ID: 1163430479

View in Genome Browser
Species Human (GRCh38)
Location 19:17264213-17264235
Sequence ATCTGGGTGTGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 0, 2: 6, 3: 88, 4: 879}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163430460_1163430479 20 Left 1163430460 19:17264170-17264192 CCCTGCTCTGAGCCAGGCAGGAC 0: 1
1: 0
2: 4
3: 43
4: 377
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430461_1163430479 19 Left 1163430461 19:17264171-17264193 CCTGCTCTGAGCCAGGCAGGACA 0: 1
1: 0
2: 9
3: 33
4: 440
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430457_1163430479 26 Left 1163430457 19:17264164-17264186 CCGGGGCCCTGCTCTGAGCCAGG 0: 1
1: 0
2: 8
3: 99
4: 820
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430455_1163430479 28 Left 1163430455 19:17264162-17264184 CCCCGGGGCCCTGCTCTGAGCCA 0: 1
1: 0
2: 3
3: 54
4: 374
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430465_1163430479 8 Left 1163430465 19:17264182-17264204 CCAGGCAGGACAGGACCTTGGGG 0: 1
1: 0
2: 1
3: 25
4: 266
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430454_1163430479 29 Left 1163430454 19:17264161-17264183 CCCCCGGGGCCCTGCTCTGAGCC 0: 1
1: 1
2: 1
3: 52
4: 425
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430456_1163430479 27 Left 1163430456 19:17264163-17264185 CCCGGGGCCCTGCTCTGAGCCAG 0: 1
1: 0
2: 5
3: 61
4: 575
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879
1163430469_1163430479 -7 Left 1163430469 19:17264197-17264219 CCTTGGGGTCCCCAGGATCTGGG 0: 1
1: 0
2: 6
3: 55
4: 651
Right 1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG 0: 1
1: 0
2: 6
3: 88
4: 879

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163430479 Original CRISPR ATCTGGGTGTGGAGGGGAGA GGG Intronic
900103060 1:971022-971044 ATCAGGGTGGGGAGGGGGGTGGG - Intronic
900131809 1:1090421-1090443 AGCTGGGCCTGGAGGGGACACGG + Exonic
900185406 1:1331005-1331027 AGCAGGCTGTGGAGAGGAGAGGG - Intergenic
900200220 1:1401360-1401382 AGCTGCCTTTGGAGGGGAGACGG + Intronic
900277174 1:1838320-1838342 GTCTGGGTGAGGAGGGTACATGG - Intronic
900312507 1:2040972-2040994 AGCTGGGTGTGGAGGGAAAGGGG - Intergenic
900788189 1:4662919-4662941 GCCTGGAGGTGGAGGGGAGAGGG + Intronic
900990952 1:6098064-6098086 AACTGGATGTGGGGGTGAGAAGG + Intronic
901167223 1:7229438-7229460 AGGGGGGTGTGAAGGGGAGAAGG + Intronic
901474536 1:9480438-9480460 AGCTGGGTGTGGAGTGGAGTTGG - Intergenic
901515700 1:9744445-9744467 ATCTCGGTGTGGATGAGACATGG - Exonic
902777346 1:18683132-18683154 CTCTGGGGGTGCAGGGGAGATGG - Intronic
902931763 1:19736439-19736461 ACCTGGGAGTGGAGGGTGGATGG - Intronic
903321866 1:22548167-22548189 AGAGGGGTGTGGAAGGGAGAGGG - Intergenic
903741637 1:25561962-25561984 AGTTGGGTTTGGAGGGGTGAGGG + Intronic
903851839 1:26311931-26311953 ATGTGGGTGGAGAAGGGAGAAGG - Intronic
904036401 1:27561373-27561395 ATCAGGTTGTGGAGGGGCTAAGG - Intronic
904320929 1:29697465-29697487 CTCGGGGTGTGCAGGGTAGATGG - Intergenic
904345519 1:29866315-29866337 TTCTGGGAGCAGAGGGGAGAGGG - Intergenic
904567046 1:31434399-31434421 GTGTGGGTGTGGCGGGGGGATGG - Exonic
905615118 1:39391413-39391435 ATGTGTGTGTGGAGAGGAGGAGG + Intronic
905652638 1:39666772-39666794 ATCAGGTTTGGGAGGGGAGAAGG - Intronic
905822725 1:41006366-41006388 TTCTGGGAGTTGAGGGGAGTAGG - Intronic
906190153 1:43893667-43893689 ATCTGGGCCTGGAGAGGAGATGG - Intronic
906781438 1:48576326-48576348 ACCAGGGTTAGGAGGGGAGATGG - Intronic
907221170 1:52907839-52907861 ATCTGGGTGTGGGGTGGAGGAGG - Intronic
907784968 1:57602780-57602802 GTGTGTGTGTGGAGGGGAGTGGG + Intronic
907875873 1:58487782-58487804 ATATGTGTGTTGAGGGGGGAGGG - Intronic
907896274 1:58695321-58695343 ATCTGTTTGTTAAGGGGAGAAGG - Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
908128607 1:61053202-61053224 ATCTGGAGGAAGAGGGGAGAAGG - Intronic
908856644 1:68437242-68437264 ATTTAGGGGTGTAGGGGAGATGG - Intronic
909195419 1:72615472-72615494 AACTGGGGGTTGAGGGGTGATGG + Intergenic
909463690 1:75948332-75948354 ATGTGTGGGTGGAGTGGAGAGGG + Intergenic
909836402 1:80260580-80260602 GCCTGGGTGTGGAGTGGAAAGGG - Intergenic
910194328 1:84624656-84624678 ATTTGGGTGTGGGGGGGTGGGGG - Intergenic
910292314 1:85611505-85611527 ATCAGAGTGAGGAGGGGGGAAGG + Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912799963 1:112714491-112714513 TTCTGGGTGTGGAGGGGGAGGGG + Intronic
912891760 1:113540594-113540616 AATTGGGTGTGGAGGTTAGAAGG + Intronic
913203059 1:116511809-116511831 AGCTGGGTGTGTAGGTGTGATGG + Intergenic
913203976 1:116518617-116518639 AGCTGGGTGTTGAGGGATGAGGG - Intronic
913248586 1:116892294-116892316 TTCTGGGATTGGAGGAGAGAAGG + Intergenic
914196692 1:145451509-145451531 ATCTGTGTGTGGAGGGGGCTGGG - Intergenic
914685037 1:149970934-149970956 GTCTGGGTTTGGCTGGGAGAAGG + Intronic
915603085 1:156934719-156934741 ATCTGGGTCTGGGGGTGAGAGGG + Intergenic
915778452 1:158517908-158517930 ATCTGTGGGTGGATGGGACATGG + Intergenic
915978418 1:160405610-160405632 ATCAGGGTGGGGCAGGGAGAGGG + Intronic
916062517 1:161109903-161109925 AGCTGGGCGTGGTGGGGGGAGGG + Intronic
916123749 1:161551064-161551086 CTCTGTGTGTGGCGGGGGGAGGG - Intergenic
916239252 1:162622806-162622828 ATCAGGATGTAGAGGGGATAGGG - Intergenic
916348255 1:163819235-163819257 ATCTGAGGGTAGATGGGAGAGGG + Intergenic
916457698 1:164987870-164987892 ATTTGGCTGGGGAGGGGATAGGG - Intergenic
916575009 1:166059358-166059380 ATCTGGGTGGGGAGGGGCAAGGG + Intronic
917359358 1:174159501-174159523 AACTGAGAGGGGAGGGGAGAAGG - Exonic
917623178 1:176818901-176818923 AATTGGGAGTGGTGGGGAGATGG - Intronic
917732665 1:177891740-177891762 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
917956213 1:180101669-180101691 ATGTGTGTGTGGAGGGGGCAGGG - Intronic
918543543 1:185657619-185657641 AGAGGGGTGGGGAGGGGAGAAGG - Intergenic
918667576 1:187171522-187171544 ACCTGGGTGTGAATAGGAGAGGG + Intergenic
920403528 1:205692390-205692412 AGCTCGGTGTGAAGGGGAGTGGG - Intergenic
920699879 1:208209700-208209722 ATCTGGGTGGGGAGCTGGGAAGG + Intronic
920753234 1:208702691-208702713 ACCTGGGTGTGGAGCCAAGATGG + Intergenic
920793299 1:209113368-209113390 ATCTGGGGGCGGAGGTTAGAAGG - Intergenic
921122993 1:212152904-212152926 AATAGGGTGTGGAGGGCAGAAGG + Intergenic
921252623 1:213311804-213311826 AGCTGTGTGAGGTGGGGAGATGG + Intergenic
921347585 1:214202982-214203004 TTCCTGGGGTGGAGGGGAGAAGG + Intergenic
921440644 1:215182201-215182223 GCCTGGGTGTGGAGCAGAGAGGG + Intronic
921627727 1:217396531-217396553 ATTTGGGGGTGGGGAGGAGAGGG - Intergenic
921660550 1:217795940-217795962 AGCTGGGCGTGGTGGTGAGAAGG - Intronic
921926189 1:220711720-220711742 ATGTGTGTGTTGAGGGGAGTGGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922003508 1:221504529-221504551 ACCTGGGCATGGAGGGGAGAGGG - Intergenic
922068853 1:222170839-222170861 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
922465002 1:225840370-225840392 CTCTGGGGCTGCAGGGGAGAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923622334 1:235588836-235588858 ATGTGGGTGTGGAGTGGAGTAGG - Intronic
924172976 1:241360311-241360333 ATCTGGGTGTGAAGTGGGGGAGG - Intergenic
924435549 1:244037450-244037472 GGCTGGCTGTGGAGGGTAGAGGG + Intergenic
1062804931 10:411524-411546 ATTTGGGGGTTGAGGGGAAACGG + Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1063113954 10:3060160-3060182 AGCAGGGTCTGGAGGGGAGGAGG + Intergenic
1064102154 10:12473088-12473110 ATGTGGGGCAGGAGGGGAGAGGG + Intronic
1064445972 10:15393232-15393254 ATCTGGGGGAGGAGGAGAGAAGG + Intergenic
1065461995 10:25977834-25977856 ATCTGGAAGTGGAAGTGAGATGG - Intronic
1065752829 10:28903429-28903451 ACCTGTGTGGGGAGGAGAGAAGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066104426 10:32144464-32144486 AGCTGGGTGTGGTGGTGACAGGG + Intergenic
1066189678 10:33044909-33044931 GACAGGGTATGGAGGGGAGATGG + Intergenic
1066352801 10:34652367-34652389 ATATGGGTGTGATGGGGAGAGGG + Intronic
1066506477 10:36049800-36049822 ATTTGGGTGGGGAGGGATGAAGG + Intergenic
1067256506 10:44647545-44647567 AACTGGGTGTGGAGGGGCACTGG - Intergenic
1067283488 10:44890825-44890847 TTCTGGGTGTGGTGTGGAAAAGG - Intergenic
1067559977 10:47298440-47298462 TTCTGGGGGGGAAGGGGAGAGGG + Intergenic
1067942283 10:50667213-50667235 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1068072455 10:52212585-52212607 ATATGGCTGTTGGGGGGAGAGGG + Intronic
1068780463 10:60914188-60914210 TTTTGGGTGTGGAGGGGGCAGGG + Intronic
1068955113 10:62814713-62814735 GGCTGGGGGTGGAGGGGAGTTGG - Intronic
1069240287 10:66129965-66129987 ATGGTGGTGTGGTGGGGAGAAGG - Intronic
1069346463 10:67476424-67476446 GTCTGGGAGTGGGGTGGAGAGGG - Intronic
1069891501 10:71655315-71655337 ATCTGAGTGGGCAGGAGAGAAGG - Intronic
1070485332 10:76924989-76925011 AGCTGGGTTGGGAGGGAAGAGGG - Intronic
1070765441 10:79053582-79053604 AACTGGGTCTGGGAGGGAGAGGG + Intergenic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1070863529 10:79692171-79692193 CTCTGAGTGTGGATGGGAGGGGG + Intergenic
1071203747 10:83251090-83251112 ATTTGGGTTTGTAGGGGACAAGG + Intergenic
1071440116 10:85682673-85682695 ACTAGGGTGTGGAGAGGAGATGG + Intronic
1071529029 10:86375074-86375096 ATGTGGGAATGGAGGGCAGAGGG - Intergenic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1073295533 10:102436182-102436204 ATGTGGGGCTGGAGGGGTGAGGG - Intergenic
1073331754 10:102674497-102674519 ATCTGAATGTGCGGGGGAGAGGG - Exonic
1073866682 10:107812674-107812696 ATGTGGGTGTGGTGAGGGGAAGG + Intergenic
1074746184 10:116534850-116534872 ATTTGAGGGTGGAGGGTAGAAGG - Intergenic
1074831795 10:117254671-117254693 AGCTGGGGGTGGAGGGGATCAGG + Intronic
1075345803 10:121681225-121681247 ATCTGAGTGAGGTGGAGAGAAGG + Intergenic
1075744655 10:124718397-124718419 ATGTGGGGGTAGAAGGGAGAAGG - Intronic
1075786060 10:125050941-125050963 ATCTGGATGAGGAGGGTGGATGG + Intronic
1075863312 10:125696322-125696344 ATGTGGGTGGGGAAAGGAGAGGG + Intergenic
1075906833 10:126088916-126088938 ATCTGGGTGTAGATTGCAGAAGG + Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076094062 10:127716069-127716091 ATCTGGGGGTGAGGGTGAGAAGG - Intergenic
1076619129 10:131775793-131775815 AGGTGGGAGTGGAGAGGAGAAGG + Intergenic
1076668489 10:132105894-132105916 GTCTGGCGGTGGAGGGGAGTCGG + Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077077306 11:707468-707490 GTCGGGCTGTGGAGGGGAGGAGG - Intronic
1077194467 11:1272337-1272359 GTCTGGGTGGGGAGGCGAGGAGG + Intergenic
1077221752 11:1421007-1421029 ATCTGGGTGCAGAGCAGAGAGGG + Intronic
1077239214 11:1501934-1501956 GGCTGGGTGTGGAGGGGTGCAGG - Intergenic
1077644605 11:3912218-3912240 ATAAGGGAGGGGAGGGGAGAAGG - Intronic
1077998683 11:7475664-7475686 TATTGGGTGAGGAGGGGAGAAGG + Intergenic
1078699856 11:13669339-13669361 AGCTGGGAGTGAAGGGGGGACGG + Intronic
1078772546 11:14364258-14364280 ATCTGAGGGTAGAGTGGAGAGGG + Intronic
1078865122 11:15289915-15289937 ATATGGGTGTAGAGAGTAGACGG + Intergenic
1079007282 11:16800846-16800868 ATCTGGGGCTGAGGGGGAGAAGG + Intronic
1079103929 11:17558603-17558625 AACTGGCTGTGAAGGGCAGAGGG - Exonic
1079128175 11:17733388-17733410 ATCTGTGTGTGGTGGGTAAAAGG - Intergenic
1079531354 11:21458061-21458083 ATCTGGCTGTGAAGAGAAGAAGG + Intronic
1079553480 11:21730345-21730367 AGCTAGGTGTGGAGTGGATAGGG - Intergenic
1079888423 11:26017988-26018010 ATCGGGGGGTGGAGGGGGGGAGG + Intergenic
1080019594 11:27546108-27546130 GTCTGTGTGAGGAGAGGAGATGG + Intergenic
1080070314 11:28076168-28076190 GTCTGTGTTTGGAAGGGAGAGGG + Intronic
1080232507 11:30033806-30033828 ACCTGAGTATGGAGGGTAGAAGG + Intergenic
1080574205 11:33583504-33583526 ATATGGAAGTGGTGGGGAGAGGG + Intronic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1081207532 11:40293111-40293133 ACCGGAGTTTGGAGGGGAGAGGG - Exonic
1081630795 11:44688332-44688354 ATGTGGGTGAGGAAGAGAGAGGG - Intergenic
1081690546 11:45074951-45074973 GGCTGGGTGTGGGGAGGAGAAGG - Intergenic
1081812135 11:45920119-45920141 AGCAAGGTGTGGAGGGGAGAGGG + Intergenic
1081864133 11:46350497-46350519 ATGTGGGTGGGGTGGGGAGGGGG - Intronic
1081869566 11:46377177-46377199 AGCAGGGTGAGGTGGGGAGAGGG - Exonic
1082581623 11:54876835-54876857 CTATGGTTGTGGAGGGGGGAGGG + Intergenic
1082811764 11:57482825-57482847 AGATGGCTGGGGAGGGGAGAGGG - Intergenic
1083155756 11:60821959-60821981 GCCTGGGGGTGGAGGGGGGAGGG - Intergenic
1083432142 11:62619146-62619168 ATCTCGGTGTTGCGGGGAGGCGG + Intronic
1083599512 11:63938332-63938354 CTCAGGGTTTAGAGGGGAGACGG - Intergenic
1084167671 11:67383573-67383595 GGCTGGAGGTGGAGGGGAGATGG - Intronic
1084315098 11:68341343-68341365 TTCTGGGTGTGGGTGGGGGATGG - Intronic
1084336520 11:68460944-68460966 TTCCGGGGGGGGAGGGGAGAGGG - Intronic
1084621406 11:70272243-70272265 ATCTGGCTGTGAAGGGGAGCCGG - Exonic
1084678182 11:70649114-70649136 ATATGGGTGAGAAGGGGAGATGG - Intronic
1085175319 11:74481657-74481679 ATCTGGGTTTACAGGGGAGAGGG + Intergenic
1085177671 11:74505047-74505069 AGCAGGGAGAGGAGGGGAGAAGG + Intronic
1085433339 11:76475874-76475896 AGCTGGTTGTAGAGGGGAAAGGG + Intronic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087104965 11:94399672-94399694 ATCTGGTTGTGTATGAGAGATGG + Intronic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1087332626 11:96800156-96800178 ATCAGAGGGTGGAGGGTAGAGGG - Intergenic
1088425478 11:109696932-109696954 GCCTGGGTGTGGGGTGGAGAGGG - Intergenic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1088884121 11:113993896-113993918 ATGAGGCTGTGGTGGGGAGACGG + Intergenic
1088893252 11:114060368-114060390 ATCTGGGGGCGGAGGGGAGCAGG + Intronic
1088906680 11:114160270-114160292 ATCTGGTTGGGGTGGGGTGAAGG + Intronic
1089012378 11:115141750-115141772 ATCTGGGTGGGGAAGTGGGAGGG - Intergenic
1089125242 11:116172176-116172198 ATGTTTGGGTGGAGGGGAGAGGG - Intergenic
1089127855 11:116190029-116190051 AGCTGGGGGTGGAGGGGAGAGGG + Intergenic
1089151183 11:116365657-116365679 CTCAGGGTGAGGATGGGAGAGGG - Intergenic
1089561444 11:119345337-119345359 ATCAGGGAGTGGCAGGGAGAAGG - Intronic
1089747938 11:120630003-120630025 ATTTGTGTGTGGGGGAGAGAGGG + Intronic
1089895795 11:121929021-121929043 ATGTGAGTGTGGAGGAGAGGGGG + Intergenic
1090552959 11:127842666-127842688 ATCAGGGTGGGGTGGGGTGAAGG - Intergenic
1090889542 11:130911252-130911274 ATCTGGGTGTTAAGGAAAGAAGG + Intronic
1091590830 12:1842195-1842217 ATCAGGGCGTGGAGTGCAGAAGG + Intronic
1091751452 12:3023829-3023851 ATTTGGGTGTGGGGAGGAGTAGG - Intronic
1091988942 12:4938798-4938820 AACTGGATGTGGAGGTGGGAAGG + Intergenic
1092193715 12:6536897-6536919 CTATGGGGGTGGGGGGGAGATGG - Intronic
1092484534 12:8891037-8891059 ATCTGGGAGGGGAGGGCAAAGGG + Intergenic
1093061780 12:14614838-14614860 TTCTGGGTGTGGCAGGGACAGGG - Intronic
1093134810 12:15437666-15437688 TCCTGGGTGTGGAGCAGAGAGGG - Intronic
1093728352 12:22541612-22541634 ATTTGTGTGTGTAGGGGAGTGGG - Intronic
1093841860 12:23912831-23912853 ATGGGGGTGGGGAGGGGAAATGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094842902 12:34349388-34349410 GGGTGGGTGTGGAGGGGACAAGG + Intergenic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1095915689 12:47475488-47475510 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1096386078 12:51196217-51196239 ATCTGGGTTTGGGGTGGAGCTGG - Intronic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096522954 12:52194426-52194448 GACGGGGTGAGGAGGGGAGAGGG - Intergenic
1096549762 12:52364365-52364387 ACCTGGGTGTGGGAGAGAGAAGG + Exonic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1098149788 12:67534944-67534966 AGGTGGTTGTGGAGGGGAGTTGG + Intergenic
1098162557 12:67659175-67659197 ATCTGGGTGTTGGGGGTAGTGGG + Exonic
1098512979 12:71341014-71341036 CTCTTGGTGGGGTGGGGAGAGGG - Intronic
1099743246 12:86668889-86668911 GTCTGGGGGTGGAGCAGAGAGGG - Intronic
1100166151 12:91920477-91920499 AACTGGGTGTAGTGGGGACAGGG - Intergenic
1100245197 12:92750728-92750750 GGCTGGGAGTGGAGGGGAGCAGG - Intronic
1100246419 12:92762326-92762348 ATTTGGAGGTGGAGGAGAGAGGG + Intronic
1101921988 12:108940704-108940726 ATTTTGGTGGGGAGGGGATAGGG - Intronic
1102229574 12:111253154-111253176 ATCTGGCTGTTGTGCGGAGAAGG - Intronic
1102547080 12:113665034-113665056 GTCTGTGTGTGCAAGGGAGACGG - Intergenic
1102583875 12:113909735-113909757 AAGTGGGTCTGGAGGTGAGAAGG - Intronic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1102803776 12:115761320-115761342 AGCTGGGGGTGGAGGAGAAAAGG - Intergenic
1103417440 12:120752501-120752523 ATCTGGGTGGAGACAGGAGATGG + Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104836625 12:131795977-131795999 ATAGGGGAGGGGAGGGGAGAGGG + Intronic
1106482129 13:30144478-30144500 AGATGGGTGTGGAGGTGATAAGG - Intergenic
1107014688 13:35698540-35698562 AGCTGGCAGTGGAGGTGAGATGG - Intergenic
1107158543 13:37198196-37198218 GCCTGGGGGTGGAGTGGAGAGGG + Intergenic
1107628758 13:42320311-42320333 ATCTGGGTGGGGCGGGGTGGGGG - Exonic
1107787541 13:43970730-43970752 AGCAGGGTGAGGTGGGGAGAGGG - Intergenic
