ID: 1163427216

View in Genome Browser
Species Human (GRCh38)
Location 19:17246112-17246134
Sequence GGGCAGAGGGAGGCGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3585
Summary {0: 1, 1: 1, 2: 30, 3: 359, 4: 3194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163427216_1163427237 16 Left 1163427216 19:17246112-17246134 CCCTCCCCCGCCTCCCTCTGCCC 0: 1
1: 1
2: 30
3: 359
4: 3194
Right 1163427237 19:17246151-17246173 GCCCTCGCCCTCGCCCAGCTCGG 0: 1
1: 0
2: 1
3: 24
4: 235
1163427216_1163427239 17 Left 1163427216 19:17246112-17246134 CCCTCCCCCGCCTCCCTCTGCCC 0: 1
1: 1
2: 30
3: 359
4: 3194
Right 1163427239 19:17246152-17246174 CCCTCGCCCTCGCCCAGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163427216 Original CRISPR GGGCAGAGGGAGGCGGGGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr