ID: 1163431231

View in Genome Browser
Species Human (GRCh38)
Location 19:17268936-17268958
Sequence AGCGTGGGCAGCCGCAGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431221_1163431231 16 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431218_1163431231 21 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431226_1163431231 -1 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431231 Original CRISPR AGCGTGGGCAGCCGCAGCGA GGG Exonic
901279965 1:8026305-8026327 GGCGGCGGCAGCCGCGGCGACGG - Exonic
901640683 1:10691562-10691584 AGCGTGGGCAGCTTCAGCCGAGG - Intronic
901796343 1:11681506-11681528 TGCGTGGGCAGCTGCAGGGATGG - Intronic
904352903 1:29920521-29920543 AGCGTGGGCAGCCAAGGGGAGGG - Intergenic
907884062 1:58577107-58577129 AGCAGCGGCAGCCGCAGCGGTGG + Exonic
910757384 1:90707444-90707466 AGCCTAGGCGGCCGCAGCGGAGG - Intergenic
914442647 1:147720770-147720792 AGCGCTGGCAGCAGCTGCGAAGG + Intergenic
918144463 1:181743388-181743410 AGTCTGGGAAGCAGCAGCGATGG - Intronic
920931999 1:210397779-210397801 AGGGTGGGCAGCAGCATGGACGG - Intronic
1063368774 10:5507657-5507679 AGCGTGGGGAGGCCCAGAGAGGG - Intergenic
1063670472 10:8095826-8095848 AGCGCGGGCAGCGGAAGCGTTGG + Intergenic
1064230820 10:13528575-13528597 AGCGGCGGCAGCGGCAGCGGCGG + Intronic
1064230823 10:13528590-13528612 AGCGGCGGCAGCGGCAGCGGCGG + Intronic
1069994617 10:72334880-72334902 AGTGTGGGCAGAAGCAGTGAAGG - Exonic
1073773749 10:106763578-106763600 AGAGTGGGCAGCCTCAGTGAAGG - Intronic
1074704477 10:116118860-116118882 AGCTTGGGCAGATGCAGGGAGGG + Intronic
1074884616 10:117684446-117684468 AGGGTCGGCAGCCGCCGGGAGGG - Intergenic
1076805949 10:132858815-132858837 GGTGTGGGCAGCCGCAGGGCTGG + Intronic
1076917794 10:133433119-133433141 AGCGTGGGCGGCTGCGGGGAGGG + Intergenic
1076937788 10:133577194-133577216 AGCGTGGGCGGCTGCGGGGAGGG + Intergenic
1077368859 11:2172339-2172361 AGCTTGGGAAGCCGCTGCAAGGG - Intergenic
1077962439 11:7089566-7089588 AGCGTGGGCCGCCGCCGCGCAGG + Exonic
1080641802 11:34162680-34162702 AGCCAGGGCAGTGGCAGCGAGGG - Exonic
1083225460 11:61281746-61281768 GGCGTGGCCAGCCGCCGGGATGG + Intronic
1085633506 11:78139585-78139607 AGCGTGCGGTGCCGCAGCAATGG - Exonic
1089614758 11:119688919-119688941 AGGGTGGGTAGGGGCAGCGAGGG + Intronic
1094474002 12:30827537-30827559 AGAGTGGGCAGCCCTAGTGAGGG + Intergenic
1096668097 12:53180600-53180622 AGCGGGGGCAGCCTCAGAGCGGG - Intronic
1100608463 12:96170943-96170965 AGTGTGGGCAGCAGCAGCAGCGG - Intergenic
1102923559 12:116810336-116810358 AGAGGGGACAGCCGCAGCCATGG + Intronic