1107928579 13:45287678-45287700 TTCTTGGTTTGGAGGTGAGATGG - Intergenic
1108282532 13:48874304-48874326 CTCTGGGTGTGGAGGATAAAGGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108682852 13:52794253-52794275 ATATTGGAGTGGAGGGGAGATGG - Intergenic
1109572096 13:64206558-64206580 AGCTGGGTGTGGAGCGGTGAGGG + Intergenic
1110080255 13:71300431-71300453 GTCTGGGTGTGGAGGGCAACTGG + Intergenic
1110334630 13:74313248-74313270 ACCTGAGTGTGGAGGGTAGGAGG - Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110739549 13:78978377-78978399 GTATAGGTGGGGAGGGGAGAGGG + Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1110840137 13:80132834-80132856 ATGTGGGTGTGAGGGGGAGGTGG - Intergenic
1111453178 13:88446025-88446047 ATTTGGCTGTGAAGGTGAGAGGG - Intergenic
1112135246 13:96570942-96570964 TTCTGTGTGTGGATGAGAGAAGG + Intronic
1112216263 13:97434132-97434154 ATCTGGGCGTGGAGGCGCGAGGG + Intergenic
1112235849 13:97635922-97635944 ATCTGGCTGTGGGGGTGGGAAGG - Intergenic
1112622510 13:101066555-101066577 ATCTCGGTGTGCAGGGCAGTGGG + Intronic
1112827380 13:103407579-103407601 ATCTGGGTGTAAAAGGGAGAAGG - Intergenic
1113333192 13:109352033-109352055 GTGTGTGTGTGGAGGTGAGAGGG + Intergenic
1114220741 14:20694053-20694075 TTCTGGGTGCAGAGGGGAAATGG - Exonic
1114450401 14:22821872-22821894 GTCTGGGTGCGGCGTGGAGATGG + Intronic
1114492561 14:23112642-23112664 GGCTGGGGATGGAGGGGAGAAGG + Intergenic
1114568214 14:23647716-23647738 TTCTGGATGTTGAGGGGGGAGGG + Intergenic
1114832731 14:26164401-26164423 GCCTGGGTGTGGAGTGTAGACGG + Intergenic
1114864809 14:26577007-26577029 ACCAGGGTGGGGAGGGGAAATGG - Intronic
1114960928 14:27888172-27888194 ATCAGGGTGTGGGGGTGAGTGGG + Intergenic
1115326640 14:32146440-32146462 ATATGGATGTTGAGGAGAGAGGG + Intronic
1117160155 14:52981587-52981609 ATGTGGGGGTGGAGGGTATATGG - Intergenic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117414340 14:55479931-55479953 CTATGGGAGGGGAGGGGAGAGGG - Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118678160 14:68211210-68211232 CACTGGGTGGGGAGGGGAAAGGG - Intronic
1118872155 14:69752480-69752502 ATCTCTGTCTGGAGGGGAAAGGG + Intronic
1119153065 14:72383230-72383252 GTATGTGTGTGGATGGGAGAGGG + Intronic
1119411277 14:74432362-74432384 ACCAGGGTGTGGAGGAGAGATGG - Intergenic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119536241 14:75404731-75404753 ATTTGAATGTGGACGGGAGAGGG + Intergenic
1120121054 14:80680519-80680541 GTCTGCGTGTGGAGCAGAGAGGG - Intronic
1120183364 14:81367793-81367815 CTCTGGGCCTGGAGGGCAGATGG + Intronic
1120320550 14:82955182-82955204 ATATGCGTGTGGAGGGTAGGAGG - Intergenic
1120521328 14:85530915-85530937 AACAGCTTGTGGAGGGGAGAGGG - Intronic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1122606074 14:102948287-102948309 GGGTGGGTGTGGAGGTGAGACGG + Intronic
1122606166 14:102948499-102948521 TGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122606250 14:102948707-102948729 GGGTGGGTGTGGAGGTGAGAGGG + Intronic
1122746383 14:103899484-103899506 CTCCGGGTGGGGTGGGGAGATGG + Intergenic
1123633736 15:22281194-22281216 TTTTGTGTGTGGGGGGGAGAGGG - Intergenic
1124218003 15:27825480-27825502 GGCTGGGAGTGGCGGGGAGAGGG + Intronic
1124955209 15:34355825-34355847 CCTTGGGTGTGGAGAGGAGAGGG + Exonic
1125727019 15:41873343-41873365 ATCTGGGTGGGAAGTGGGGATGG + Intronic
1126701578 15:51372617-51372639 ATCTGGTGGTGCTGGGGAGAGGG - Intronic
1126745971 15:51826948-51826970 AGCTGGGTGTGGTGGGGTGGGGG + Intergenic
1126998362 15:54473005-54473027 ATGTGGGGGTGGGGGAGAGAGGG - Intronic
1127538153 15:59910386-59910408 ATCTGGGTGGGGATGGGCGAGGG + Intergenic
1128212722 15:65913688-65913710 ATGTGTGTGTGGAGGGGAAGAGG + Intronic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1128732726 15:70032050-70032072 ATCTAGATGTGGAGAGGTGAAGG + Intergenic
1129139630 15:73585603-73585625 ATCCAGGTGTTGGGGGGAGAAGG + Intronic
1129513867 15:76144617-76144639 ACCTGGGTGTAGAGTGGTGAAGG - Intronic
1129714567 15:77839690-77839712 ATCTGTGTGGAGATGGGAGAAGG - Intergenic
1130130906 15:81142066-81142088 ACGTGGGTGGGGAAGGGAGATGG - Intronic
1130381934 15:83379046-83379068 ACCTGGGAGTGGTGGGGGGAGGG + Intergenic
1130559229 15:84945469-84945491 GTTTGGATGTGGAGGGGAAACGG - Exonic
1130747350 15:86669832-86669854 AAGTGTGTGTGGAGGGGAGTGGG + Intronic
1131369157 15:91865367-91865389 ACATGGGCTTGGAGGGGAGAGGG + Intronic
1132667125 16:1086636-1086658 TTGTGTGTGTGGAGGGGTGAGGG + Intergenic
1132715840 16:1289432-1289454 AGCTGGGAGTGGGGGGGAGGGGG + Intergenic
1133140043 16:3736948-3736970 AGCTGGGTGTGGTGGGGGCAAGG + Intronic
1133256316 16:4518545-4518567 ATGTGGATATGGAGGGGTGAGGG - Intronic
1133512023 16:6468938-6468960 ATCTGAGGGTGGAGGGTGGAAGG - Intronic
1133565935 16:6993451-6993473 ATCAGAGTGGGAAGGGGAGATGG + Intronic
1133788297 16:8989762-8989784 ATCTGGGTGTGGCAGCCAGAGGG - Intergenic
1134054418 16:11160525-11160547 ATCTAGGTGTGGTGGGCTGAAGG - Intronic
1135127631 16:19824213-19824235 ATCTGGGGGGTGATGGGAGATGG + Intronic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136138671 16:28274848-28274870 ATGTGGGAGTGGGTGGGAGAGGG + Intergenic
1136674995 16:31895006-31895028 GTCTGGCTGTGAAGGGGAGCCGG + Intronic
1137712547 16:50576329-50576351 ATCTGGAGGAGGAGAGGAGAGGG - Intronic
1138591511 16:58001648-58001670 GTCTGGGGGTGGAGTGGGGAGGG + Intronic
1139342563 16:66278024-66278046 GCCTGGGTGTGGAGAAGAGAGGG - Intergenic
1139342618 16:66278346-66278368 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1139516280 16:67454169-67454191 CTGTGGGAGTGGAGTGGAGAGGG + Intronic
1140727211 16:77824303-77824325 AGCTGGTTCTGGAGAGGAGAGGG + Intronic
1140906376 16:79412794-79412816 CTCTGGGTGTGAATGGGGGAGGG - Intergenic
1141174467 16:81709925-81709947 TTCTGGGGGCGGAGGGGGGAGGG + Exonic
1141223392 16:82092264-82092286 CTCTTGGGGTGGAGGGGAGGTGG - Intronic
1141900335 16:86986869-86986891 ATCAGGGAGGGGAGGGGAGGGGG + Intergenic
1141999841 16:87658014-87658036 TCCTGGGTGTGGAGGGGACTGGG + Intronic
1142065088 16:88057742-88057764 ATCTGGGTGGGGCGGGGGGGGGG + Intronic
1142142834 16:88480165-88480187 ATCTGGATGGGGAGAGGAGGAGG - Intronic
1142376168 16:89708162-89708184 ATCTGCCTGGGGAGGGGATAAGG - Intronic
1142501497 17:335738-335760 ACCTGGGAGGGGAGGGGAGTGGG - Intronic
1142809523 17:2388756-2388778 GACTGAGTGTGGAGGGGAGCTGG - Intronic
1142875962 17:2852515-2852537 TGCTGGGTGGAGAGGGGAGAGGG - Intronic
1143164206 17:4889844-4889866 ATCTGGGGGTGGGGGAGAGAAGG - Intronic
1143168128 17:4909279-4909301 GTCTTTGTGTGGAGTGGAGAGGG - Intergenic
1143290385 17:5823490-5823512 ACCTGGGGGTGGGGAGGAGATGG + Intronic
1143519182 17:7435999-7436021 AGCTGGGTGTGCAGGAGAGCTGG + Exonic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1143868401 17:9940592-9940614 TTCTGGGGCTGGAAGGGAGAGGG - Intronic
1144095173 17:11893706-11893728 GTCAGGGGGTGGAGGGGAAAGGG + Intronic
1144452601 17:15393561-15393583 ATCTGGGTGTGGAAAGGGGCGGG - Intergenic
1144734459 17:17547259-17547281 ATCTGTGTGTGGAGAGGGGTCGG - Intronic
1145116296 17:20213639-20213661 ACCTGAGTCTTGAGGGGAGAGGG + Intronic
1145272047 17:21410030-21410052 AGGCTGGTGTGGAGGGGAGAGGG - Intronic
1145310256 17:21697493-21697515 AGGCTGGTGTGGAGGGGAGAGGG - Intronic
1145792670 17:27637709-27637731 ATATGGTGGTGGTGGGGAGAGGG + Intronic
1145807543 17:27745577-27745599 ATATGGTGGTGGTGGGGAGAGGG + Intergenic
1145898083 17:28472277-28472299 GTCAGGGTGAGGAGGGGTGAGGG + Intronic
1146722930 17:35136073-35136095 AGCTGGGTCTAGAAGGGAGAAGG + Intronic
1146824187 17:36009179-36009201 AGCTGGGAGGAGAGGGGAGAAGG - Intergenic
1146825211 17:36016318-36016340 ATCGGGGAGTGGAGGGTAAAAGG - Intronic
1146836801 17:36117556-36117578 ATCTGAGTGTGGGAGGGAGAAGG - Intergenic
1146985208 17:37209590-37209612 ATTTGGATGTGGAGAGGAAAGGG - Intronic
1147140948 17:38460452-38460474 ATCTGAGGGTGGCGGGTAGAAGG - Intronic
1147401210 17:40180974-40180996 ACGGGGGTGTGGAGGGGAAAGGG + Intronic
1147428532 17:40357487-40357509 AGCTGGGGGTGCAGGGGTGAGGG - Intronic
1147510108 17:41060720-41060742 ATTTGGGGGTGGAGGGGGAAAGG + Intergenic
1147644875 17:42027568-42027590 GACTGGGTCAGGAGGGGAGAGGG - Intronic
1147996549 17:44363116-44363138 AGCTGGGTTTGAAGGGGGGAGGG - Intronic
1148110918 17:45144357-45144379 GCCTCTGTGTGGAGGGGAGAGGG + Intergenic
1148235181 17:45964002-45964024 CTCTGGGTGAGGAGGTGAGAGGG + Intronic
1148445614 17:47735147-47735169 GGCTTGGGGTGGAGGGGAGAGGG + Intronic
1148690631 17:49524969-49524991 GGCTGGGAGTGGAGGGGAGGGGG - Intergenic
1148732964 17:49848871-49848893 ATCTGGGTGGATAGGCGAGAGGG - Intergenic
1148737824 17:49874663-49874685 AGGTGGGCGTGGAGGGGAGGGGG - Intergenic
1149114234 17:53072507-53072529 ATCTGGGGATAGAGTGGAGAGGG + Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150270626 17:63862197-63862219 ATTTGGGTGAGGGGAGGAGAGGG + Intergenic
1150274253 17:63885719-63885741 ATTTGGGTGAGGGGAGGAGAGGG + Intergenic
1150276399 17:63900546-63900568 ATTTGGGTGAGGGGAGGAGAGGG + Intergenic
1151130969 17:71895563-71895585 ATCTGTGTGTGGAGGAGGGGAGG + Intergenic
1151327812 17:73389706-73389728 CTGTGAGTGGGGAGGGGAGAGGG + Intronic
1151358174 17:73572422-73572444 ATGTGGGGGTGGATGGGAGCTGG - Intronic
1151486146 17:74402088-74402110 AGCTGGGAGTGGAGGGGCAAAGG - Intergenic
1151951486 17:77356670-77356692 ATGTGGGGGGGGAGGGGAGGGGG - Intronic
1152066151 17:78113497-78113519 CTCTGAGCCTGGAGGGGAGAGGG - Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152577989 17:81151315-81151337 ATGTGGGGGAGGAGGGGTGAGGG - Intronic
1152889743 17:82873714-82873736 GTCTGGGTGTGGAGGGCTGGGGG + Intronic
1153014818 18:573968-573990 ATCTGGGAAAGAAGGGGAGAGGG + Intergenic
1153246169 18:3074409-3074431 AGCTGGATGTGAAGGGGACAGGG - Intronic
1153314687 18:3710356-3710378 AGCTGGGTGTGGAGGAGAAAGGG - Intronic
1153543750 18:6185321-6185343 GTATGGATCTGGAGGGGAGAAGG - Intronic
1153763743 18:8355546-8355568 ATTTGGGTGTGGAAGTGACAAGG + Intronic
1153933591 18:9900901-9900923 TGCTGGGTGTGGAGATGAGATGG + Intergenic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1155893283 18:31292840-31292862 ATCTGGGTGTGGTGGGGGTGGGG - Intergenic
1156084250 18:33379950-33379972 GGCTGGGTGTGGAGCAGAGAGGG + Intronic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1156084395 18:33381254-33381276 AGCTGGGTATGGAGCAGAGAGGG + Intronic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156640236 18:39086272-39086294 TTGTGGGTGTGGAGGTGTGAAGG + Intergenic
1157106796 18:44781495-44781517 AGGTGGGGGTGGGGGGGAGAGGG - Intronic
1157189561 18:45569249-45569271 AACTGGGTTTAGACGGGAGAAGG - Intronic
1157241435 18:46013700-46013722 ATATGAGTCTGGAGGGGAAATGG - Intronic
1157317330 18:46603279-46603301 AGCAGGGAGTTGAGGGGAGAGGG + Intronic
1157752587 18:50193272-50193294 CTCTGGGGGAGGAGGGGAGGAGG - Intronic
1157918470 18:51692741-51692763 GTGTGTGTGTGGAGGGGAGGGGG + Intergenic
1158452304 18:57578187-57578209 ATATGGCTGAGGTGGGGAGAGGG + Intronic
1158497524 18:57969992-57970014 ATGTGGGTGTGGAGTGATGAAGG - Intergenic
1158532222 18:58273921-58273943 CTCTCTGTGTGGATGGGAGAGGG - Intronic
1159018331 18:63121406-63121428 TTCTGGGGATGGAGGAGAGAGGG - Intergenic
1159087811 18:63813897-63813919 TTCTGGGGGTAGTGGGGAGAAGG - Intergenic
1159731429 18:72033164-72033186 ATCTGCTTGAGGAGAGGAGATGG - Intergenic
1159775891 18:72602313-72602335 CTCTGGGTCTGGTGAGGAGAAGG + Intronic
1160002965 18:75045052-75045074 ATCTGGGTGTGGGGGGGTGTGGG + Intronic
1160294340 18:77623721-77623743 AGGTGGGTGTGCAGGTGAGAAGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1160440286 18:78884334-78884356 GCCTGGGTGTGGAGTGGAGAGGG - Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160764184 19:799830-799852 ACCTGGCTGTGGAGGGGACCTGG + Intronic
1160978906 19:1807494-1807516 AGCTGGGCTTGGACGGGAGAAGG - Intronic
1161207857 19:3051203-3051225 GGCTGGGAGTGGAGGGGACAGGG - Intergenic
1161302395 19:3548920-3548942 ATCTGGGGGTGGGGAGGAGCTGG + Intronic
1161529854 19:4781683-4781705 ATCTGGCTGGGGAGGGAAGGAGG - Intergenic
1161840650 19:6678285-6678307 AGCCTGGAGTGGAGGGGAGAGGG + Exonic
1161980692 19:7628734-7628756 ATCTGGGCCTGGGGTGGAGATGG - Intronic
1162068234 19:8138363-8138385 CTGTGGGTGAGGAGGGGACAGGG - Intronic
1162069445 19:8144967-8144989 AGATGGCTGTGGAGGAGAGAGGG + Exonic
1162139544 19:8577505-8577527 AGCTGGGTGTGGAGGGGGGCGGG + Exonic
1163034373 19:14562731-14562753 CCCTGGGTGTGGCGGGGAAATGG + Intronic
1163382873 19:16980259-16980281 CTCTGTGTGTGCAGGGGACAGGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163994929 19:21035702-21035724 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164269638 19:23660196-23660218 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164279102 19:23752696-23752718 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164777114 19:30861585-30861607 ATTTGTCTGTGCAGGGGAGAAGG + Intergenic
1164813221 19:31174759-31174781 ACATTGGTATGGAGGGGAGAGGG + Intergenic
1164986694 19:32653591-32653613 ATCTGGGTGAGCACAGGAGAAGG + Intronic
1165112778 19:33511994-33512016 AGCTGAGTGTGGAGAGGATATGG - Intronic
1165186911 19:34030626-34030648 ATGGGGGTGGGGAGTGGAGAGGG + Intergenic
1165235342 19:34416323-34416345 AACTGGGTGTGGTGGGGAGGTGG + Intronic
1165773349 19:38390514-38390536 ACCTGGGGAGGGAGGGGAGAGGG + Intronic
1165899421 19:39161876-39161898 ACCTGCGTGAGGAGGGGAGAGGG - Intronic
1165922055 19:39305383-39305405 AGCTGGTTGGGGAGAGGAGAGGG - Intergenic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166535287 19:43570026-43570048 ATCTGGGTGTGGAGTACACAGGG + Intronic
1166547318 19:43640969-43640991 GTCTGGGCGGGGAGGGGGGAGGG - Intergenic
1166612456 19:44211047-44211069 AGCTGGGCGTGGTGGGGAGGGGG + Intronic
1166778058 19:45324183-45324205 ATCTGAGGGGGGAGGGGAGAGGG + Intergenic
1166988654 19:46677757-46677779 AGCTGGGAGTGGATGGGAGTGGG - Intronic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167161047 19:47767218-47767240 ACGTGGGTGGGGTGGGGAGAAGG - Intergenic
1167354373 19:48994077-48994099 ATCTGGGGGAGAAGGGGACATGG + Intronic
1167637067 19:50661484-50661506 AGCTGTGTGTGCTGGGGAGAGGG + Intronic
1167647476 19:50713548-50713570 TTCTGGGTGTTTAGGGGAGGAGG + Intronic
1168147861 19:54429779-54429801 CCCTGGGTGGGGAGGGGAGCTGG + Intronic
1168151557 19:54451538-54451560 ATTTGGTTGTGGTGTGGAGAGGG + Intronic
1168283685 19:55320165-55320187 GGCTGGGAGTAGAGGGGAGAAGG + Exonic
1168547021 19:57261319-57261341 ATGTGGGAGGGGTGGGGAGAAGG + Intergenic
925422601 2:3724977-3724999 GTCTGGGTTGGGAAGGGAGAGGG + Intronic
925529094 2:4839682-4839704 ATCTGGACGTGGAGTTGAGAGGG + Intergenic
925969847 2:9098657-9098679 TGCTGGGTGTGGGGAGGAGAGGG - Intergenic
926415217 2:12643022-12643044 ATCTGTGTGTGGGCGAGAGAGGG - Intergenic
926706738 2:15842781-15842803 ATCTCCGTGGGGAGGGGAGCTGG - Intergenic
927008477 2:18877424-18877446 ATCAGAGGGTGGAGGGTAGAAGG - Intergenic
927240458 2:20916056-20916078 AGGTGGGTGTGGAGTGGGGAGGG + Intergenic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
928234724 2:29529701-29529723 ATCTGTGTGGTGAGGGTAGAAGG - Intronic
928337719 2:30412390-30412412 ATCTGGCTGTGGAGACGTGAGGG - Intergenic
928467445 2:31535616-31535638 GTCCAGGTGTGAAGGGGAGAGGG - Intronic
928624115 2:33122026-33122048 ATGTGTGTGTGGAGGGGGGCAGG - Intronic
929099936 2:38301931-38301953 TTCTGCGTGAGGAGAGGAGAGGG + Intronic
929122329 2:38493889-38493911 ATCTGGGATAGGAGGGGAGAGGG + Intergenic
929859890 2:45667743-45667765 AACTAGGTGTGGAGGTGAGGGGG - Intronic
930361867 2:50390746-50390768 ATGTGTGTGTTGAGGGGAGGTGG - Intronic
930842651 2:55864662-55864684 ATGAGGGTGGGGAGGGGTGAGGG + Intergenic
930877229 2:56232732-56232754 ACCTGGATGTGGAGTGGTGAGGG - Intronic
931057998 2:58494322-58494344 ATCTGCCTGTGGAGGGGGGTGGG + Intergenic
931248788 2:60512504-60512526 TTCTGGGTTGGGAGGGGAGCCGG - Intronic
931516578 2:63053736-63053758 GTGTGTGTGTGCAGGGGAGAGGG + Intronic
932443191 2:71751272-71751294 ATCTGGGCCTGGAGTGGTGATGG + Intergenic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
933264701 2:80169298-80169320 AGCTGGGATCGGAGGGGAGAGGG + Intronic
933457422 2:82534174-82534196 ATTTGGGTGTGAGGGAGAGAGGG + Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
933739903 2:85525223-85525245 ATCCTGGGGTGGAGGGGAGAGGG + Intergenic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935186633 2:100740134-100740156 ATCTGAGGCTGGAGTGGAGAAGG - Intergenic
935412530 2:102780709-102780731 TTGTGGGTGTGGAGGGGATGTGG + Intronic
936068344 2:109348815-109348837 ATCTGGGGGCGGCGGGGAGCAGG - Intronic
936290631 2:111221073-111221095 ATTTGGGTGTGGGGGTGAGAGGG - Intergenic
936359448 2:111784297-111784319 AGCTGGGTGTGGTCGGGAGTTGG - Intronic
936611334 2:114004869-114004891 AGATGGGTGTGGTGGGGAGGTGG + Intergenic
936699405 2:114992587-114992609 AGCTGTGTGGGGAGTGGAGAGGG - Intronic
936820205 2:116510868-116510890 GCCTGGATGTGGAGTGGAGAGGG + Intergenic
936921549 2:117694193-117694215 AACTAGGTGTGGAAGGGAGAAGG - Intergenic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937159614 2:119747590-119747612 AGCTGGGTGGGGAGGGTGGAAGG + Intergenic
937900680 2:127016717-127016739 ATGGGGCTGCGGAGGGGAGAAGG - Intergenic
937982098 2:127621958-127621980 TGGTGGGTGAGGAGGGGAGAAGG - Intronic
938739844 2:134220701-134220723 AGGAGGGTGAGGAGGGGAGAAGG - Intronic
939024111 2:136991491-136991513 ACCTGGGTATGCAGTGGAGAGGG + Intronic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
940235260 2:151504722-151504744 ATCTGCGTATGGATGGGAAAAGG + Intronic
940404375 2:153283929-153283951 GCCTGGGTGTGGAGCTGAGAGGG + Intergenic
940441889 2:153725299-153725321 ACTGTGGTGTGGAGGGGAGAGGG + Intergenic
940677811 2:156746560-156746582 TTCTGGGTGTGGAGGGAAAATGG - Intergenic
940982254 2:160016922-160016944 AACTGGGTGGGCAGGAGAGAGGG + Intronic
941003232 2:160222524-160222546 ATGTGGGTGAGGAAGGGGGATGG - Intronic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
941867239 2:170347906-170347928 GTCAGGGGCTGGAGGGGAGAAGG - Intronic
942538973 2:176995659-176995681 CTCTAAGTGTGGAGGAGAGAAGG - Intergenic
942816825 2:180061652-180061674 AGCTGAGAGTGGAGGAGAGAGGG + Intergenic
943322520 2:186463103-186463125 ATAAGGGTGTGGAGGGCAGGGGG - Intergenic
943733280 2:191325958-191325980 ATCTGGAAATGAAGGGGAGATGG + Intronic
943912297 2:193584295-193584317 GCCTGGGTGTGGAGCAGAGATGG - Intergenic
944453386 2:199867478-199867500 ATTTGGGAGTAGAGGGGAGGTGG - Intergenic
944610506 2:201400463-201400485 AGCTGGGGGGAGAGGGGAGAAGG + Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
945098205 2:206239354-206239376 ATCAGTATGTGGAGGGGAGGGGG + Intergenic
945188440 2:207163412-207163434 AGCAGGGGGAGGAGGGGAGAAGG + Intronic
945494934 2:210498785-210498807 GCCTGGGTGTGGAGTGTAGAGGG + Intronic
945495012 2:210499238-210499260 GCCTGGGAGTGGAGTGGAGAGGG + Intronic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
946227099 2:218269874-218269896 AGTCGGGTGTGGAGGGGAGCGGG + Intronic
946420841 2:219563626-219563648 ATCTGGGTGGGAAGCAGAGATGG + Exonic
946543134 2:220707616-220707638 ATGTGGATGTGGATGGGAGTAGG - Intergenic
946577375 2:221090161-221090183 ATTCAAGTGTGGAGGGGAGAAGG + Intergenic
947444935 2:230156392-230156414 GTCCAGGTGAGGAGGGGAGATGG - Intergenic
947943104 2:234075908-234075930 AACTGGGTGAGGTGGGGAGGAGG - Intronic
948229828 2:236341744-236341766 TGCTGTGTGTGGTGGGGAGAAGG + Intronic
948510897 2:238464547-238464569 TCCTGGGTGTGGCGGGGAGCGGG - Intergenic
948623776 2:239253861-239253883 ATCTGGGTGGGCAGGAGAGGTGG + Intronic
948625734 2:239266847-239266869 ACCTGGGTGTGGGGTGGAGCAGG - Intronic
948733158 2:239979966-239979988 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948733172 2:239980008-239980030 ATGTGGGGGTGTAGGGGAGCAGG - Intronic
948809425 2:240467152-240467174 ATCTGGGTGAGGATGGGAGCAGG - Exonic
948964601 2:241367954-241367976 ATGTGGGGGTGGAGGGTATATGG - Intronic
1168795090 20:606048-606070 ACCTGGGGGTGGAGGGGGCAGGG - Intronic
1168964701 20:1892417-1892439 ATCTGGGGTGGGAGTGGAGATGG - Intergenic
1169276570 20:4237096-4237118 ATGTGGATCTGAAGGGGAGAGGG + Intronic
1169375602 20:5064429-5064451 AGCTGGGTGTGGTGGGGCGTGGG + Intergenic
1169530157 20:6476513-6476535 CTCTGTGTGTGGTGGGGGGATGG + Intergenic
1169615592 20:7440578-7440600 ATCTGGTGGTGGAGCAGAGAAGG + Intergenic
1169618352 20:7475871-7475893 ATCTGACTGAGAAGGGGAGAGGG - Intergenic
1170827862 20:19811521-19811543 CAGTGGGTGTGGAGGGGACAAGG + Intergenic
1170881970 20:20304760-20304782 AGCTGTGGGTGGAGAGGAGAGGG + Intronic
1170905798 20:20514474-20514496 ATCTGGATGTGGAGTGGAGAGGG - Intronic
1171257494 20:23701197-23701219 ACCTGGGTGTGGAGTACAGAGGG - Intergenic
1171364968 20:24617339-24617361 AGCTGGGTGCGGAGGTGACAGGG - Intronic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1171936917 20:31283523-31283545 ATCTGAGGGTGGAGGGCAGGAGG + Intergenic
1172007612 20:31828256-31828278 CTCTGGGTGTGGAGCAGGGAAGG + Intronic
1172102467 20:32493424-32493446 GTCCAGGTGTGGAGGGGAGTGGG + Intronic
1172399592 20:34638300-34638322 ACCTGGGTGTGGGGTGGTGAGGG - Intronic
1172907686 20:38381146-38381168 ATCAGGTTGAGGAGAGGAGAGGG - Intergenic
1173000811 20:39104373-39104395 ATCTGTGTGTGGGGGAGAGGAGG + Intergenic
1173014675 20:39214427-39214449 AAGTGGGTGTGAAGGGGGGAAGG + Intergenic
1173198614 20:40937520-40937542 AACTGGATATGGAGGTGAGAGGG + Intergenic
1173227073 20:41168314-41168336 CCCTGGCTGTGGAGGGGAGGGGG - Intronic
1173347712 20:42216103-42216125 ATGTGAGTGTGGAACGGAGAAGG - Intronic
1173586654 20:44187517-44187539 ATCGGGGAAGGGAGGGGAGAGGG + Exonic
1173658211 20:44715487-44715509 ATTTGGGTGTGGAGGGGGTGGGG + Intronic
1173865267 20:46308750-46308772 ATCTGGGGTTGGAGGAGGGAGGG - Intergenic
1174213047 20:48895112-48895134 AGCTGGGAGTGGAGGGGGCAGGG + Intergenic
1174905869 20:54550532-54550554 ATGTGGTGGTGGAGGAGAGAGGG - Intronic
1175084252 20:56445578-56445600 CTCTGGGTGTCGAGGGGGGCCGG - Intronic
1175224952 20:57439386-57439408 AGCTGGGGGTGCAGGGCAGAGGG - Intergenic
1175374572 20:58515360-58515382 GTTTGGGTGTGGTGGGGAGCGGG - Intergenic
1175430622 20:58900066-58900088 ATCTGAGGGGGGAGGGGGGATGG + Intronic
1175595225 20:60225606-60225628 ACCTGTGTGTGGAGGTGCGAGGG + Intergenic
1176002639 20:62839853-62839875 GTGTGTGCGTGGAGGGGAGAAGG - Intronic
1176946603 21:14989782-14989804 ATGTGTGTGTGGAGGTGAGGAGG + Intronic
1178116864 21:29426843-29426865 CTCTTTGTCTGGAGGGGAGAAGG - Intronic
1178345633 21:31825511-31825533 AGGTGGGTGTGAGGGGGAGAAGG - Intergenic
1178347824 21:31846969-31846991 ATCTGGGTATGTGGGGGAGGAGG + Intergenic
1178524998 21:33320247-33320269 TTTTTGGTGGGGAGGGGAGAGGG - Intergenic
1178923316 21:36754504-36754526 AGCTGGGCGTGCTGGGGAGAGGG + Intronic
1179804318 21:43827169-43827191 ATCTGGGTGTGGGGGGTATGGGG + Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180853593 22:19033417-19033439 TGCTGGGTGTGGGGGGGGGAAGG - Intergenic
1181444985 22:22963436-22963458 ATGGGGGTGGGAAGGGGAGAGGG - Intergenic
1182081412 22:27531698-27531720 AGCTGGGAGTGGAGGGAAAAGGG + Intergenic
1182585180 22:31340919-31340941 ATCTGAGTGGGAAGGGCAGAGGG + Intronic
1182666596 22:31964664-31964686 ATGTGTGTGTGGTGGGGTGAGGG + Intergenic
1182709184 22:32310047-32310069 AGCGGGGTGGGGAGGGGGGAGGG + Intergenic
1182777352 22:32840639-32840661 ATCTGGGTGGGGGGCGGAGGGGG - Intronic
1182920265 22:34072806-34072828 TGCTGGATGTGGAGGAGAGATGG + Intergenic
1182950781 22:34373739-34373761 ATATGGCTGGGGAGGGGGGAAGG + Intergenic
1183093335 22:35538444-35538466 AAGTGGGTGGGGAGGGGGGAAGG + Intergenic
1183261288 22:36797523-36797545 CTCTGGGTGGAGAGGGGAGAGGG + Intergenic
1183291084 22:37002388-37002410 ATGGGGGTGAGGAGGGGAAACGG + Intronic
1183339362 22:37271072-37271094 ATGGGGGTGAGGAGGGTAGAGGG + Intergenic
1183700525 22:39448512-39448534 TGCTGGGTGTGGAGGAGAGGAGG + Intergenic
1183748149 22:39704114-39704136 CCCTGGGAGGGGAGGGGAGAAGG + Intergenic
1183827308 22:40398443-40398465 ATCTGGCTGTGGAGGCCTGAAGG - Intronic
1183948296 22:41339032-41339054 TCGTGGGCGTGGAGGGGAGAAGG - Exonic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184113880 22:42410895-42410917 ATCTGGGTGTGGAAAGGGCAGGG - Intronic
1184187321 22:42873472-42873494 CTCTGGGTGCTGAGGGGAGGAGG + Intronic
1184313765 22:43666220-43666242 TTCTGGCTGGGGAGGGGAGAGGG + Intronic
1184452623 22:44591911-44591933 ATCTGGGTGTGCAGATGGGATGG + Intergenic
1184468636 22:44683416-44683438 TTCTGGGTGTGGGTGGCAGATGG - Intronic
1184968311 22:47997244-47997266 TCCTGGGTGTGGGGGGGAGGGGG - Intergenic
1185233260 22:49695181-49695203 AACCGGGCGTGGAGGGGAGCTGG + Intergenic
1185338807 22:50282665-50282687 AGCTGGGTGTGGGGAGCAGAGGG + Intronic
1185417206 22:50716733-50716755 ATCTGGGTCAGGAAAGGAGACGG - Intergenic
949399208 3:3647998-3648020 ATCTGTGTGTGGGGAAGAGAAGG + Intergenic
949605581 3:5649640-5649662 TGCTGGGAGTTGAGGGGAGAGGG + Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
950098390 3:10343255-10343277 CTCGGGGGCTGGAGGGGAGAGGG - Intronic
951104826 3:18730562-18730584 ATCTGTGTGAGGCGAGGAGAGGG - Intergenic
951193956 3:19803702-19803724 GCCTGGGGGTGGAGTGGAGAGGG - Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951325409 3:21296894-21296916 GCCTGGGTGTGGAGTGGAGGGGG - Intergenic
952002646 3:28804319-28804341 TTCAGGGTGAGTAGGGGAGAAGG - Intergenic
952648250 3:35689031-35689053 GTCTGGGTGTGGGGGAGAGGTGG - Intronic
952661567 3:35856383-35856405 ATCTGGCTGTGGAGTGGCCAGGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
952959616 3:38581114-38581136 CTCTGGGGGTGGCGGGGAGTAGG + Exonic
