ID: 1163432333

View in Genome Browser
Species Human (GRCh38)
Location 19:17275819-17275841
Sequence GCCTCATGTAAGTCCCCTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163432330_1163432333 2 Left 1163432330 19:17275794-17275816 CCACCAGATCTGGAAGGACTTTT 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1163432329_1163432333 3 Left 1163432329 19:17275793-17275815 CCCACCAGATCTGGAAGGACTTT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1163432327_1163432333 5 Left 1163432327 19:17275791-17275813 CCCCCACCAGATCTGGAAGGACT 0: 1
1: 0
2: 2
3: 18
4: 141
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1163432331_1163432333 -1 Left 1163432331 19:17275797-17275819 CCAGATCTGGAAGGACTTTTCAG 0: 1
1: 0
2: 0
3: 19
4: 166
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1163432323_1163432333 19 Left 1163432323 19:17275777-17275799 CCTTCTCCTTAGCACCCCCACCA 0: 1
1: 0
2: 3
3: 31
4: 448
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1163432324_1163432333 13 Left 1163432324 19:17275783-17275805 CCTTAGCACCCCCACCAGATCTG 0: 1
1: 0
2: 0
3: 11
4: 161
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121
1163432328_1163432333 4 Left 1163432328 19:17275792-17275814 CCCCACCAGATCTGGAAGGACTT 0: 1
1: 1
2: 0
3: 12
4: 135
Right 1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163432333 Original CRISPR GCCTCATGTAAGTCCCCTGT GGG Exonic
900375527 1:2352824-2352846 GCCTGATGTCTGTGCCCTGTAGG + Intronic
901780186 1:11588977-11588999 GCCTTATCTAAGGCCCCTTTGGG + Intergenic
901849627 1:12007270-12007292 GCCTAAAGGAAGTCCCCTGCTGG - Intronic
903687480 1:25142515-25142537 GCCTCCCATTAGTCCCCTGTAGG - Intergenic
903715054 1:25359183-25359205 GGCTCATCTAAGGCACCTGTGGG + Intronic
907474992 1:54699715-54699737 TCCTCAGGGAAATCCCCTGTTGG + Intronic
909510639 1:76448215-76448237 GCCCCATGGAAGTCCCCAGCAGG - Intronic
912885029 1:113461925-113461947 GCCTCATGTATGTCTTCTTTTGG - Intronic
915911879 1:159920483-159920505 GCCATATGCAGGTCCCCTGTTGG + Exonic
922929983 1:229381432-229381454 GCCTCATTGGAGTCCCCTGCGGG - Intergenic
1070750877 10:78963413-78963435 GACTCATGTAATTCCACGGTTGG + Intergenic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1080842745 11:35999729-35999751 GCCTCCTGGAAATCTCCTGTTGG + Intronic
1083372381 11:62192565-62192587 GCCTCAGGAAAGTCCCCAGGTGG - Intronic
1084098960 11:66932810-66932832 GTCTCAATTATGTCCCCTGTTGG + Intronic
1084571519 11:69962679-69962701 GCCCCGTGCAAGTTCCCTGTGGG - Intergenic
1085683865 11:78603964-78603986 GCCTGATGTAACTGCCCAGTGGG + Intergenic
1089732761 11:120529570-120529592 CACACATGTAAGTTCCCTGTCGG + Intronic
1090392479 11:126398114-126398136 GTCTCATCTAAGTCAGCTGTGGG + Intronic
1091003676 11:131932739-131932761 GCATCTGGAAAGTCCCCTGTGGG - Intronic
1091962831 12:4713012-4713034 GACTCCTGTAAGTCCCCATTTGG + Intronic
1094737934 12:33256263-33256285 GCATAATGTAAGTACCATGTAGG - Intergenic
1099632938 12:85173961-85173983 GACTCATGTAAGTCACCTTTAGG + Intronic
1102747093 12:115258712-115258734 GGCTCAAGTGAGTCCCATGTTGG - Intergenic
1103626120 12:122221404-122221426 GCCTCATGGAAAGCCACTGTAGG + Intronic
1103747222 12:123133443-123133465 GCCTCAATTATGTCCACTGTGGG + Intronic
1106123113 13:26878275-26878297 GCCTAATGTAACTACCCAGTAGG + Intergenic
1112806558 13:103169364-103169386 GCCTCATGTATGTCTTCTTTTGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1116354306 14:43908771-43908793 ACCTCATGAAAATACCCTGTTGG + Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202854754 14_GL000225v1_random:43407-43429 GCCTCACGAAAGCCCCCTGTGGG - Intergenic
1202857160 14_GL000225v1_random:58698-58720 GGCACATGAAAGACCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1128752913 15:70161767-70161789 GCCTCCAGTAATTCCCATGTGGG + Intergenic
1130535729 15:84783873-84783895 GATCCAAGTAAGTCCCCTGTTGG + Exonic
1130777320 15:86998460-86998482 GCCTCATGTAAGTCTCAGCTGGG - Intronic
1132708871 16:1257849-1257871 GCCTCATTTAAGCCCCATCTGGG - Intronic
1138184248 16:54964084-54964106 GCCTCAGCAAAGTTCCCTGTTGG - Intergenic
1143402226 17:6653819-6653841 GCATCATGTCGTTCCCCTGTTGG - Intergenic
1152081609 17:78190948-78190970 GCCTCATGTTTGTGCCCTGCAGG + Exonic
1153234258 18:2970577-2970599 GTCTGATTTAAGTCCTCTGTTGG - Intronic
1161754957 19:6125892-6125914 GCCTCATCCAAGGCTCCTGTCGG - Intronic
1163036515 19:14572221-14572243 GGCTCAGGGAAGTCCCCTCTCGG - Intergenic
1163432333 19:17275819-17275841 GCCTCATGTAAGTCCCCTGTGGG + Exonic
929579023 2:43070137-43070159 GCCTCAGGGCTGTCCCCTGTTGG + Intergenic
931584556 2:63811399-63811421 GCCACATGTAAGTAGCCTCTAGG + Intronic
936024103 2:109018184-109018206 GCCACATGTAAGCCCATTGTGGG + Intergenic
938000679 2:127733285-127733307 GACTCCTGTCAGTCCCCTGCAGG - Intronic
939129306 2:138214973-138214995 ACATCATGTAAGTCTCCTCTGGG - Intergenic
940236580 2:151517428-151517450 GCATTATTTAGGTCCCCTGTTGG - Intronic
944888846 2:204095914-204095936 ACCTGAAGTGAGTCCCCTGTAGG + Intergenic
1170570832 20:17631595-17631617 GCCTTATGAAAGTCCCCAGCTGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171906134 20:30900590-30900612 GGCTCATGAAAGCCCCATGTGGG + Intergenic
1180149279 21:45939452-45939474 GCCTCCTTTCATTCCCCTGTTGG - Intronic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1184151785 22:42643730-42643752 GCCTCCTTTAAGGCCCCAGTTGG + Intronic
1184976628 22:48066840-48066862 ACCTGATGTAGGTCCCCTTTCGG - Intergenic
949623990 3:5847907-5847929 GCTTCATGTAGGTACCCTGCAGG - Intergenic
953068976 3:39501324-39501346 TAGTCACGTAAGTCCCCTGTGGG + Intronic
964661581 3:159125823-159125845 GCCCCAGGTTGGTCCCCTGTAGG - Intronic
966906617 3:184530762-184530784 GCCTAATGGAAGTTCCCTGAGGG + Intronic
974366059 4:60950782-60950804 GCATGATGTAAGTCCTCTGTTGG - Intergenic
976412872 4:84737140-84737162 GCCACATGTAAATCTCCTGGTGG + Intronic
976839597 4:89416383-89416405 GCCTCATGAAAGACTCATGTAGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
990989300 5:61669653-61669675 GCCTCATGAAAGAACCCTGCTGG - Intronic
994077440 5:95669322-95669344 GCCTCATGGCAGGCCCATGTGGG + Intronic
1004756286 6:18614316-18614338 GCATCATGTAAAAACCCTGTAGG + Intergenic
1007491550 6:42226911-42226933 GCTTCATGCAACTCCCCTTTTGG - Exonic
1009759890 6:67991866-67991888 TCCTCAAGTGAGTCTCCTGTCGG - Intergenic
1010234569 6:73564589-73564611 GGCTCAAGTAAGTCGCCTCTTGG - Intergenic
1012118178 6:95331234-95331256 GCCTCAGCTGAGTCCCCAGTTGG - Intergenic
1016994582 6:149952812-149952834 CCCTCATGTGAATCCCATGTAGG - Intergenic
1020974822 7:14991796-14991818 GCCTCATGTATGTCTTCTTTTGG - Intergenic
1021262576 7:18476495-18476517 GCCACATTTAAGTCCCCTAGAGG - Intronic
1023835901 7:44066961-44066983 GCTTCATGTCTGGCCCCTGTGGG - Intronic
1026607365 7:71827372-71827394 GCCTCATTTAAGTCTCATGGAGG + Intronic
1030887064 7:114951267-114951289 GCCTAAGGTCAGTCACCTGTTGG + Intronic
1032481423 7:132250139-132250161 TCCTCATCTAAGTACCCTGATGG + Intronic
1037942684 8:22964605-22964627 CCTTCATGTGAGTCCCCTGAGGG - Intronic
1041848072 8:62354816-62354838 GCCTTCTTTATGTCCCCTGTGGG - Intronic
1043120760 8:76320129-76320151 GCCTCAAGTTAGTCCCCTCTTGG - Intergenic
1043658997 8:82710954-82710976 GCCTCAAGAAATTCTCCTGTCGG - Intergenic
1043670913 8:82883036-82883058 TCCTCCTGCAATTCCCCTGTTGG - Intergenic
1046152563 8:110246896-110246918 GCTTCATGGAAGTCTTCTGTGGG - Intergenic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1055279638 9:74659459-74659481 GCCTGCTGTGAGTCCCCTGAAGG - Intronic
1056578102 9:87870980-87871002 GCCTGATGTCAGGCCCCTGGAGG - Intergenic
1060807818 9:126588496-126588518 GCCTCATGTTCGACCCCAGTAGG - Intergenic
1062043516 9:134414936-134414958 GGCTCATGGAAGTCCCATGTGGG + Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1188860539 X:35250961-35250983 GCCCCATGCACGTCCCCGGTGGG - Intergenic
1195405535 X:104509036-104509058 CCCTAAGGTAAGTCCCCTCTAGG - Intergenic
1201175736 Y:11307522-11307544 GGCTCATGAAAGCCCCTTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic