ID: 1163434955

View in Genome Browser
Species Human (GRCh38)
Location 19:17289899-17289921
Sequence TGGCCCCTGTTTTACACTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163434955_1163434964 18 Left 1163434955 19:17289899-17289921 CCTCCAGTGTAAAACAGGGGCCA No data
Right 1163434964 19:17289940-17289962 TGTACTCCCAGAACTTTGGGAGG 0: 36
1: 6807
2: 311716
3: 268106
4: 151403
1163434955_1163434961 14 Left 1163434955 19:17289899-17289921 CCTCCAGTGTAAAACAGGGGCCA No data
Right 1163434961 19:17289936-17289958 CGCCTGTACTCCCAGAACTTTGG 0: 17
1: 2220
2: 133918
3: 283787
4: 226483
1163434955_1163434962 15 Left 1163434955 19:17289899-17289921 CCTCCAGTGTAAAACAGGGGCCA No data
Right 1163434962 19:17289937-17289959 GCCTGTACTCCCAGAACTTTGGG 0: 32
1: 4893
2: 234537
3: 278540
4: 184158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163434955 Original CRISPR TGGCCCCTGTTTTACACTGG AGG (reversed) Intergenic
No off target data available for this crispr