953031065 3:39180351-39180373 ATGTGGGTGAGGAGGAGAGTGGG + Intergenic
953330381 3:42048059-42048081 CTCTTGGAGTGGAGGAGAGAGGG - Intronic
953449801 3:42996703-42996725 CTCTGGGCCTAGAGGGGAGATGG - Intronic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
953980507 3:47410829-47410851 AGCTGGGTGTGTAGGGGGGGTGG - Exonic
954387886 3:50253944-50253966 ATCTCGGGGTGGTGGGGAGCTGG + Intronic
954411879 3:50374380-50374402 AGGTGGGTGGGGAGGGGAGGGGG + Intronic
954485963 3:50851446-50851468 TCCTGGGCGTGGAGTGGAGAAGG + Intronic
954609249 3:51935571-51935593 CTGTGAGTGTGGATGGGAGAGGG - Exonic
954640916 3:52097236-52097258 GTGTGTGTGTGGCGGGGAGAGGG + Intronic
954675006 3:52310902-52310924 ATGTGGGTGGGCAGGGGCGATGG + Intergenic
955404894 3:58619861-58619883 ATGTGTGTGTGGTGGGGAGGTGG + Intronic
955550410 3:60078857-60078879 ATCTGAGGGAGGAGGGTAGAGGG + Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
959328927 3:104977051-104977073 TTCTGAGTGTGGATAGGAGAAGG + Intergenic
961379475 3:126487710-126487732 AGCTGGGAGCCGAGGGGAGAGGG + Intronic
961384651 3:126516676-126516698 GTGTGGGGGTGGAGGGGAGTTGG - Intronic
961464586 3:127073440-127073462 AGTTGGGTGGGGAGTGGAGAGGG - Intergenic
961584397 3:127910233-127910255 ACCTGGAGGTGGAGGGGAGGTGG + Intergenic
962348361 3:134638946-134638968 ATATGTGTGTGGAGGGGTCATGG + Intronic
962911622 3:139856210-139856232 TCCTGGGTGTGGAGCAGAGAGGG + Intergenic
962931515 3:140041875-140041897 ACCTGTGTGAGGAGGGAAGAGGG + Intronic
963576489 3:147066815-147066837 ATTTGGGGGTGGAGGGCAGGGGG + Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
963933841 3:151032578-151032600 ATCGGAGGGTGGAGGGCAGAAGG + Intergenic
965028309 3:163330243-163330265 ATCTGGGTGGGCATGGGTGATGG + Intergenic
965826946 3:172741139-172741161 AGATGGATATGGAGGGGAGAGGG + Intergenic
966459924 3:180165518-180165540 GCCTGGGTGTGGAGTGGAAAGGG + Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
966710027 3:182962562-182962584 ATCTGGGGTTTGGGGGGAGAGGG - Intronic
966965397 3:184986837-184986859 AACTGAGTGTGGGAGGGAGAAGG - Intronic
967390245 3:188948015-188948037 AGCGGGGCGGGGAGGGGAGAGGG - Intronic
967921186 3:194615753-194615775 AGCATGGTGTGGAGGGGTGAAGG - Intronic
968041367 3:195591995-195592017 ATCTGGGTGTGGAGGAATTAAGG + Intergenic
968434827 4:579048-579070 ATCCTGATGTGGATGGGAGACGG - Intergenic
968481605 4:835446-835468 AGCTGGGTGCGGAGGGCACAAGG + Intergenic
968793843 4:2688677-2688699 CTCTGGCTGTAGTGGGGAGAAGG + Intronic
968949306 4:3682360-3682382 ACCTGGGTGTGGAGAGGTGGGGG - Intergenic
969276853 4:6141615-6141637 ATTTGGGAGTGGAGGAGAAAGGG - Intronic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969875960 4:10135712-10135734 TCCTCGGTGTTGAGGGGAGAGGG + Intergenic
970067527 4:12116073-12116095 GGCTGGGTGTGGAGCAGAGAGGG + Intergenic
971170512 4:24228488-24228510 ATCAGGGTGGGCAGGGTAGAAGG + Intergenic
971272640 4:25164938-25164960 ACCTGGCTTTTGAGGGGAGAGGG - Intronic
971418590 4:26455587-26455609 GTCTGGGAGTGATGGGGAGAGGG + Intergenic
971522479 4:27571406-27571428 ATTTGGGTGGAGAGAGGAGAGGG - Intergenic
973042461 4:45488309-45488331 ATCTGGATGTTGAGGGGAGGAGG + Intergenic
975276328 4:72505909-72505931 GCCTGGGTGTGGAGTGGAGATGG + Intronic
975710458 4:77156678-77156700 GCCTGGGTGTGCAGCGGAGAAGG - Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
976744803 4:88392068-88392090 AGGGGGGAGTGGAGGGGAGAAGG - Intronic
976869497 4:89773903-89773925 ATTTGGGTGTGAAAGGGCGAGGG - Intronic
977557134 4:98497750-98497772 AGCTGAGTCTAGAGGGGAGACGG + Intronic
978826092 4:113025739-113025761 ATCTGAGGGTGGAGGGGAAGGGG + Intronic
979737408 4:124104562-124104584 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
980836730 4:138203108-138203130 ATTGGGGTGGGGAGGGAAGAAGG - Intronic
981141537 4:141275209-141275231 ATTTGGTTGTGGAGAGTAGAAGG - Intergenic
982583610 4:157209552-157209574 TTCTGGGTCTGGAGGGGACTTGG - Intronic
982805946 4:159762648-159762670 ATTAGGGAGTGGAGTGGAGACGG - Intergenic
982843733 4:160223945-160223967 GCCTGGGTGTGGAGTGGAGAGGG + Intergenic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985045600 4:185937698-185937720 AGCTGGAAGTGGAGGGGAGGGGG + Intronic
985058474 4:186056581-186056603 AGCTGGGGGTGGAAGGCAGAAGG - Intergenic
985059064 4:186058121-186058143 ATCTGGGTGTGGATGGCTGGAGG - Intergenic
985250891 4:188023367-188023389 AGCTGGGTGAGGAGGGGGGATGG + Intergenic
985484507 5:140863-140885 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985484554 5:140990-141012 GTGGGGGTGTGCAGGGGAGAGGG - Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986047051 5:4049126-4049148 AACTGTGTGTGGAGAGGGGAGGG + Intergenic
987182769 5:15385052-15385074 CTCTGGGGGAGAAGGGGAGAGGG - Intergenic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
987669675 5:20990593-20990615 TTCTGGGTGTAGAGCAGAGAGGG - Intergenic
987669772 5:20991183-20991205 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
987710819 5:21499133-21499155 AGCTGGCTGGGGAGGGGACAAGG - Intergenic
988120007 5:26949257-26949279 AGCTTGGAGTGGAGGTGAGAAGG + Intronic
988635006 5:32973705-32973727 AACTGAGTGGGGAGGGGAAATGG - Intergenic
988832936 5:35004832-35004854 ATCTGGGGTTGGTGGGAAGAAGG - Intronic
989460835 5:41696655-41696677 GCCTGGGTATGGAGAGGAGAGGG + Intergenic
989961864 5:50425708-50425730 TTCTGGGGGGGCAGGGGAGATGG + Intronic
990266724 5:54084630-54084652 ATCTGGCTCTGGAGGGGAGATGG - Intronic
990276821 5:54205985-54206007 TTCTGGGGGTGGAGGAGAAAGGG - Intronic
990555791 5:56934528-56934550 ATTTGGGTGGTGAGGTGAGAAGG + Intronic
990852695 5:60224847-60224869 ATCTGGGGGAGGCGGGGAGAGGG + Intronic
991761159 5:69918191-69918213 AGCTGGCTGGGGAGGGGACAAGG - Intergenic
991786170 5:70199909-70199931 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
991840387 5:70793241-70793263 AGCTGGCTGGGGAGGGGACAAGG - Intergenic
991878614 5:71200295-71200317 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
992527919 5:77630007-77630029 AGCTGGGTGGGAAGGGAAGAGGG + Exonic
993621768 5:90177097-90177119 TTTTTGGTGGGGAGGGGAGATGG - Intergenic
994824734 5:104698692-104698714 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
995358732 5:111269397-111269419 ATCTGGTTGTGTGGGGGAAAGGG + Intronic
996369876 5:122741849-122741871 ATCAGGGTGGGGAGAGGAGCTGG - Intergenic
996635069 5:125679320-125679342 AACTTGGTGTGGAGTGGAAATGG + Intergenic
997013275 5:129904177-129904199 AGCTGGGGGAGGAGGGAAGAGGG + Intergenic
997055450 5:130438273-130438295 GTCTGGGTGTGAAGTGGAGAGGG + Intergenic
997055483 5:130438498-130438520 GTCTGGGGGTGGAGTGAAGAGGG + Intergenic
997432081 5:133847715-133847737 ATCTGGGTATTGCTGGGAGATGG - Intergenic
997715036 5:136036214-136036236 GTCTGGATGAGGTGGGGAGATGG + Intronic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
998377317 5:141699785-141699807 AGCTGGCTGATGAGGGGAGAAGG + Intergenic
998629051 5:143878304-143878326 ATTGGGGTGTGGTGGGGAGATGG - Intergenic
998679037 5:144444201-144444223 CTTTGTGTGTGGAGGGGGGAGGG - Intronic
998819682 5:146047443-146047465 AGATGGGTGGGGTGGGGAGAGGG + Intronic
999388652 5:151174036-151174058 ATCTGGAGGAGGAGGGGCGAAGG + Intergenic
999426453 5:151491371-151491393 ATCTGGCTGCAGAGGAGAGATGG - Exonic
999525280 5:152398679-152398701 ATGTGAGTGTGGAAGGTAGAGGG - Intronic
999629337 5:153553984-153554006 AACTGGGTGGGGAAGGGGGAGGG - Intronic
1000169044 5:158683742-158683764 ATCTGGGAGTGGAGAGGAAGGGG - Intergenic
1000346884 5:160321792-160321814 AGTTGGGTGTGGAGCCGAGACGG + Intronic
1000900336 5:166904674-166904696 ACCGGGGAGTGGTGGGGAGAGGG + Intergenic
1001040910 5:168334542-168334564 AAATGGGGGTGGAGGGGGGAGGG - Intronic
1001056918 5:168457436-168457458 AGCTGGCTGTGGAGGGGGCAGGG - Intronic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001374058 5:171237811-171237833 TTCTAGGTGTGGAGTGGAGCAGG + Intronic
1001402782 5:171455860-171455882 ATCTGGGTGGAGAGTGGGGAAGG + Intronic
1001750428 5:174126064-174126086 GTGTGTGTGTGGATGGGAGATGG - Intronic
1001930852 5:175672054-175672076 GTGTGTGTGTGGAGGGGTGAAGG - Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002106004 5:176879704-176879726 AGATGGCTGTGGAGGGGAGGGGG - Exonic
1002468568 5:179421176-179421198 ATCTAGGTTTGGAAGGGAGTTGG - Intergenic
1002604538 5:180374688-180374710 AACTGGGTGCTGAGGAGAGAAGG - Intergenic
1002614477 5:180442222-180442244 GACAGGATGTGGAGGGGAGAGGG + Intergenic
1002702259 5:181132720-181132742 ATCCAGTTGTGAAGGGGAGAGGG + Intergenic
