACCCTGG - Intergenic
986446320 5:7824583-7824605 GGGGCTCCTGCCCTCCTCCCAGG + Intronic
987100686 5:14588898-14588920 AAGGCTCATTCCATCGTCCCTGG - Intronic
987439818 5:17942086-17942108 AGGTCTCCAACCCTGGTCCATGG - Intergenic
988829978 5:34977796-34977818 TGGTCTTCATCCCTGGTCCCTGG - Intergenic
992175587 5:74146198-74146220 GGGGCCCCTGCCCTTGTCCCTGG - Intergenic
992734595 5:79706036-79706058 AGGGCTCTTTCTTTGTTCCCAGG + Intronic
994166593 5:96615591-96615613 TGGCCTCCTTCCCTGGGGCCTGG - Intronic
996125648 5:119722703-119722725 TGGGCTTGTTACCTGGTCCCTGG + Intergenic
996811260 5:127518073-127518095 AGCGCTCCTGCCTTGGTCCTTGG - Intronic
996879822 5:128283572-128283594 AGGGCTCCTTCCCAGGACACTGG - Intronic
997943916 5:138182602-138182624 AGGGATTCTCCCCCGGTCCCTGG + Exonic
998270383 5:140701023-140701045 AGTGCTGCTTCCCTGGGCCTAGG + Intronic
999290475 5:150422243-150422265 AAGGCTCCTTCCCTGGGCGGTGG - Intergenic
1002601948 5:180358823-180358845 AGGGCTCATTTCCTGGTTCATGG - Intergenic
1002636351 5:180610639-180610661 TGGAGTCCTTCCCTGCTCCCAGG + Intronic
1003137265 6:3443387-3443409 ACGGCTCCTTCCAAGATCCCTGG + Intronic
1004048039 6:12045258-12045280 AGGGCACCCTCCCAGGACCCAGG - Intronic
1005844209 6:29764860-29764882 AGACCTCCCTGCCTGGTCCCTGG - Intergenic
1006067498 6:31472642-31472664 AGGCCTCCCTGCCTGGTTCCTGG + Intergenic
1007713313 6:43838516-43838538 GGGGTCCCTTCCCTGGCCCCAGG + Intergenic
1008505571 6:52226473-52226495 TGGGCTCCTTGCCTGTTTCCTGG - Intergenic
1012072372 6:94639600-94639622 AGGGTTCCATCCCTGGGCCTGGG + Intergenic
1012147654 6:95706436-95706458 AGTCCTCCTTACCTGGTGCCAGG + Intergenic
1014405211 6:121042892-121042914 AGGGCTCTTTCTTTGTTCCCAGG - Intergenic
1018372148 6:163178143-163178165 AGGGCTCCCTGCCTGGCACCAGG + Intronic
1019023520 6:168939282-168939304 AGGGATCCTTGCCTGGTGCCTGG + Intergenic
1019054614 6:169214064-169214086 AGGGCTCCTTCCGTCATTCCTGG - Intergenic
1019209792 6:170395569-170395591 TGGCCTTCTTACCTGGTCCCTGG - Exonic
1019372273 7:668803-668825 TGGGCTCCTCCCCAGCTCCCAGG - Intronic
1019412085 7:911173-911195 AGGGAGGCTTCCCTGTTCCCAGG + Intronic
1021624080 7:22575724-22575746 AGGGGTGCTTCTCTGTTCCCAGG - Intronic
1021820806 7:24495522-24495544 AGGGCATCTGCCCTGGTCACAGG - Intergenic
1022323082 7:29305097-29305119 AGAGCTCCTTCCTTGGCCACTGG - Intronic
1023041760 7:36178769-36178791 AGGGCTCCTGACCTTGTGCCAGG - Intronic
1023608786 7:41954184-41954206 AGGCCTTTTTCCCTGGTTCCTGG + Intergenic
1024203136 7:47126396-47126418 AGGGCTCCAGCCCTGGGCCTGGG - Intergenic
1024220681 7:47284206-47284228 AAGGCACCTTCTCTGGTCTCAGG + Intronic
1025241760 7:57282592-57282614 AGATCTCCTTTCCTGTTCCCTGG + Intergenic
1026152490 7:67800152-67800174 AGAGCTCCTCCTCTGCTCCCAGG - Intergenic
1026950337 7:74342487-74342509 CTGGCTCCATCCCAGGTCCCTGG - Intronic
1027131837 7:75596807-75596829 AGGGCCCCTTCCCTCCTCCCAGG + Intronic
1028582945 7:92425514-92425536 AGGGCTCCTCCCCAGGGACCCGG - Intergenic
1030073815 7:105719913-105719935 AGGCCTCCTTTCCTAGGCCCTGG - Intronic
1032792777 7:135254628-135254650 AGGGCTTCTCCCCTTGTCCCAGG + Intronic
1032840617 7:135710904-135710926 AGGGGGCCTTCCCTGCCCCCAGG - Intronic
1033600607 7:142885912-142885934 AGGGCTCTCTCCCTGCCCCCAGG + Intergenic
1034455453 7:151167635-151167657 AGGGCTCGCTCCCTGGCTCCCGG + Intronic
1034462980 7:151208698-151208720 AGGACTCCTCCCCTGGTCCGGGG - Intronic
1034488500 7:151380904-151380926 AGAGCTCCTCCCTTGCTCCCCGG + Intronic
1037518705 8:19659357-19659379 TGGGCTCCTTCCCTTATCCTAGG + Intronic
1038240484 8:25803405-25803427 AGCACTCCTTCCCTGGTGCCAGG - Intergenic
1038493716 8:27987442-27987464 AGGGCTCCTTCCCCACCCCCAGG + Intronic
1038911279 8:31967519-31967541 AGGGCTCTTTCCTTGTTGCCAGG - Intronic
1039377107 8:37045518-37045540 ACATCTCCCTCCCTGGTCCCTGG + Intergenic
1044585719 8:93867776-93867798 AGTGCTCGTTGCTTGGTCCCTGG + Intronic
1044828287 8:96219863-96219885 AGGGTTCCTTCCCTCCACCCAGG - Intergenic
1045693084 8:104779551-104779573 AGGGCTCCCTCTCTGGTTCATGG - Intronic
1046602762 8:116336931-116336953 AGAGCTCCTTTCCTGGTACAAGG + Intergenic
1047765352 8:127985904-127985926 AGGGCTCCTACCCTAGCCCTTGG + Intergenic
1049240733 8:141536232-141536254 AGGGCCCCTCCCTTGGTGCCAGG - Intergenic
1049281749 8:141753047-141753069 AAGGCGCCTCCCCTGGGCCCCGG - Intergenic
1049364888 8:142232390-142232412 GGGCCTCCTTACGTGGTCCCAGG + Intronic
1049530669 8:143153288-143153310 AGGCCTCCTTCCCTGGACAGGGG + Intergenic
1049790179 8:144468824-144468846 AGGGGTCCTGACCTGGCCCCGGG - Exonic
1050225994 9:3456122-3456144 AGGGCTCCTTCCCTTGTGAATGG - Intronic
1056293316 9:85166282-85166304 GGGCTTCTTTCCCTGGTCCCAGG + Intergenic
1056768038 9:89456984-89457006 AGGGCTCCTTCCTTCCTCACTGG + Intronic
1056793210 9:89639518-89639540 AGGGCTCCTTTCCTGTCCCAGGG + Intergenic
1056809381 9:89752424-89752446 AATGCCCCTGCCCTGGTCCCAGG - Intergenic
1057048524 9:91904245-91904267 CGGGATCCTTCCATGATCCCTGG - Intronic
1058419745 9:104822383-104822405 TGTGCTCCTTCCCTTGGCCCAGG + Intronic
1060078761 9:120620731-120620753 AAGGCATGTTCCCTGGTCCCAGG - Intronic
1060766855 9:126300677-126300699 AGGGTTCCTTCACTGGGCACGGG - Intergenic
1060969693 9:127731039-127731061 TGGGCTCCTGCCTTGGGCCCTGG - Exonic
