ID: 1163431218

View in Genome Browser
Species Human (GRCh38)
Location 19:17268892-17268914
Sequence GTCCTCAGCCCCTTCAGGAT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431218_1163431230 20 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431230 19:17268935-17268957 CAGCGTGGGCAGCCGCAGCGAGG 0: 1
1: 1
2: 1
3: 20
4: 217
1163431218_1163431233 27 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431233 19:17268942-17268964 GGCAGCCGCAGCGAGGGTGAGGG 0: 1
1: 1
2: 3
3: 22
4: 310
1163431218_1163431227 5 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431227 19:17268920-17268942 AGTAGGGGCACAGGCCAGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 221
1163431218_1163431232 26 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431232 19:17268941-17268963 GGGCAGCCGCAGCGAGGGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 371
1163431218_1163431231 21 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431218_1163431224 -10 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431224 19:17268905-17268927 GGCTGAGGACCGGGCAGTAGGGG 0: 1
1: 0
2: 3
3: 21
4: 241
1163431218_1163431225 -4 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431218_1163431228 6 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431228 19:17268921-17268943 GTAGGGGCACAGGCCAGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431218 Original CRISPR GTCCTCAGCCCCTTCAGGAT TGG (reversed) Exonic