1003445441 6:6179568-6179590 ATCTGAATGTGGCGGGTAGAAGG - Intronic
1004313096 6:14563259-14563281 ATGTGTGTGTGGAGTGGGGAAGG + Intergenic
1004505545 6:16244006-16244028 ATTTGGGTGAGAAGGGAAGAGGG + Intronic
1004819173 6:19348103-19348125 CACTGGGGGTGGAGGGGAGGTGG - Intergenic
1005054599 6:21717680-21717702 AGCTGGGTGTGGTGGGGGGGTGG + Intergenic
1005207400 6:23420625-23420647 GTCTAGGAGTGGAGTGGAGAGGG - Intergenic
1005546868 6:26881370-26881392 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
1005605774 6:27475669-27475691 AACTGGGGGAGGAGGGGAGAAGG + Intergenic
1005685072 6:28246189-28246211 AACTGGGAGTGGAGGGAAAATGG + Intronic
1005771499 6:29077458-29077480 GTCTGGGGGTGGAGAGGGGAGGG - Intergenic
1007098811 6:39230607-39230629 GTGTGTGTGTGGCGGGGAGAGGG - Intergenic
1007182027 6:39935820-39935842 AACTGGGTATGGGGGAGAGAAGG + Intergenic
1007556204 6:42768661-42768683 CACTGGGCATGGAGGGGAGAAGG - Intronic
1007636198 6:43301289-43301311 ATATGTGTGTGGTGGGGAGTGGG + Intronic
1007782875 6:44264299-44264321 ATCTGGGTCTGGAGGAGGAAGGG + Intronic
1007945254 6:45820702-45820724 ATCTAGGTATTGAGGGGACAGGG + Intergenic
1008265873 6:49425759-49425781 AGCTGGGAGGGGAGGGGAAAAGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1008596124 6:53043750-53043772 ATGGGGGTGTGGATGGGAGGGGG + Intronic
1008998935 6:57690402-57690424 GTCTAGGTGTGGAGTAGAGAGGG - Intergenic
1009017623 6:57922452-57922474 AGCTGGCTGGGGAGGGGACAAGG + Intergenic
1009187422 6:60589781-60589803 GTCTAGGTGTGGAGTAGAGAGGG - Intergenic
1010353450 6:74903758-74903780 ATCTGGGGGTGGAGCCAAGATGG + Intergenic
1010356768 6:74943854-74943876 ATTTGGGTGGGGAGAGGAAATGG + Intergenic
1010948388 6:82005645-82005667 GCTTGGGTGTGGAGTGGAGAGGG - Intergenic
1012246308 6:96930062-96930084 ATCTGGGTGGGGAAGGGAGGGGG - Intronic
1012814006 6:103999094-103999116 ATCAGAGGGTGGAGGGCAGAAGG - Intergenic
1013422258 6:109977982-109978004 AGCTGGGAGGGGAGGGGTGAAGG - Intergenic
1013586938 6:111587626-111587648 ATCTTGGTGGGGAGGGGAGCAGG - Intronic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1014080114 6:117276095-117276117 ATTTGGGTCTGGATGGGAGATGG + Intergenic
1014505172 6:122247005-122247027 AGCCAGGTGTGGAGTGGAGAAGG + Intergenic
1015306588 6:131715624-131715646 GCCTGGTTGTGGAGTGGAGAGGG - Intronic
1015602944 6:134928197-134928219 GTCAGGGTGAGGAGGGGAAAAGG - Intronic
1016380204 6:143469953-143469975 TTCTGGGGGGTGAGGGGAGATGG + Intronic
1017062116 6:150493564-150493586 GTGTGTGTGTAGAGGGGAGAGGG + Intergenic
1017235059 6:152110522-152110544 ATCGGGGGGTGGAGGGTGGAAGG + Intronic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017970132 6:159304805-159304827 GTCTGGCTGAGGAGGGGTGAGGG + Intergenic
1018126805 6:160690494-160690516 ACCTGGGTGTGGGGAAGAGAGGG - Intergenic
1018651531 6:165995767-165995789 GTCTGGGGGTGGGAGGGAGATGG - Intergenic
1018861017 6:167710649-167710671 ATCCGTGTGTGAAAGGGAGAAGG - Intergenic
1019265672 7:116286-116308 TCCTGAGTGTGGAGGGGAGATGG - Intergenic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1020092891 7:5351180-5351202 TTCTGGGTGGGGAGGAGGGAGGG + Intronic
1020675362 7:11177800-11177822 TTCTGGGTTTTGAGGGGAGAAGG - Intergenic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1020914311 7:14172846-14172868 AGCTTGGGGTGGAGGGTAGAGGG - Intronic
1021537671 7:21723741-21723763 AGCTGGGGGTGGAGGGGTGGGGG - Intronic
1022498078 7:30865645-30865667 AGCTGGAGGTGGAGGAGAGAGGG + Intronic
1023016405 7:35971795-35971817 ATCTGGGTGTTAAGGGGTGGCGG - Intergenic
1023062698 7:36343495-36343517 AGATGGGAGGGGAGGGGAGATGG + Intronic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1023585875 7:41729280-41729302 TACTGGGGGTGGAGGGGAAATGG - Intergenic
1023861396 7:44219559-44219581 GCCTGGGGGTGGATGGGAGAGGG - Intronic
1024261425 7:47576708-47576730 ATCTGGCTGTGCAGGGCAGGCGG - Intronic
1024435443 7:49348272-49348294 ATTTGAGAGTGAAGGGGAGAAGG - Intergenic
1025774010 7:64542182-64542204 CTCTGGGTTTGTAGTGGAGAGGG - Intronic
1025791649 7:64693508-64693530 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025816693 7:64920105-64920127 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1025866854 7:65390463-65390485 CTCTGGGTTTGTAGTGGAGAGGG + Intronic
1026172216 7:67963900-67963922 ATCTGGGTGGGTAGGGGAGTGGG + Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026776012 7:73231557-73231579 ACCTGGGTGTAGGGGGCAGAGGG + Intergenic
1026791361 7:73334390-73334412 AACTAGGTGGGGAGGGGGGAGGG - Intronic
1026850029 7:73718618-73718640 CTCTGGGTGTGTCGGGGAGGGGG - Intronic
1027016869 7:74784928-74784950 ACCTGGGTGTAGGGGGCAGAGGG + Intronic
1027026075 7:74852501-74852523 CTATGTGTGTTGAGGGGAGATGG + Intergenic
1027061681 7:75091618-75091640 CTATGTGTGTTGAGGGGAGATGG - Intergenic
1027071158 7:75161008-75161030 ACCTGGGTGTAGGGGGCAGAGGG - Intergenic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027934805 7:84589029-84589051 GCCTGGGTGTGGAGTGTAGAGGG - Intergenic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1027956357 7:84883562-84883584 ATCTGAGGGTGGAGGGTAGAAGG - Intergenic
1028333259 7:89622630-89622652 GACTGGGTGTGGAGTGGAAAGGG - Intergenic
1029177378 7:98674661-98674683 AAGTGGGTGGGGTGGGGAGAGGG - Intergenic
1029635981 7:101784040-101784062 ATGTGGGTGGGCAGGGGACAGGG + Intergenic
1029930533 7:104365843-104365865 GTGTGGGCGGGGAGGGGAGATGG + Intronic
1031237625 7:119196992-119197014 GCCTGGGTGTAGAGAGGAGAGGG - Intergenic
1031526911 7:122833507-122833529 AGCTGGGTGTGGTGGGAGGACGG - Intronic
1031652710 7:124310998-124311020 ATCTGGGTGAGTAGTTGAGAAGG + Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1032298285 7:130662575-130662597 AGCTGGATGTGGAGTGGGGAAGG - Intronic
1032453873 7:132057076-132057098 ATCTGGGTGTGGATGTCAAATGG + Intergenic
1032503470 7:132417706-132417728 AGGTGGGGGAGGAGGGGAGAGGG + Intronic
1032901327 7:136312280-136312302 GTGTGGGTGGGAAGGGGAGAAGG - Intergenic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033425011 7:141236158-141236180 ATCTGGAGGTAGAGGGTAGAGGG + Intronic
1033679844 7:143583569-143583591 GCCTGGTTGTGGAGTGGAGAGGG - Intergenic
1033691990 7:143745874-143745896 GCCTGGTTGTGGAGTGGAGAGGG + Intergenic
1033730961 7:144178876-144178898 GCCTGGTTGTGGAGTGGAGAGGG + Intergenic
1034161037 7:148994522-148994544 AGCTGGGTGTGAAGGTCAGAGGG - Intergenic
1034355163 7:150445440-150445462 GAGTGGGTGGGGAGGGGAGAGGG + Intergenic
1034427810 7:151023845-151023867 GTGTGGGTGTGGGTGGGAGAGGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035049908 7:155992698-155992720 AACTGGGTGTTGAGGCGAGGCGG + Intergenic
1035098715 7:156378757-156378779 GTCTGGGGGTGTAGGGGAGGAGG + Intergenic
1035768451 8:2127263-2127285 ACCTGACTGGGGAGGGGAGATGG + Intronic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1036293721 8:7518136-7518158 CACTGGGTGGGGAGGGGAGAGGG - Intergenic
1036328840 8:7802859-7802881 CACTGGGTGGGGAGGGGAGAGGG + Intergenic
1036615367 8:10383390-10383412 TTCTGTGTGTGAAGGAGAGACGG + Intronic
1036817692 8:11914113-11914135 ATCCGGGGGTGGAGGGGGGGCGG + Intergenic
1037458107 8:19083547-19083569 GTCTAGGTGTGTTGGGGAGATGG + Intronic
1037824728 8:22154541-22154563 ATCTGTGTGTGGGAGGGAAAGGG - Exonic
1038041503 8:23727587-23727609 GACTGGTTGTGGTGGGGAGAAGG - Intergenic
1038272609 8:26087744-26087766 ACCTGGGGTTGGAGGGGGGAAGG + Intergenic
1038365387 8:26926837-26926859 ATCTGGGTGGGGGGGGTATATGG + Intergenic
1038411320 8:27361833-27361855 GTGTGGGTGTGGAGCGGAGCAGG - Intronic
1038435406 8:27532206-27532228 ATGTGGGGGCTGAGGGGAGAGGG - Intronic
1038436356 8:27539529-27539551 ATGTGGGTGTGGGGGAGGGAAGG - Intronic
1038660520 8:29492873-29492895 ATCTTGCTCTGGAGGGGAAAGGG + Intergenic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039435356 8:37556171-37556193 GTGTGGGTGTGGAGGGGAAGGGG - Intergenic
1039469063 8:37802531-37802553 CCCTGGGTGGGGAGGGGAGTGGG - Intronic
1040737755 8:50531502-50531524 ATCTGGATCGGGAGGGAAGAAGG - Intronic
1041425150 8:57712694-57712716 TTCTGGGTGTGGATGGTTGAGGG - Intergenic
1041750507 8:61255486-61255508 ATGTGTGTGTGGAGAGGTGAAGG + Intronic
1042114809 8:65419189-65419211 GTCTGGGAGTGGAGGAGACAGGG - Intergenic
1042228332 8:66532721-66532743 AATAGGGTGTGGAGGGGTGAGGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043261783 8:78209504-78209526 CACTGGGTGTGGTAGGGAGAGGG + Intergenic
1043285258 8:78519921-78519943 ATCTGGTTGGGGAAGGAAGATGG - Intronic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1044794268 8:95880443-95880465 AGGTGGGTGTGGTGGGGATAAGG + Intergenic
