HTGT WGE

Individual CRISPR Summary

ID: 1163431225

 View in Genome Browser
Species Human (GRCh38)
Location 19:17268911-17268933
Sequence GGACCGGGCAGTAGGGGCAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 209}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431213_1163431225 7 Left 1163431213 19:17268881-17268903 CCGCACTCGCTCCAATCCTGAAG 0: 1
1: 0
2: 0
3: 3
4: 117
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431221_1163431225 -9 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431210_1163431225 15 Left 1163431210 19:17268873-17268895 CCTCGGCCCCGCACTCGCTCCAA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431211_1163431225 9 Left 1163431211 19:17268879-17268901 CCCCGCACTCGCTCCAATCCTGA 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431218_1163431225 -4 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209
1163431212_1163431225 8 Left 1163431212 19:17268880-17268902 CCCGCACTCGCTCCAATCCTGAA 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163431225 19:17268911-17268933 GGACCGGGCAGTAGGGGCACAGG 0: 1
1: 0
2: 2
3: 7
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431225 Original CRISPR GGACCGGGCAGTAGGGGCAC AGG Exonic