HTGT WGE

Individual CRISPR Summary

ID: 1163431224

 View in Genome Browser
Species Human (GRCh38)
Location 19:17268905-17268927
Sequence GGCTGAGGACCGGGCAGTAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431212_1163431224 2 Left 1163431212 19:17268880-17268902 CCCGCACTCGCTCCAATCCTGAA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163431224 19:17268905-17268927 GGCTGAGGACCGGGCAGTAGGGG 0: 1
1: 0
2: 3
3: 21
4: 241
1163431218_1163431224 -10 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431224 19:17268905-17268927 GGCTGAGGACCGGGCAGTAGGGG 0: 1
1: 0
2: 3
3: 21
4: 241
1163431210_1163431224 9 Left 1163431210 19:17268873-17268895 CCTCGGCCCCGCACTCGCTCCAA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1163431224 19:17268905-17268927 GGCTGAGGACCGGGCAGTAGGGG 0: 1
1: 0
2: 3
3: 21
4: 241
1163431213_1163431224 1 Left 1163431213 19:17268881-17268903 CCGCACTCGCTCCAATCCTGAAG 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1163431224 19:17268905-17268927 GGCTGAGGACCGGGCAGTAGGGG 0: 1
1: 0
2: 3
3: 21
4: 241
1163431211_1163431224 3 Left 1163431211 19:17268879-17268901 CCCCGCACTCGCTCCAATCCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1163431224 19:17268905-17268927 GGCTGAGGACCGGGCAGTAGGGG 0: 1
1: 0
2: 3
3: 21
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431224 Original CRISPR GGCTGAGGACCGGGCAGTAG GGG Exonic