ID: 1163427140

View in Genome Browser
Species Human (GRCh38)
Location 19:17245888-17245910
Sequence GCAGCGCGAGGCCGGCGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 264}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163427140_1163427148 10 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427148 19:17245921-17245943 ACACACAGCGTTCCATTCGCGGG 0: 1
1: 0
2: 1
3: 4
4: 55
1163427140_1163427153 19 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427153 19:17245930-17245952 GTTCCATTCGCGGGGCGGGCGGG 0: 1
1: 0
2: 1
3: 4
4: 40
1163427140_1163427155 21 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427155 19:17245932-17245954 TCCATTCGCGGGGCGGGCGGGGG 0: 1
1: 0
2: 1
3: 11
4: 93
1163427140_1163427161 28 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427161 19:17245939-17245961 GCGGGGCGGGCGGGGGGCGGGGG 0: 3
1: 10
2: 146
3: 977
4: 5384
1163427140_1163427149 11 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427149 19:17245922-17245944 CACACAGCGTTCCATTCGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 21
1163427140_1163427151 15 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427151 19:17245926-17245948 CAGCGTTCCATTCGCGGGGCGGG 0: 1
1: 0
2: 1
3: 1
4: 26
1163427140_1163427152 18 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427152 19:17245929-17245951 CGTTCCATTCGCGGGGCGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 35
1163427140_1163427150 14 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427150 19:17245925-17245947 ACAGCGTTCCATTCGCGGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 31
1163427140_1163427154 20 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427154 19:17245931-17245953 TTCCATTCGCGGGGCGGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 69
1163427140_1163427160 27 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427160 19:17245938-17245960 CGCGGGGCGGGCGGGGGGCGGGG 0: 1
1: 12
2: 81
3: 668
4: 3041
1163427140_1163427159 26 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427159 19:17245937-17245959 TCGCGGGGCGGGCGGGGGGCGGG 0: 2
1: 0
2: 15
3: 204
4: 1533
1163427140_1163427157 22 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427157 19:17245933-17245955 CCATTCGCGGGGCGGGCGGGGGG 0: 1
1: 0
2: 1
3: 11
4: 164
1163427140_1163427158 25 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427158 19:17245936-17245958 TTCGCGGGGCGGGCGGGGGGCGG 0: 1
1: 2
2: 9
3: 147
4: 1080
1163427140_1163427147 9 Left 1163427140 19:17245888-17245910 CCCGCGCGCCGGCCTCGCGCTGC 0: 1
1: 0
2: 2
3: 31
4: 264
Right 1163427147 19:17245920-17245942 GACACACAGCGTTCCATTCGCGG 0: 1
1: 0
2: 1
3: 7
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163427140 Original CRISPR GCAGCGCGAGGCCGGCGCGC GGG (reversed) Exonic
900240683 1:1615935-1615957 GCGGCGCGCGGCAGGCGCTCTGG + Intronic
900349587 1:2228277-2228299 GCCGCGCGAGGACGGCCCGGCGG + Intergenic