1061053576 9:128209865-128209887 TGGGCACCTCCCCTGGCCCCTGG + Intronic
1061181485 9:129027542-129027564 AGGTCTGTTTCCTTGGTCCCTGG - Intronic
1061191289 9:129084218-129084240 CGGGCTGCCTCCCAGGTCCCAGG + Intronic
1061327574 9:129873633-129873655 AGGGCTGCTTCCCTGGCCCCTGG + Intronic
1061416065 9:130447557-130447579 AGGCCACCTTCCCTCCTCCCAGG + Intronic
1061840948 9:133358283-133358305 AGTGCTCCTGGCCTGGTCTCTGG - Intronic
1061962167 9:133993727-133993749 AGGGCTCCCACCCTGGACTCCGG + Intergenic
1062351719 9:136142878-136142900 AGGGATCCTTCCCGAGCCCCCGG - Intergenic
1062402041 9:136376988-136377010 AGGCCTCCTCCCCTGGTGCCAGG - Intronic
1062447760 9:136602755-136602777 ATGGCTCCTGCCCTTTTCCCAGG - Intergenic
1062477532 9:136736167-136736189 ATGGCTGCTTCCCTGGGCCCAGG + Intergenic
1062558794 9:137129998-137130020 CGGGCGCCTCCCCGGGTCCCGGG - Intergenic
1062586940 9:137253755-137253777 ACGCCTCCTTCCCAGTTCCCTGG - Intergenic
1062592803 9:137281613-137281635 AGCGCTCCCGCCCTGGGCCCAGG - Exonic
1062680658 9:137777999-137778021 AGGTTTCCTTCCCTGGTCCCTGG - Exonic
1203760998 EBV:12994-13016 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203761927 EBV:16066-16088 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203762856 EBV:19138-19160 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203763785 EBV:22210-22232 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203764714 EBV:25282-25304 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203765643 EBV:28354-28376 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203766572 EBV:31426-31448 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1203767501 EBV:34498-34520 AGGGTGCCTCCCCGGGTCCCAGG + Intergenic
1185517958 X:715230-715252 AGGGTTCCTTCCCTCCTCCCTGG + Intergenic
1185517988 X:715335-715357 AGGGATCCTTCCCTCCTCCCTGG + Intergenic
1186749537 X:12607124-12607146 GAGGCTCCTACCCTGGTCACTGG + Intronic
1189387755 X:40551235-40551257 AGGGCAATTTCCCTGGTGCCTGG + Intergenic
1189775245 X:44464742-44464764 AGGGCTCCTTCCCCTCTCACTGG + Intergenic
1191898684 X:66019557-66019579 AGCTCTTCTTCCCTGGGCCCTGG + Intergenic
1196964837 X:121044197-121044219 TGGGCTCATTCCCAGGACCCTGG + Intergenic
1197287049 X:124607837-124607859 ACTGCTCCTGTCCTGGTCCCAGG - Intronic
1199069237 X:143457288-143457310 AGGGCACCTTCCCTGGGCTTAGG - Intergenic
1200059191 X:153476762-153476784 CGGGCTGCATCCCTGGTTCCTGG + Intronic
1200084465 X:153596810-153596832 TGGTGTCCTTCCCTGGTGCCTGG - Intronic
1200162636 X:154017284-154017306 AGGGCTCATCCCTTTGTCCCTGG + Intronic
1201222921 Y:11789325-11789347 AGTGCTCCTGCCCCGGTCCTGGG + Intergenic