1104013922 12:124950089-124950111 ACCGTGGGCAGCAGCAGCCCGGG - Intronic
1104376323 12:128267553-128267575 GGTGAGGGCAGCCGAAGCGAGGG + Intronic
1104900508 12:132187472-132187494 AGCCAGGACGGCCGCAGCGAGGG - Intergenic
1104987641 12:132605968-132605990 AGCGAGTGCAGCCTCAGGGAGGG + Intronic
1105307890 13:19181795-19181817 GGCGTGCGCAGCTGCAGCGGCGG - Exonic
1106911226 13:34465499-34465521 AGCCTGGTCAGCCACAGCCACGG + Intergenic
1107508721 13:41060940-41060962 CGTGTGGGCAGCAGCAGCGGCGG - Intronic
1113665555 13:112138806-112138828 AGCGTGGGCAGCTGCACCACGGG + Intergenic
1114805650 14:25833421-25833443 AGCCTGGCCATACGCAGCGATGG - Intergenic
1115906678 14:38209438-38209460 AGCCCGGGCAGCTGCGGCGAAGG + Exonic
1122016946 14:98804266-98804288 AGCTTGGGGAGCTGCAGAGATGG - Intergenic
1122978576 14:105181142-105181164 AGCGTGAGCGGCCGCAGGTAGGG + Exonic
1124439379 15:29675372-29675394 AGCATGTCCACCCGCAGCGAGGG + Intergenic
1125524829 15:40368285-40368307 AGCGTGGGCAGCCGCAGGCGGGG - Exonic
1129607141 15:77030474-77030496 AGCGCAGGCAGCCTCAGGGAGGG - Intronic
1129847551 15:78774927-78774949 AGGGTGGGCAGCCCAAGGGAGGG - Intronic
1132831500 16:1930381-1930403 CGCGGGGGCAGCCGCAAGGATGG + Intergenic
1133018731 16:2956578-2956600 AGCGTGGGCAGAGCCAGGGAGGG - Intergenic
1134235598 16:12463073-12463095 AGCATGGGCAGCAGCAGCAGGGG - Intronic
1135423671 16:22321824-22321846 AGCATGGGCAGCAGCAGAGTAGG - Intronic
1136114567 16:28086703-28086725 AGCGTGTGCTGCTGCAGGGAAGG + Intergenic
1136186167 16:28590225-28590247 AGTGAGGGCAGCAGCTGCGAGGG + Exonic
1136234607 16:28905921-28905943 GGCGTGGGCAGCAGCGGGGAGGG - Intronic
1140442654 16:74999341-74999363 AGCCGGGGGAGCCGCAGGGAAGG - Exonic
1141423180 16:83930411-83930433 TGCATGGGCAGCCGCTGCGAGGG - Intronic
1141609763 16:85174739-85174761 AGGGTGGGCATGGGCAGCGAAGG + Intronic
1143178945 17:4972556-4972578 AGTGAGGGCAGCCGGAGCCACGG + Intronic
1143904609 17:10198716-10198738 AACGCGGGCTGCCGCCGCGAGGG + Intergenic
1145242349 17:21247417-21247439 AGCGTGTGCAGCCCCAGCACAGG + Intronic
1147265377 17:39231453-39231475 AGAGGGGGCAGCAGGAGCGAGGG - Intergenic
1148178077 17:45584874-45584896 GACGTGGGCAGCGGCAGCGGCGG + Intergenic
1151658900 17:75508419-75508441 AGGGTGGGGAGCCACAGGGACGG - Intronic
1152542275 17:80982308-80982330 AGCCTGGTCAGCTGCAGCCATGG - Intergenic
1152571155 17:81121821-81121843 AGCGTGGCCGCCCGCAGAGACGG + Exonic
1152855978 17:82664687-82664709 AGCTTGGGCAGACACAGGGAGGG - Intronic
1154214862 18:12408293-12408315 GGCGGGGGCAGCCGGAGCGGGGG + Intronic
1160753584 19:746871-746893 AGGGTGGGCAGGCGCCGGGAGGG - Exonic
1160839297 19:1138361-1138383 AGGGTGGGCTGCAGCAGCAAGGG + Intronic
1160844364 19:1159967-1159989 GGCGTGGGCAGGGGCAGCGCCGG - Intronic
1162718315 19:12647549-12647571 AGCGTGAGCAGGTGCACCGAGGG + Exonic
1163158121 19:15449856-15449878 AGCGGCGGTAGCGGCAGCGACGG - Exonic
1163284521 19:16338132-16338154 AGACTGGGCAGCAGCAGAGAGGG + Intergenic
1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG + Exonic
1163615212 19:18323054-18323076 AGCGTGTGCAGCGGCGGCGGCGG - Exonic
1163685913 19:18711567-18711589 AGCGTGGCCGGCCGCAGCTGTGG - Intronic
1165396215 19:35565034-35565056 TCCATGGGCAGCAGCAGCGAGGG + Intergenic
1167463875 19:49640103-49640125 AGCGAAGGCAGCAGCAGCGGTGG - Exonic
1167612050 19:50512413-50512435 AGCCAGGGCAGCCGCCGCCATGG + Exonic
925991596 2:9259383-9259405 AGCGGGGGCAGACGCAAGGAAGG - Intronic
926205916 2:10834394-10834416 AGGGTGGCCAGCCCCAGGGAGGG - Intronic
927644781 2:24870687-24870709 AGCCTGGGCACCAGCAGAGAGGG - Intronic
927827245 2:26317395-26317417 AGAGAGGGCAGGTGCAGCGAGGG - Intronic
929021576 2:37558648-37558670 AGAGTGGGAAACAGCAGCGAGGG + Intergenic
932763311 2:74454863-74454885 AGCGTGGGGAGGCGGAGCCAGGG + Intergenic
935591886 2:104852547-104852569 AGCGGGCGCACCCGCAGCTAGGG + Intergenic
937045116 2:118847034-118847056 AGCAGCGGCAGCGGCAGCGATGG - Exonic
942653856 2:178194784-178194806 TGGGTGGGCAGCCGCAGCTTCGG + Intronic
948281187 2:236749037-236749059 AGCGTGAGCAGCTGCAGGGAGGG - Intergenic
948347961 2:237314970-237314992 AGCCAGGGCAGCCACTGCGATGG - Intergenic
1172143963 20:32743448-32743470 AGCGGTGGCAGCGGCAGCGGAGG - Exonic
1173857107 20:46257526-46257548 AGCCTGGGCAGCGGCAATGATGG + Intronic
1174504710 20:51009746-51009768 AGCGAGGGCCGCGACAGCGAGGG - Exonic
1180748841 22:18110847-18110869 GGCGAGGACAGCGGCAGCGATGG + Exonic
1182098600 22:27642302-27642324 AGCGTGGGCGGCCGCAGAGATGG + Intergenic
1182690677 22:32159437-32159459 AAGGTGGGCAGCAGCAGGGATGG - Intergenic
950894924 3:16440134-16440156 AGAGTGGGCCGCTGCCGCGAGGG + Intronic
953982301 3:47418854-47418876 ACAGTGGGCAGCCTCAGCGGGGG + Intronic
954436722 3:50500237-50500259 AGGGTGGGCAGAAGCAGTGAGGG - Intronic
954681254 3:52347251-52347273 AGCATGGGCAGAGGCACCGAGGG + Intronic
962919135 3:139935420-139935442 GGCGTGGGGAGCGGCAGCGGCGG + Exonic
968193512 3:196688530-196688552 AGCGTGGGCAGCAGCAGCGTGGG - Intronic
968512976 4:1003402-1003424 AGCGACGGCAGCCGCAGCGCGGG - Exonic
969271421 4:6105905-6105927 AGCGCGAGCAGGAGCAGCGACGG - Exonic
969433535 4:7170168-7170190 AGCATGGTCAGCTCCAGCGAGGG + Intergenic
975415315 4:74098765-74098787 AGCAGTGGCAGCGGCAGCGATGG + Intronic
975986161 4:80202864-80202886 AGCGCGGGCAGCACCAGCGGTGG + Exonic
993283554 5:85959931-85959953 AGGGTGGGCAGGCGGAGGGAAGG - Intergenic
998504381 5:142660344-142660366 AGGGTGGGCAGCCACAGGGCAGG - Intronic
1002415968 5:179121238-179121260 AGGGTCGGCGGCAGCAGCGACGG + Intronic
1004483236 6:16040586-16040608 AGAGCAGGCAGCCGCAGTGAGGG - Intergenic
1005778056 6:29159800-29159822 CGCGAGGGGAGCCACAGCGAGGG - Intergenic
1005778805 6:29166079-29166101 CGCGAGGGGAGCCACAGCGAGGG + Intergenic
1006725616 6:36197112-36197134 AGCGAGGGCGGCGGCAGGGAAGG + Intronic
1013575993 6:111483632-111483654 GGCGGGGGCAGCCGCTGAGACGG + Exonic
1014813134 6:125907298-125907320 ACCTTGGGCAGCCTCAGCGGAGG - Intronic
1016864089 6:148748229-148748251 GGGGTGGGCAGCGGCAGCCAAGG - Intronic
1018359524 6:163053773-163053795 AGGGAGGGCAGCTGCACCGAGGG - Intronic
1019189875 6:170245692-170245714 AGGGTGAGCAGCCGTCGCGAGGG + Intergenic
1024948239 7:54833397-54833419 TGCGAGGGAAGCCGCAGCGGTGG + Intergenic
1029738013 7:102475192-102475214 GGTGTGGGCAGGCGCAGGGATGG - Intronic
1031804541 7:126292504-126292526 ACAGTGGGCAGCTGCAGCCATGG - Intergenic
1032109820 7:129066459-129066481 AGCCTGAGCAGCCGCCGCCATGG - Intergenic
1035742317 8:1937732-1937754 AGCGAGGGCAGCAGCTGCGGGGG + Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1038428453 8:27480758-27480780 AGCGGTGGCAGCAGCAGGGATGG - Intergenic
1043502860 8:80873992-80874014 AGCCTGGGCAGCCGCCGGGGGGG - Intronic
1044242431 8:89902639-89902661 AGCCGGGGCAGCCGCGGCAACGG + Exonic
1044599724 8:93991672-93991694 AGCGTGGGCAGCTGACGCCACGG + Intergenic
1049327396 8:142030027-142030049 GGAGTGGGCGGCTGCAGCGAGGG - Intergenic
1049429627 8:142554495-142554517 GGTGTGGGCAGCCGCAGCAGAGG + Intergenic
1049562954 8:143321171-143321193 AGCGGGGGCAGCTGGCGCGAGGG + Intronic
1049587857 8:143440291-143440313 AGCCACGGCAGCCGCAGTGAGGG + Exonic
1054798555 9:69325131-69325153 AGCCAGGGCAGCGGCAGCGGCGG + Intronic
1055731897 9:79287166-79287188 AGCTTAGGCAGCCGCAGAGCAGG + Intergenic
1057276867 9:93680729-93680751 AGCCTGGGCAGCCCCAGCATGGG - Intergenic
1059347083 9:113636353-113636375 AGAGTGGACAGCCGCAGCTGCGG - Intergenic
1061680874 9:132241934-132241956 CGCGCGGGCAGGCGCAGCGCTGG - Exonic
1061867431 9:133500068-133500090 AGCGCCGGCAGCAGCAGCCAAGG - Intergenic
1061970654 9:134043346-134043368 AGCCTGGGCTGCCCCAGGGAGGG - Intronic
1062413431 9:136436108-136436130 AGCTTGGTGAGCCGCAGCCAGGG - Intronic
1185759359 X:2678004-2678026 AGCATGAGCTGCCTCAGCGAAGG - Intergenic
1200841497 Y:7785981-7786003 AGAGTGGGCAGACGCTGTGAGGG + Intergenic