900405581 1:2491589-2491611 GCAGCTCTAGGCAGGGGCGCTGG - Intronic
901086544 1:6614719-6614741 GAAGAGAGAGGCCAGCGCGCCGG - Intronic
902451322 1:16498788-16498810 GCAGGGCGGGGCCCGCACGCAGG + Intergenic
902501550 1:16914494-16914516 GCAGGGCGGGGCCCGCACGCAGG - Intronic
903413745 1:23167970-23167992 GCAGGGGGACGCCGGCGAGCGGG - Intronic
903852948 1:26319163-26319185 GCTGGGCGAGCCGGGCGCGCTGG + Intronic
903939815 1:26921905-26921927 GCAGCACGAGGGCGGCGTGCAGG + Exonic
904006600 1:27366354-27366376 CCTGCGCGAGGCTTGCGCGCAGG - Exonic
904093422 1:27960309-27960331 GCAGCGCCAGGCAGCGGCGCGGG - Exonic
904252973 1:29237790-29237812 CCAGCGAGGGGCCGGCGGGCGGG + Intronic
904253173 1:29238583-29238605 GCAGGGCGAGGCCCAAGCGCTGG - Intronic
904618927 1:31764059-31764081 GCAGCGCGGGGCGGGCGGGCGGG + Intronic
905731923 1:40303821-40303843 GCAGGGCGAGTCCGGCGAGCCGG - Exonic
906345353 1:45011160-45011182 GCAGCGCGGAGCCTCCGCGCCGG - Exonic
906917169 1:50023916-50023938 GCAACGGGCGGCAGGCGCGCGGG + Intergenic
907051071 1:51330330-51330352 GCGGCCCCAGGCCGGTGCGCGGG + Intronic
908293113 1:62687953-62687975 GCAGGAGGAGGCGGGCGCGCTGG + Intronic
910427637 1:87132420-87132442 GCCTCCCGAGGCCGCCGCGCCGG - Intronic
913300671 1:117366738-117366760 GCGGCGCGAGGCCGGAGCCCGGG + Intergenic
913450234 1:118988026-118988048 GCAGCGAGCGGGCGGCGCTCGGG - Intronic
913662960 1:121021065-121021087 GCAGAACGAGGCCGGCGCTGCGG - Intergenic
914014342 1:143804330-143804352 GCAGAACGAGGCCGGCGCTGCGG - Intergenic
914163479 1:145156871-145156893 GCAGAACGAGGCCGGCGCTGCGG + Intergenic
915530840 1:156501149-156501171 GCAGCGCCAGGCGGGCGGGCGGG - Intergenic
916390050 1:164321448-164321470 GCAGGGCGGCGGCGGCGCGCAGG - Intergenic
917490501 1:175494149-175494171 GCAGAGAGAGGCCGGCGGGAGGG - Intronic
918064238 1:181088971-181088993 GCAGCTTGATGCCGCCGCGCTGG - Exonic
918282943 1:183023488-183023510 GAAGCGCGGAGGCGGCGCGCGGG + Exonic
919748622 1:201023459-201023481 GCTGCGGGAGGCGGGGGCGCGGG + Exonic
921355608 1:214281573-214281595 GCAGCGCGGGGCCGCAGCGCGGG - Intronic
922416562 1:225427862-225427884 GAAGCCCGAGGCCGGCGCAGCGG - Intronic
923372499 1:233327742-233327764 GGAGCGCGCGGCGGGCGGGCCGG + Intergenic
924325442 1:242890472-242890494 GCAGCGCGAGGCCTGCTGGCCGG - Intergenic
924436786 1:244049191-244049213 GCTGCGGGAGGCCCGGGCGCGGG + Intronic
1064244338 10:13657209-13657231 GCAGCGGGCGGCGGGCGCACTGG - Exonic
1064418281 10:15168822-15168844 GCAGGGCGGGGCCGGCGGGCTGG - Intergenic
1064418290 10:15168840-15168862 GCAGGGCGGGGCCGGCGGGCAGG - Intergenic
1065024526 10:21527285-21527307 CGGGCGCGGGGCCGGCGCGCCGG + Intergenic
1065186319 10:23173769-23173791 GCAGCCCAAGGCCGGTGCTCCGG - Intergenic
1065186530 10:23174613-23174635 GCTCCGCGAGGCCGGCGGGGCGG - Intergenic
1067147289 10:43702851-43702873 GCAGCGCGAGGCCAGGAGGCTGG + Intergenic
1067710957 10:48650911-48650933 GCAGCACGAGGCCGGCCCAGGGG + Intronic
1070609988 10:77926563-77926585 GCCCCCCGAGGCCGGCGGGCGGG + Intergenic
1070954193 10:80454049-80454071 GGACCGCGAGGCCGGGTCGCCGG - Intergenic
1071345113 10:84685038-84685060 GCAGCGACAGGCCGGCTGGCTGG - Intergenic
1071629053 10:87203661-87203683 GCTGCGGGAGGCTGGCGCTCGGG + Intergenic
1071857981 10:89645087-89645109 GCGCCGTGGGGCCGGCGCGCGGG - Exonic
1071966473 10:90857701-90857723 GAGGCGCGTGGCCGGGGCGCCGG - Intergenic
1073009101 10:100346558-100346580 GCAGCGCGTGGCTGGTGGGCGGG + Intergenic
1073109118 10:101050380-101050402 GCGGCGCGGGGCAGGCGGGCGGG - Intergenic
1074182924 10:111078893-111078915 GCCGCGCGACACCGACGCGCTGG + Exonic
1074325465 10:112446843-112446865 GCAGCGAGAGGCTGGAGTGCGGG + Exonic
1075520822 10:123142688-123142710 GCAGCGCGTGGCCCTTGCGCAGG - Intergenic
1076750035 10:132537916-132537938 CGAGCGCGAGGCCGGAGCCCCGG + Exonic
1076753863 10:132557930-132557952 GCAGCAGGAGGCGGGCACGCGGG - Intronic
1076945028 10:133640729-133640751 GCTGCGCGGGGCCGGAGCGGGGG - Intergenic
1077361297 11:2141233-2141255 GCAGTGGGTGGCCGGCGAGCCGG + Exonic
1077522576 11:3045076-3045098 GTAGGGAGAGGCCGGCGGGCTGG + Intronic
1079296681 11:19241181-19241203 GCTGCGCGGGGCCTGAGCGCGGG + Intronic
1082243123 11:49891814-49891836 GCAGCGTGAGGCCGCGGGGCTGG - Intergenic
1083599625 11:63938887-63938909 GCAGCGGTGAGCCGGCGCGCAGG - Intergenic
1083660990 11:64251661-64251683 GCAGCGCGTGGACGCCGGGCTGG - Exonic
1084074458 11:66762290-66762312 GCAGCTCCTGGCCGGCGCCCCGG - Intronic
1084193268 11:67508519-67508541 GCAGCGCGAGTGAGGCGCGAGGG - Exonic
1085266488 11:75240802-75240824 GAAGCCGGAGGCCGGCGCGCAGG + Intergenic
1086590412 11:88508828-88508850 GCAGCCCGCGGCAGGGGCGCAGG - Exonic
1088481059 11:110296676-110296698 GCGGCGCGAGGACGGCCGGCCGG - Exonic
1090190392 11:124762755-124762777 GCAGGGAGAGGCCGGAGCGCCGG + Intergenic
1091724410 12:2835392-2835414 GCAGCCCAGGGCTGGCGCGCAGG + Intronic
1092861827 12:12725251-12725273 GGAGCGCGGGGCAGGCGCGCGGG - Intergenic
1096435850 12:51590944-51590966 GCAGCGCGCCGCCCGCCCGCAGG - Intronic
1096529406 12:52233692-52233714 CCAGCGCCTGGCCCGCGCGCAGG - Intronic
1102197041 12:111033622-111033644 GCTGCGGGAGGCGGGCGCGCGGG - Intergenic
1103400696 12:120641060-120641082 GCCGCGAGAGGAGGGCGCGCGGG + Exonic
1103595548 12:122022563-122022585 GCATCGCGGCCCCGGCGCGCGGG - Intronic
1103883980 12:124187497-124187519 TCAGCGCCAGGCCTGCGCCCAGG - Intronic
1104698171 12:130880171-130880193 GCAGCTGGAAGCCGGCGGGCAGG + Intergenic
1105492638 13:20903051-20903073 GCACCGCGAGGCCGGGGCGCCGG - Intergenic
1109024644 13:57142539-57142561 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109025631 13:57149109-57149131 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109026621 13:57155682-57155704 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109027613 13:57162253-57162275 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1109028599 13:57168818-57168840 GCAGAGAGAGGCCGGCGCCGGGG + Exonic
