ID: 1163431231

View in Genome Browser
Species Human (GRCh38)
Location 19:17268936-17268958
Sequence AGCGTGGGCAGCCGCAGCGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163431226_1163431231 -1 Left 1163431226 19:17268914-17268936 CCGGGCAGTAGGGGCACAGGCCA 0: 1
1: 0
2: 4
3: 37
4: 314
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431218_1163431231 21 Left 1163431218 19:17268892-17268914 CCAATCCTGAAGGGGCTGAGGAC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132
1163431221_1163431231 16 Left 1163431221 19:17268897-17268919 CCTGAAGGGGCTGAGGACCGGGC 0: 1
1: 0
2: 2
3: 22
4: 286
Right 1163431231 19:17268936-17268958 AGCGTGGGCAGCCGCAGCGAGGG 0: 1
1: 0
2: 2
3: 7
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163431231 Original CRISPR AGCGTGGGCAGCCGCAGCGA GGG Exonic