1045727090 8:105186419-105186441 GCCTGGGGGTGGAGTGGAGATGG + Intronic
1046073018 8:109281818-109281840 ACCTGGGTGTGAAGCAGAGAGGG - Intronic
1046360494 8:113147660-113147682 GTAGGTGTGTGGAGGGGAGAGGG + Intronic
1046694255 8:117320877-117320899 ACCTGAGTGGGGAGGGTAGAAGG + Intergenic
1047864541 8:129007586-129007608 ATCTGATAGTGGAGGGTAGAAGG - Intergenic
1047930996 8:129728219-129728241 ACCTGAGTGTGGAGGAGAGAGGG - Intergenic
1047942878 8:129843219-129843241 CTCTGGGTGTCCATGGGAGATGG - Intronic
1048009570 8:130444715-130444737 GTCTGGGTGTAGTGGGGAGTGGG + Intergenic
1048152490 8:131907815-131907837 AGATGGGAGGGGAGGGGAGAAGG - Intronic
1048461080 8:134622633-134622655 AGCTGGGTGGAGAGGGGGGAGGG - Intronic
1048574104 8:135677605-135677627 ATCTGGGTGGGGAGAGGAGGAGG + Intergenic
1048887868 8:138923101-138923123 ACCTGGTTAAGGAGGGGAGAGGG + Intergenic
1048992291 8:139767541-139767563 ATGTGGGGGTGGAAGGGGGAGGG + Intronic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1049256015 8:141614352-141614374 GGCTGGGGGTGGAGGGGAGCAGG - Intergenic
1049456093 8:142690103-142690125 GTGTGTGTGTGGAGGGGAGGCGG + Intergenic
1049641410 8:143717633-143717655 ATCTGGGTGGGCAGGGGATGGGG + Intronic
1049696789 8:143987976-143987998 ATCAGGGTGTGCAGGGGGCATGG - Intronic
1049754571 8:144304130-144304152 ATTTGGGAATTGAGGGGAGAAGG + Intronic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050336715 9:4596557-4596579 ATTTGGGGGTGGTGGGGAGGAGG + Intronic
1051735113 9:20189924-20189946 TGCTGGGAGGGGAGGGGAGATGG + Intergenic
1051828075 9:21243690-21243712 ACCTGGGTCAGGAGGAGAGAAGG - Intergenic
1053281928 9:36826126-36826148 AGCTGGGGGTGGGGGGGGGAGGG - Intergenic
1053334141 9:37249092-37249114 ATGTGGGAGAGGTGGGGAGATGG + Intronic
1054157209 9:61649324-61649346 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054476984 9:65580329-65580351 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054877164 9:70109012-70109034 AGCTGGGTGTGGACTGGATAAGG + Intronic
1055494932 9:76844594-76844616 GTATGTATGTGGAGGGGAGATGG - Intronic
1056422691 9:86445066-86445088 ATTTGGTTGGGGAGGGGAGCGGG - Intergenic
1056596613 9:88012992-88013014 AGCTGGGTTTGCAGGGGTGAAGG - Intergenic
1056743462 9:89280067-89280089 AGCTGGGGTTGGAGGGTAGATGG - Intergenic
1056805792 9:89727616-89727638 AGGGGGGTGTGGAGGGGAGATGG + Intergenic
1057081547 9:92177678-92177700 TCCTGGGTGTAGAGGGCAGAGGG - Intergenic
1057081816 9:92179125-92179147 TCCTGGGTGTGGAAGGCAGAGGG + Intergenic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1057702064 9:97370515-97370537 ACCTGGGTGTGTGGGGGTGATGG - Intronic
1057791399 9:98127364-98127386 TTGTGGGGGTGGAAGGGAGAGGG + Intronic
1057997211 9:99829008-99829030 GGCTGGGTGCGGAGGGGAGGGGG - Intronic
1058050564 9:100402050-100402072 ATCAGGGTGGGGATGGGAGGTGG - Intergenic
1058417733 9:104805759-104805781 ATGTGAGTTTTGAGGGGAGAAGG - Intronic
1058923592 9:109640733-109640755 GTGCGGGTGGGGAGGGGAGACGG + Intergenic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1059587662 9:115623220-115623242 ATATGGGTTTGGTGGGGAGTGGG - Intergenic
1060200474 9:121649392-121649414 GAGTGTGTGTGGAGGGGAGAGGG - Intronic
1060559796 9:124533563-124533585 AACTGGGTGGGAGGGGGAGATGG + Intronic
1060736455 9:126069560-126069582 AGCTGGGGGCGGAGGGGAGCCGG - Intergenic
1060799076 9:126532309-126532331 CTCTGGGCTGGGAGGGGAGAGGG - Intergenic
1060801375 9:126547791-126547813 CTCTGGGTGGGGAGGGATGAGGG - Intergenic
1060983729 9:127808217-127808239 ACCTTGCTGTGGAGGGAAGAAGG - Exonic
1061127166 9:128684317-128684339 GGCTGGATGTGGAGGGGTGAAGG - Intronic
1061192386 9:129089292-129089314 ACCTGGGTGTGGGGTGGAGGAGG + Exonic
1061238672 9:129356875-129356897 ATCAGGGTGTGTAGGGGAACTGG + Intergenic
1061424574 9:130491029-130491051 ATCTGGGAGTGGAGGGGGAGAGG - Intronic
1061681078 9:132242660-132242682 GTCTGGGGGAGGAGGAGAGAAGG + Exonic
1061736936 9:132668088-132668110 ATCTGGGTGGAGCGGGGAGAAGG - Intronic
1061821465 9:133229163-133229185 CTCTGTGTGTGGAGCAGAGAGGG - Intergenic
1061833973 9:133317200-133317222 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062237781 9:135520901-135520923 CTCTGTGTGTGGAGCAGAGAGGG + Intergenic
1062282981 9:135760186-135760208 ACCTGGCTGTGGATGGGAAATGG - Intronic
1062333657 9:136055528-136055550 ATCTAGGGGTGGAGGGGGCAGGG - Intronic
1062502275 9:136856658-136856680 CTCTGGAGGGGGAGGGGAGAAGG + Intronic
1062586869 9:137253444-137253466 ATCTCAGTGTAGCGGGGAGATGG - Exonic
1062698041 9:137885325-137885347 ATCTGTGTGTGGAGGGGGCTGGG + Intronic
1186260878 X:7778021-7778043 AACTGGGTGGGGAGGGGAAGAGG - Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1187286307 X:17907168-17907190 AAGTGGGAGTGGAGGGGTGAGGG - Intergenic
1188459558 X:30408303-30408325 ATCTGGGTGGGAAGGGGTGCAGG - Intergenic
1188734367 X:33694440-33694462 ATATGGGTGTGCCAGGGAGAGGG + Intergenic
1188747376 X:33862751-33862773 GGGTGGGTGTGGAGGGGAGGTGG - Intergenic
1188990405 X:36812042-36812064 ATGTAGGTGTGGAGTGGAAAGGG - Intergenic
1189078275 X:37941245-37941267 AGCTGGATGTGGTGGGGAGCGGG - Intronic
1189407883 X:40741989-40742011 ATTTTTTTGTGGAGGGGAGAGGG + Intergenic
1189649848 X:43177452-43177474 ACCTGGGAGGGGAGGGGAGCAGG - Intergenic
1190144329 X:47876925-47876947 ACCTGGGAGAGGAAGGGAGATGG + Intronic
1190245085 X:48685663-48685685 CTTGGGGTGTGGAGAGGAGATGG + Intronic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190741072 X:53289158-53289180 ATGTGTGTGTGGAGGGGGAAGGG - Intronic
1191105827 X:56771573-56771595 ATCTGAGTGTGAAGGGAAAAAGG - Intergenic
1191106820 X:56776975-56776997 ATCTGAGTGTGAAGGGAAAAAGG - Intergenic
1191716105 X:64194619-64194641 ATCTGGGAGGAGAGGGGAGAGGG + Intronic
1192219021 X:69184443-69184465 CACTGGGAGTGGAGTGGAGAAGG - Intergenic
1192553720 X:72073435-72073457 ATCTGTATGTGGTGGGGAGGGGG + Intergenic
1192779921 X:74283512-74283534 AACTGGGTGGGGTGGGGGGAAGG - Intergenic
1192917281 X:75666224-75666246 CTCTGGGCATGGAGTGGAGAGGG + Intergenic
1192917305 X:75666337-75666359 CTCTGGGGGTGGAGCAGAGAGGG + Intergenic
1193779211 X:85682658-85682680 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
1194608864 X:96015684-96015706 ATGTGTGTGTGGAGGGGGGTGGG - Intergenic
1194682616 X:96872242-96872264 AAGTGGGTGGGGAGGGGAAATGG - Intronic
1194684271 X:96893303-96893325 TTCTTTGTGTGGAGTGGAGAGGG + Intronic
1194710662 X:97232641-97232663 ATCAGGGTGTGGACGGCAGAAGG - Intronic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195064280 X:101225680-101225702 ATTTTGGTGGGGAGCGGAGAGGG + Intronic
1195335505 X:103849287-103849309 ATGTGGGTGTGGGGGGGCGGGGG + Intergenic
1195416168 X:104621617-104621639 GTCTGGGTGTGGAGTGGAGAGGG - Intronic
1195588569 X:106597224-106597246 ATTAGGGGGTGGAGGGTAGATGG + Intergenic
1195654831 X:107324225-107324247 ATCTGGGCGTGGCGGGGGGCGGG - Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1195735398 X:108007733-108007755 GTTTGGCTGTGAAGGGGAGAAGG + Intergenic
1195889133 X:109672284-109672306 ATGGGGGTGGGGAGGGGAGAGGG + Intronic
1195964213 X:110415566-110415588 TTCTGGGTGCTGTGGGGAGATGG + Intronic
1196194141 X:112822512-112822534 ATTGGGTTGTGGTGGGGAGAGGG + Exonic
1196853226 X:119958710-119958732 AGCTGGGTGTGGTGGGGGGGGGG + Intergenic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1197659548 X:129155376-129155398 ATTTGGGGGTGGAGGGGTGAGGG + Intergenic
1198162770 X:134024019-134024041 AGCGGGGTGGGGATGGGAGAGGG - Intergenic
1198425585 X:136516499-136516521 ATTTGGGTGGGGAGGAGTGATGG - Intergenic
1198436718 X:136624342-136624364 AACTGGTAGTGGAGGTGAGACGG - Intergenic
1198677593 X:139147320-139147342 AGATGTGTGTGGTGGGGAGATGG - Intronic
1198847585 X:140929348-140929370 GTATGTGTGTGGAGGGGAGGAGG + Intergenic
1198968164 X:142249973-142249995 GCCTGGGCGTGGAGAGGAGAGGG + Intergenic
1198968216 X:142250312-142250334 GTCTGGGTGTGAAGCAGAGATGG + Intergenic
1199425277 X:147693566-147693588 ATCTGTGTGTGGGGGGGCGGGGG - Intergenic
1199438644 X:147843230-147843252 ATATGGTTGTGGAGGAGAGCAGG + Intergenic
1199482539 X:148312858-148312880 ATCTGGGTGAAGAGGGTACATGG - Intergenic
1199738528 X:150709329-150709351 GTATGGGGGTGGAGGGGAGAAGG - Intronic
1200068712 X:153517587-153517609 AGCTGGGTGAGGAGGAGGGAGGG - Intergenic
1200877542 Y:8173864-8173886 ATCAGGGGGTGGGGTGGAGAGGG + Intergenic
1201672013 Y:16533466-16533488 ATCTGTGGGTGGAGTGTAGATGG + Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic