ID: 1163431226

View in Genome Browser
Species Human (GRCh38)
Location 19:17268914-17268936
Sequence TGGCCTGTGCCCCTACTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 314}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431226_1163431232 4 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431232 19:17268941-17268963 GGGCAGCCGCAGCGAGGGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 371
1163431226_1163431231 -1 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431226_1163431230 -2 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431230 19:17268935-17268957 CAGCGTGGGCAGCCGCAGCGAGG 0: 1
1: 1
2: 1
3: 20
4: 217
1163431226_1163431237 30 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431237 19:17268967-17268989 AGGCCGCCAGTGCTGATGATGGG 0: 1
1: 0
2: 0
3: 7
4: 78
1163431226_1163431233 5 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431233 19:17268942-17268964 GGCAGCCGCAGCGAGGGTGAGGG 0: 1
1: 1
2: 3
3: 22
4: 310
1163431226_1163431236 29 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431236 19:17268966-17268988 GAGGCCGCCAGTGCTGATGATGG 0: 1
1: 0
2: 0
3: 15
4: 145
1163431226_1163431235 10 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431235 19:17268947-17268969 CCGCAGCGAGGGTGAGGGTGAGG 0: 1
1: 1
2: 3
3: 91
4: 1895

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431226 Original CRISPR TGGCCTGTGCCCCTACTGCC CGG (reversed) Exonic