ID: 1163431221

View in Genome Browser
Species Human (GRCh38)
Location 19:17268897-17268919
Sequence GCCCGGTCCTCAGCCCCTTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 286}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431221_1163431228 1 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431228 19:17268921-17268943 GTAGGGGCACAGGCCAGCGTGGG 0: 1
1: 0
2: 0
3: 10
4: 169
1163431221_1163431225 -9 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431221_1163431232 21 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431232 19:17268941-17268963 GGGCAGCCGCAGCGAGGGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 371
1163431221_1163431235 27 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431235 19:17268947-17268969 CCGCAGCGAGGGTGAGGGTGAGG 0: 1
1: 1
2: 3
3: 91
4: 1895
1163431221_1163431227 0 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431227 19:17268920-17268942 AGTAGGGGCACAGGCCAGCGTGG 0: 1
1: 0
2: 0
3: 16
4: 221
1163431221_1163431230 15 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431230 19:17268935-17268957 CAGCGTGGGCAGCCGCAGCGAGG 0: 1
1: 1
2: 1
3: 20
4: 217
1163431221_1163431231 16 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431221_1163431233 22 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431233 19:17268942-17268964 GGCAGCCGCAGCGAGGGTGAGGG 0: 1
1: 1
2: 3
3: 22
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431221 Original CRISPR GCCCGGTCCTCAGCCCCTTC AGG (reversed) Exonic