1113914882 13:113864122-113864144 CCAGCGCGCGGGCGGGGCGCGGG + Intergenic
1117647336 14:57865870-57865892 GCAGCGCGGGGCCCGGGAGCTGG + Intronic
1119106732 14:71932279-71932301 GCAGGGAGGGGCCGGCGGGCGGG - Intergenic
1121113320 14:91327380-91327402 GCAGCGAGAGGAGGGCACGCAGG - Intronic
1121226224 14:92323598-92323620 GCAGCGCGCACGCGGCGCGCGGG + Exonic
1122620872 14:103057193-103057215 GCGGTGAGAGGCCGGCGCGTCGG - Exonic
1124118253 15:26867362-26867384 GCCTCCCGGGGCCGGCGCGCAGG + Intronic
1125546750 15:40511773-40511795 GCTGCGCGAGGTCGGCGCTGGGG - Intergenic
1128344116 15:66842791-66842813 GCAGCGCGGGGGCCGCGCGCAGG + Intergenic
1128454126 15:67823234-67823256 GCCGCGCGTGGCCCGCGGGCGGG + Intronic
1132348190 15:101121200-101121222 CCAGCGTGAGGCCGGTGAGCTGG + Intergenic
1132365346 15:101252379-101252401 GGAGCGCGGGGCCGGCCCGGCGG - Intergenic
1132583110 16:694256-694278 GTAGCGCGAGGCCCCCGCCCCGG - Exonic
1132779301 16:1614181-1614203 AGGGAGCGAGGCCGGCGCGCAGG + Intronic
1132829076 16:1918696-1918718 GCAGGGACAGGGCGGCGCGCGGG + Intergenic
1132842367 16:1984315-1984337 GACGCGCGGGGCCGGGGCGCGGG + Exonic
1132865624 16:2091437-2091459 GCAGCGAGAGGCCCGCGCTGAGG + Exonic
1133916081 16:10111328-10111350 GCAGCGGCAGGCGGCCGCGCGGG + Intronic
1134070204 16:11255913-11255935 GCTGCGGGAGCCCCGCGCGCGGG + Intronic
1134073692 16:11276072-11276094 GCAGGGCAAGGCGGGGGCGCAGG + Intronic
1134656176 16:15949813-15949835 GCCGCGTGAGGCCGGCGGGACGG + Intronic
1136470126 16:30474190-30474212 GTAGCTCGAGGCCGGCGCTGAGG - Exonic
1139465252 16:67150781-67150803 TCAGCGCGAGGGAGGCGGGCGGG - Intronic
1139483975 16:67246148-67246170 GCAGCGCGAGGAATGCGGGCTGG + Intronic
1139545785 16:67648892-67648914 GCTGCGCTCGGCCGGCGCCCAGG + Exonic
1139754543 16:69132273-69132295 GCGGCGGGAGGGCGGCGCGGAGG - Intronic
1141538474 16:84699962-84699984 GCGGCGCGCGGCCAGTGCGCAGG + Intronic
1141620847 16:85235879-85235901 CCAGCGCGGGGGCGGGGCGCGGG - Intergenic
1141828100 16:86494903-86494925 CCAGCGCGAGGCCGGCTACCTGG + Intergenic
1142050006 16:87951787-87951809 GGAGCGCGAGGCCCCCGGGCCGG - Intronic
1142638264 17:1270923-1270945 GGGGCGCGGGGCTGGCGCGCAGG - Exonic
1142838652 17:2609295-2609317 GCAGCGGGAGCCGGGCGCGGTGG - Intronic
1144565171 17:16353570-16353592 GCAGCGCGGCGCCTGCCCGCAGG + Intronic
1147006349 17:37406962-37406984 GCAGCGCTGGGCGGGCGGGCGGG + Intronic
1147429623 17:40363416-40363438 GGCGCGCGCGGCGGGCGCGCAGG + Exonic
1148225471 17:45895644-45895666 GAGGCGCGGGGCTGGCGCGCAGG + Intronic
1148549703 17:48543283-48543305 GCTGCGCGGGGCCGGCGGGCTGG - Exonic
1150221095 17:63496366-63496388 GCAGAGCGAGGCCGTGGCCCGGG - Intronic
1150802210 17:68291349-68291371 GCGACGCGGGGCCGGGGCGCGGG - Intronic
1152212501 17:79009826-79009848 GCTGCGCGCGGACGGCGCGAGGG + Intronic
1152245541 17:79183037-79183059 GCGGCGCGAGGCGGGGGGGCCGG - Intronic
1152846717 17:82604952-82604974 GCAGCTCTTGGCCGGCGCGGTGG + Intronic
1152917849 17:83051334-83051356 GGAGCGCGGGGCAGGCGGGCGGG + Intronic
1154125570 18:11689532-11689554 GCACAGCGGGGGCGGCGCGCGGG - Exonic
1155152793 18:23135873-23135895 TCAGCCCGCGGCCGCCGCGCCGG + Exonic
1155176721 18:23307626-23307648 GGAGGGCGAGCCCGGGGCGCTGG + Intronic
1156099633 18:33578375-33578397 GCGGCGCGCGGCGGGCGGGCCGG - Intergenic
1158137563 18:54224143-54224165 GGAGCGCGGGGCCGGGGCCCAGG - Exonic
1159798222 18:72868194-72868216 GCTGCGCGCGGCCGGCGCCCCGG + Intergenic
1160797853 19:954062-954084 GCAGCTCAAGGCCGGGGCGGAGG + Intronic
1160812969 19:1020908-1020930 GGGGTGCGAGGCCCGCGCGCGGG + Exonic
1161150074 19:2702794-2702816 GCTGCGGGAGGCCGGAGCGGGGG + Intergenic
1161224421 19:3136455-3136477 GCAGCGCCAGGTCAGCGAGCGGG - Exonic
1162118393 19:8445666-8445688 GCGGAGCGCGGTCGGCGCGCGGG - Intronic
1162535867 19:11262518-11262540 GCGGGGCGGGGCCGGCGCGGGGG + Intergenic
1162959684 19:14118293-14118315 GAGGGGCGCGGCCGGCGCGCGGG + Intergenic
1163243215 19:16076781-16076803 GCGGCCCGAGGACTGCGCGCGGG - Intronic
1163368759 19:16890288-16890310 TCAGCGCGTGGCCGTAGCGCCGG - Exonic
1163427140 19:17245888-17245910 GCAGCGCGAGGCCGGCGCGCGGG - Exonic
1165080164 19:33302291-33302313 GCTGCGCGGGGCCCGCGCCCCGG + Exonic
1165774380 19:38396089-38396111 GCAGCGCGATGCGGCTGCGCCGG + Exonic
1165775751 19:38403446-38403468 GCAGCGAGAGGCGGGCGCGGAGG + Exonic
1166547204 19:43640465-43640487 GCAGGGCGAGGCTGGGGCTCAGG + Intergenic
1166852551 19:45767523-45767545 GAAGGGAGAGGCCGGCGCTCAGG + Intronic
1166957066 19:46471643-46471665 GCTGAGCCCGGCCGGCGCGCCGG + Intergenic
1166979389 19:46623805-46623827 GCAGCGCCAGGCGGGCGCAGCGG + Exonic
1168154093 19:54463630-54463652 CCAGAGCTAGGCCGGAGCGCGGG - Exonic
1168473670 19:56660930-56660952 GCAGCCCGACGCCTGCGCACTGG + Intergenic
1168728657 19:58606933-58606955 GCAGAGAGGGGGCGGCGCGCCGG - Intergenic
1168728665 19:58606963-58606985 GCAGAGAGGGGGCGGCGCGCCGG - Intergenic
1168728681 19:58607023-58607045 GCAGAGAGGGGTCGGCGCGCCGG - Intergenic
1168728688 19:58607053-58607075 GCAGAGAGGGGGCGGCGCGCCGG - Intergenic
924962367 2:46284-46306 ACGCCGCGCGGCCGGCGCGCAGG - Exonic
925218746 2:2120993-2121015 TCACCGGGAGGCCGGCGCGGAGG + Intronic
926077096 2:9950916-9950938 GCAGCGTGGGGCGGCCGCGCGGG + Intergenic
927542653 2:23926812-23926834 GCCGAGCAAGGCCGGCCCGCCGG + Exonic
929452824 2:42048164-42048186 GCCGCGCGGGGCCGGCCGGCCGG + Exonic
932567834 2:72920681-72920703 GCGGCGCGGTCCCGGCGCGCGGG + Intronic
935275795 2:101474385-101474407 GGAGCGCGCGGGGGGCGCGCGGG + Intronic
940322234 2:152389733-152389755 GCAGCACGAGGGCGGCGTGCAGG + Intronic
941463144 2:165794289-165794311 GGGGCGGGAGGCTGGCGCGCAGG - Exonic
941808602 2:169734107-169734129 GCAGCCCGAGGCCGGCCTGCTGG + Intronic
942681269 2:178480345-178480367 GCTGCGCGAGGAGGGCGGGCCGG - Intergenic
942947034 2:181683191-181683213 GCGTCGCGATGCCGGCGCCCCGG - Intergenic
943624220 2:190180783-190180805 GGAGCGCGCGGCGGGCGCGGCGG + Intronic
946231304 2:218292562-218292584 GCCCCACGAGGCCGGCGCGACGG - Intronic
946321992 2:218959795-218959817 GCAGAGCGGGGCCGGCGCCCAGG - Exonic
947754272 2:232550605-232550627 GCAGCGGAACGTCGGCGCGCAGG - Exonic
948438118 2:237967367-237967389 GCCGGGCGAGGCCAGCGCCCCGG - Intronic
948487203 2:238288577-238288599 CCTGCCCGAGGCCCGCGCGCCGG + Exonic
948824634 2:240568371-240568393 GGGGCGCGGGGCCGGGGCGCCGG - Intronic
948899460 2:240949063-240949085 GCCGCGCGAGTCCTGCGCTCCGG - Intronic
949023887 2:241755959-241755981 GCGGGCCGAGGCGGGCGCGCAGG - Exonic
1172064241 20:32207835-32207857 GCGGTGCGCGGGCGGCGCGCAGG + Intergenic
1172474568 20:35226993-35227015 GGCGCGCGGGGCCGGGGCGCGGG + Intronic
1173221567 20:41136858-41136880 GCAGCGCGGGGCTGGTCCGCAGG - Intergenic
1173690859 20:44960131-44960153 GCCGCGCGAGGCCCGGGCGGTGG + Intronic
1175121338 20:56718347-56718369 GCGGCCCGAGGGAGGCGCGCGGG - Intergenic
1175429503 20:58891622-58891644 GCAGCGCCGGGCGGGCGGGCCGG - Intronic
1178277421 21:31251832-31251854 GGTGCGCAAGGCCGGCGCCCTGG - Exonic
1180211587 21:46298064-46298086 GCAGCGCGTCGCGAGCGCGCTGG + Intergenic
1181079709 22:20405744-20405766 GCAGCGCGGGGCGGGCGCCGGGG + Exonic
1182532133 22:30968879-30968901 GCGGCGCGCGGGCGGCGCGCGGG - Intergenic
1182904029 22:33920974-33920996 GCTGAGCGAGTCCGGCGCTCTGG - Intronic
1183524924 22:38317257-38317279 GCCGGGAGAGGCTGGCGCGCCGG - Exonic
1183649512 22:39145842-39145864 GCAGGGCGAGCCCTGCGCGGCGG - Intronic
1185065752 22:48630991-48631013 GCAGCCAGGGGCCGGCGCTCTGG + Intronic
1185272697 22:49936097-49936119 GGAGCGCGGGGCCGGGGCGGCGG - Intergenic
949709861 3:6861152-6861174 TGAGCGCGAGCGCGGCGCGCCGG + Exonic
950374306 3:12557373-12557395 GCTGGGCGAGGCCAGCGCGGGGG + Intronic
950433982 3:12967692-12967714 GCAGCGCGAGGCCGGGCCGGAGG + Intronic
952241193 3:31532837-31532859 GCGCCGCGAGGCCGGCGGACTGG - Exonic
954076906 3:48188179-48188201 ACACCGCGAGGCCAGCGGGCGGG + Exonic
954702015 3:52455529-52455551 GCAGCGCGCGGCGGGGGCGACGG + Exonic
954823051 3:53347869-53347891 GCACCGCGAGGCCGGCACTTCGG - Intergenic
956761241 3:72447000-72447022 GCAGCCCGAGGCCGGCGACGGGG + Intergenic
961463789 3:127069231-127069253 GCAGCGCGAGGCCTACCAGCAGG + Intergenic
961502892 3:127350217-127350239 GCAGCGCCAGGCCTGGGTGCAGG + Intergenic
968225608 3:196970100-196970122 GGAGTGCGAGGCCGGCGGGGAGG - Intergenic
968448450 4:663986-664008 GGTGCGCGGGGCCGGCGGGCAGG - Intronic
968471998 4:786656-786678 GGAGCGCGAGGCCGAGGCCCAGG - Exonic
968508963 4:987093-987115 GCAGCGCGGCGCGGGGGCGCAGG - Exonic
968542016 4:1172610-1172632 TAAGCCCGAGGCCGGCGCCCCGG + Exonic
968967054 4:3774018-3774040 ACAGCAAGAGGCCGGCGTGCTGG + Intergenic
968978042 4:3831930-3831952 GCAGCGCCAGGCCTGTGCTCTGG - Intergenic
969422095 4:7103436-7103458 GCAGGGCGGGGCCGGGGCACTGG - Intergenic
969617733 4:8263156-8263178 GCAGCGCGAGGCCTGTGGGGTGG + Intergenic
971451361 4:26804647-26804669 GCAGCGCAGGCCCGGCGGGCGGG + Intergenic
981782486 4:148444109-148444131 GCAGAGCGCGGGCGGCGGGCGGG + Intronic
982042289 4:151408661-151408683 GCAGAGCTGGGCCGGGGCGCCGG + Intergenic
982198511 4:152937716-152937738 GCGGCGCGAGGGTGGGGCGCCGG - Intronic
984801803 4:183722990-183723012 GCCGAGCGAGGCGGGCGCCCTGG + Intergenic
985432441 4:189894020-189894042 GCAGCGCGGGGCGGGGGGGCGGG + Intergenic
985448411 4:190041239-190041261 GCTGCGCGGGGCCGGAGCGGGGG - Intergenic
985555631 5:556647-556669 GTAGCTCGTGGCCGGCGCGGTGG - Intergenic
985580605 5:693593-693615 GCAGGGCGCGGCCGACCCGCGGG + Intergenic
985895571 5:2748627-2748649 GCTGCCCGCGGCCGCCGCGCCGG - Exonic
986330522 5:6713664-6713686 GCGGCGCGGGGCGGGCGCGGGGG - Intergenic
987050480 5:14143787-14143809 GCAGCCCGAGCCAGCCGCGCTGG - Exonic
988482071 5:31639306-31639328 GCAGCTCGGGGCAGGCGCGGCGG + Intergenic
989643211 5:43603232-43603254 GCCGCGAGAGGACGTCGCGCTGG - Intronic
990699690 5:58460848-58460870 GCAGAGCGAGGTCGGCGTCCTGG + Intergenic
1002349930 5:178576767-178576789 GGACCGAGAGGCCGGCGCGGCGG - Intronic
1002559432 5:180071651-180071673 GCAGGGCGAGCGCGGCGAGCCGG + Exonic
1002888177 6:1313432-1313454 GCGGGGCGAGGCCGGGGCGGCGG - Exonic
1003942713 6:11044475-11044497 GCCGCGCCAGGAGGGCGCGCGGG + Intergenic
1004203884 6:13574285-13574307 CCTGCGGGAGGCGGGCGCGCCGG - Intergenic
1005039467 6:21588189-21588211 GCTGCGCGTGCACGGCGCGCGGG - Intergenic
1005569732 6:27133197-27133219 GCGGGTCGGGGCCGGCGCGCCGG + Exonic
1005648555 6:27865480-27865502 GCGGGTCGGGGCCGGCGCGCCGG + Exonic
1005651960 6:27893002-27893024 GCGGGTCGGGGCCGGCGCGCCGG - Exonic
1006470168 6:34224139-34224161 GCAGCGTGAGTCAGGCGCGGAGG + Intergenic
1007390190 6:41546357-41546379 GCTGCGAGCGGGCGGCGCGCGGG - Intergenic
1007897457 6:45377650-45377672 CCAGGGCGTGGCCGGCGCGGGGG + Intronic
1013225765 6:108118540-108118562 GCAGGGGGCGGCCGGCGCGGCGG + Intronic
1013242608 6:108260558-108260580 GCAGAGCGAGCCCGGCGCGCTGG - Intronic
1015149332 6:130020205-130020227 GCGGCGCGAGGACGGCCCGCGGG - Intronic
1017206455 6:151808332-151808354 GGTGCGCGAGGCCGGCCCGCCGG + Exonic
1019279277 7:192182-192204 GGAGCGCGGGGCCGGGGCCCAGG - Intergenic
1019461350 7:1160495-1160517 GGAGCGCGAGGCCGGCCTGAGGG + Intronic
1019626203 7:2016942-2016964 GCCGCGCAAGGCCGGGGCGGGGG + Intronic
1019660730 7:2222682-2222704 GGAGCGGGAGGCCGGGGCGGAGG - Exonic
1020278238 7:6637328-6637350 GCTGCGCGACGGCGGCGCGTGGG - Exonic
1022018436 7:26376184-26376206 GCAGCGCGGGGGATGCGCGCGGG - Intergenic
1022107210 7:27205162-27205184 GCAGTGCGCGGCCAGCCCGCGGG + Intergenic
1023071741 7:36441581-36441603 GCAGCAAGAGGCAGGCGCTCTGG + Intronic
1024554356 7:50590717-50590739 CCAGCGCGAGGCCAGCGAGCTGG + Exonic
1024639360 7:51316849-51316871 GCGGCGCGGGGCGGGGGCGCCGG + Intergenic
1026360554 7:69598439-69598461 GCTGCGCGAGGCAGGCGGGCGGG + Intergenic
1027001811 7:74658734-74658756 GCCCCGCGGGGCAGGCGCGCCGG - Intronic
1029715089 7:102321392-102321414 GGAGGGCGAGGCAGGCGGGCAGG - Exonic
1034426940 7:151018909-151018931 GCGGCGCGAGCCTGGCGCGCTGG - Exonic
1034951148 7:155297857-155297879 GCAGCGCCTGGCGGGCGCGCGGG - Exonic
1035751848 8:2002056-2002078 GGTGGGCGCGGCCGGCGCGCAGG - Exonic
1036528319 8:9556113-9556135 GCAGCGCTAGGCCGTGCCGCGGG - Exonic
1037481884 8:19313498-19313520 GCAGCTCGGGGACAGCGCGCGGG + Intergenic
1038575845 8:28702308-28702330 GCAGCGCGAGGCCGGCTCTAGGG - Intronic
1042877021 8:73449133-73449155 GCAGTGGGAGGGCGGCGGGCAGG + Intronic
1045231412 8:100310175-100310197 ACAGCACGCGGGCGGCGCGCTGG - Intronic
1047381870 8:124372059-124372081 GCAGCACCAGGACGGCGGGCGGG + Exonic
1048214248 8:132480809-132480831 GGCGCGCGAGGCTGGCGCGGAGG + Exonic
1049465889 8:142751154-142751176 GCAGCGCAGGGCCGGCGCTGGGG + Exonic
1049668348 8:143858802-143858824 CCAGCACGCGGCCGGCGCCCTGG - Exonic
1049668764 8:143860401-143860423 CCAGCACGCGGCCGGCGCCCTGG - Exonic
1049669179 8:143862003-143862025 CCAGCACGCGGCCGGCGCCCTGG - Exonic
1049669594 8:143863605-143863627 CCAGCACGCGGCCGGCGCCCTGG - Exonic
1049670004 8:143865198-143865220 CCAGCACGCGGCCGGCGCCCTGG - Exonic
1049765657 8:144354176-144354198 GCGGCGCGGGGCCGGCCCTCAGG + Intronic
1049789159 8:144465240-144465262 GCAGGCCGAGGCCGCCGCGTGGG - Intronic
1049996821 9:1042686-1042708 GCAGCGGGAGGAGGCCGCGCGGG - Intergenic
1051170317 9:14314328-14314350 GCGGGGCGAGGCGGGCGGGCGGG - Intronic
1053555484 9:39132871-39132893 GCAGCCCGAGGGCCGCGCCCCGG + Intronic
1053819602 9:41953122-41953144 GCAGCCCGAGGGCCGCGCCCCGG + Intronic
1054109867 9:61096775-61096797 GCAGCCCGAGGGCCGCGCCCCGG + Intergenic
1054610990 9:67234350-67234372 GCAGCCCGAGGGCCGCGCCCCGG - Intergenic
1057038958 9:91833643-91833665 GCAGCTCGAGGCGGGCATGCAGG - Intronic
1059251348 9:112890312-112890334 GCAGCCCGAGGCGGGAGAGCAGG + Exonic
1059375198 9:113876085-113876107 GCACGGCGAGGCCGGCCCGGGGG + Intergenic
1059633979 9:116154493-116154515 GCAGCTCGAGGTCGGCCCGGAGG - Exonic
1060296480 9:122346987-122347009 GCAGCCCGGGACCGCCGCGCGGG - Intergenic
1060952267 9:127612018-127612040 GCCGCGCGCGCCCGGGGCGCAGG - Intergenic
1061208578 9:129177962-129177984 GCAGCTTGATGCCGCCGCGCTGG + Exonic
1062022622 9:134326574-134326596 GCAGCGGGCGGCGGGCGCGGCGG - Exonic
1062542962 9:137049617-137049639 GCAGGGGGAGGCCGGTGCCCAGG - Intronic
1062568768 9:137174904-137174926 GCAGCGCCTGGCGGGCGGGCGGG + Exonic
1062592796 9:137281589-137281611 GGAGCTCGAGCTCGGCGCGCAGG + Exonic
1062699162 9:137890151-137890173 GCAGCGCGGGGCTGGCTCACTGG + Intronic
1199179641 X:144838525-144838547 GCAGGGCGCGGCCGGCGGGCAGG - Intergenic
1200003466 X:153073419-153073441 GGAGAGCGTGGCCGGCGCCCTGG + Exonic
1200004257 X:153076590-153076612 GGAGAGCGTGGCCGGCGCCCTGG - Intergenic
1200125186 X:153810153-153810175 GCAGCTCGAGGCAGGCGTGCAGG + Intronic
1200128969 X:153830809-153830831 GCCGGGCGAGGCGGGAGCGCGGG - Intergenic
1201222955 Y:11789465-11789487 GCGGCGCGAGGCCTGCTGGCCGG - Intergenic