ID: 1163436535

View in Genome Browser
Species Human (GRCh38)
Location 19:17299237-17299259
Sequence AATTATATAGAGAATGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 291}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163436535_1163436544 12 Left 1163436535 19:17299237-17299259 CCCCCCCCATTCTCTATATAATT 0: 1
1: 0
2: 4
3: 18
4: 291
Right 1163436544 19:17299272-17299294 TGAAAATTGGCCTGGTGCGTTGG 0: 1
1: 0
2: 15
3: 173
4: 1885
1163436535_1163436543 4 Left 1163436535 19:17299237-17299259 CCCCCCCCATTCTCTATATAATT 0: 1
1: 0
2: 4
3: 18
4: 291
Right 1163436543 19:17299264-17299286 TTTGAACTTGAAAATTGGCCTGG 0: 2
1: 0
2: 4
3: 34
4: 364
1163436535_1163436542 -1 Left 1163436535 19:17299237-17299259 CCCCCCCCATTCTCTATATAATT 0: 1
1: 0
2: 4
3: 18
4: 291
Right 1163436542 19:17299259-17299281 TTTTTTTTGAACTTGAAAATTGG 0: 1
1: 1
2: 11
3: 153
4: 1363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163436535 Original CRISPR AATTATATAGAGAATGGGGG GGG (reversed) Intronic
900664232 1:3803429-3803451 GATTATATAGAGGATGGGCCGGG - Intergenic
900812017 1:4811420-4811442 GATGATATTGATAATGGGGGAGG + Intergenic
900840134 1:5042115-5042137 AATTACATAAAGAATGGGGTTGG - Intergenic
901376574 1:8843852-8843874 AATTGGAAAGAGAATGGGGAAGG - Intergenic
902711634 1:18243921-18243943 ACAGATATGGAGAATGGGGGAGG - Intronic
903763762 1:25718624-25718646 AAATATATAGAGACTGAGGGAGG - Intronic
907146933 1:52243316-52243338 GATAATATAAAAAATGGGGGTGG + Intronic
907779246 1:57550512-57550534 GATTAGTTAGAGAAGGGGGGTGG - Intronic
911270218 1:95792201-95792223 AATAATATTGAGAATGGCAGAGG + Intergenic
911443247 1:97956586-97956608 AAATACAGAGAGAATGGGGTAGG + Intergenic
911740934 1:101386157-101386179 AATTCTGTTGAGGATGGGGGAGG + Intergenic
912578281 1:110695658-110695680 AATTATTTTCAGAATGGGGATGG - Intergenic
913061703 1:115214481-115214503 AAACAGATAGGGAATGGGGGTGG - Intergenic
913384678 1:118246636-118246658 CATTATATAGAACATGGGGTTGG - Intergenic
913408881 1:118528153-118528175 AGTTAGAGAGAGAGTGGGGGAGG + Intergenic
914422609 1:147542709-147542731 ATTTGTACAGAGAATGGGGTGGG + Intronic
915020220 1:152772053-152772075 AAAAATAAATAGAATGGGGGAGG - Intronic
916008636 1:160684496-160684518 ATTAATATAAAGAATGGGGCAGG - Intronic
916386433 1:164276877-164276899 AATAATATAAAGAATGAGAGGGG + Intergenic
916974949 1:170066179-170066201 TATAACATAAAGAATGGGGGGGG - Intronic
917579621 1:176362070-176362092 AAGAATAAAGAGAATGGAGGAGG + Intergenic
917643418 1:177006263-177006285 AAATATATACAGAATTGAGGTGG + Intronic
918039125 1:180901513-180901535 AGGTATATACAGAATGTGGGAGG + Intergenic
919713516 1:200751855-200751877 AATTAGATGGAGAATAGGGTTGG + Intronic
919844482 1:201632753-201632775 ATATATAGAGAGAATGGGTGGGG + Intronic
920770324 1:208878612-208878634 TTTTATATTGAGAATGGGGAGGG - Intergenic
920976780 1:210793606-210793628 AATTAAACAGAGAATGTGAGTGG + Intronic
921565947 1:216720042-216720064 AAATATATATTGAATGGGAGTGG - Intronic
921774250 1:219078832-219078854 TATTCTATAGAAAATGGGGCAGG - Intergenic
921940133 1:220830561-220830583 AAAGAAATAGAGAATGGGAGAGG - Intergenic
923845394 1:237725193-237725215 AATTATCTAGAAAAAGTGGGAGG + Intronic
923915947 1:238505129-238505151 AATTTCAAAAAGAATGGGGGAGG + Intergenic
924371696 1:243357534-243357556 CATCATATACAGAATGGAGGAGG - Intronic
1063046451 10:2397498-2397520 AATAATTTTAAGAATGGGGGAGG - Intergenic
1063560998 10:7127548-7127570 TATTATCCAGAGATTGGGGGTGG + Intergenic
1064985769 10:21208497-21208519 AATTAATTAGAGAAGGAGGGAGG - Intergenic
1065755177 10:28924483-28924505 AATTACATAGAAAATAGGGCCGG - Intergenic
1067272049 10:44800485-44800507 GATTGTATTAAGAATGGGGGAGG + Intergenic
1068113037 10:52704111-52704133 ATTTAAAGAGAGACTGGGGGTGG + Intergenic
1068923047 10:62505305-62505327 AATTATAGAGGGTTTGGGGGTGG - Intronic
1069222233 10:65898677-65898699 AAATGTATAAAGCATGGGGGTGG - Intergenic
1069403377 10:68074026-68074048 AATTATTTAAAGATTGGCGGGGG + Intronic
1071033656 10:81216014-81216036 AATTATATATAGAATGTGTAAGG + Intergenic
1071162284 10:82762394-82762416 AATTATATAAACATTGGGGCTGG - Intronic
1072008029 10:91274891-91274913 AATTATACTGAGACTGGGTGGGG + Intronic
1073772707 10:106752762-106752784 AATGCTAAGGAGAATGGGGGAGG + Intronic
1073835512 10:107436601-107436623 TAAAATAGAGAGAATGGGGGCGG + Intergenic
1073989624 10:109247852-109247874 AATTATAAAGAGACTGTGGCAGG + Intergenic
1074343209 10:112654775-112654797 AAGTATAAAAAGAATGGGGCCGG - Intronic
1074650121 10:115512767-115512789 AATACTATAGAGTAAGGGGGTGG + Intronic
1074970273 10:118530703-118530725 AATGACCTAGAGAATGGGAGAGG - Intergenic
1081083100 11:38768030-38768052 AATTAAGTTGAAAATGGGGGAGG + Intergenic
1081380476 11:42408461-42408483 AATAATATATAAGATGGGGGTGG - Intergenic
1082011453 11:47452556-47452578 AATTATAGAGAGGCTGGGCGTGG - Intergenic
1082801485 11:57418154-57418176 AATTTTCTAGAGAAGGGGTGAGG - Intronic
1085558381 11:77446805-77446827 AACAATAAAGAGAATGGGTGAGG + Intronic
1086867619 11:91999054-91999076 ACATATATAGAGAAGGGAGGAGG + Intergenic
1087765798 11:102151880-102151902 AATTATGTACAGAGTGAGGGAGG + Intronic
1088028931 11:105222496-105222518 TATTACACTGAGAATGGGGGAGG - Intergenic
1088364354 11:109023372-109023394 AATTTTAAAAAGATTGGGGGAGG - Intergenic
1089821843 11:121235724-121235746 AATTAAAAAGAAAATTGGGGAGG + Intergenic
1090849739 11:130561714-130561736 AATTATGTAGTGCTTGGGGGCGG + Intergenic
1090891355 11:130925677-130925699 GATAATAAAGAGAATGGAGGAGG + Intergenic
1092267448 12:6993461-6993483 AATTAGATAGATAGTGGGGATGG - Intronic
1092813550 12:12293144-12293166 CGTTATATAGAGATTGGTGGTGG + Intergenic
1094194709 12:27735637-27735659 AACTATATTGAAGATGGGGGAGG + Intronic
1095850156 12:46793927-46793949 AATTGTATAGTGAAAAGGGGTGG + Intronic
1096597407 12:52705223-52705245 ATTTATTTAGAGACTGTGGGAGG + Intergenic
1098608064 12:72419047-72419069 AATTATAAAGGGAAAGGGGTAGG + Intronic
1099195375 12:79609092-79609114 AATTATACAGAAAATGGGGTTGG + Intronic
1099703725 12:86122908-86122930 AATTATAAAAAGAAAGGGAGAGG + Intronic
1100291170 12:93216060-93216082 AATTAAATAGAGAGAGAGGGTGG - Intergenic
1102185400 12:110943868-110943890 AAATATGTACAGTATGGGGGCGG - Intergenic
1104064071 12:125292222-125292244 AATTATATATGTAATGGGGGAGG - Intronic
1109650230 13:65314326-65314348 AATCCTCTAGGGAATGGGGGAGG - Intergenic
1110347484 13:74465250-74465272 AAATATATTTACAATGGGGGTGG - Intergenic
1111889644 13:94065751-94065773 AATTATACAGAGAAAGATGGTGG - Intronic
1114552849 14:23543957-23543979 CTTCATATAGAGAATGGGGCAGG + Intronic
1115894152 14:38065413-38065435 AATTTTCTAGAAAATGGGTGAGG - Intergenic
1116610179 14:47059102-47059124 TATTATAGAGACAATGGGAGGGG + Intronic
1116867528 14:50042940-50042962 AATTATAAACAGACTGGGCGTGG + Intergenic
1118705336 14:68475068-68475090 CATGAGATAGAGAATGGTGGTGG + Intronic
1120181527 14:81347731-81347753 TATTTTATAGAGAAGGGGGAGGG - Intronic
1120520984 14:85528435-85528457 AATGAGATTGAAAATGGGGGAGG - Intergenic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1127343484 15:58069563-58069585 AAATAATTACAGAATGGGGGGGG - Intronic
1127425753 15:58854296-58854318 AATTATATCCAGAATGGTAGCGG + Intronic
1127830570 15:62747278-62747300 AAGTAGATACAGAATTGGGGTGG - Intronic
1128277116 15:66363085-66363107 AACTAAATAGAGACTGGGTGCGG + Intronic
1128432963 15:67617239-67617261 AATTAAAGAAAGAATGGGGGAGG - Intronic
1128767399 15:70259546-70259568 CATTAGATAGGGAGTGGGGGAGG - Intergenic
1129174316 15:73829167-73829189 CATAATATAGAGAATGGGGGAGG + Intergenic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130312626 15:82768404-82768426 AATAAAACAGAGAATGGTGGTGG - Intronic
1131053077 15:89360674-89360696 AATTCAATAGGAAATGGGGGAGG + Intergenic
1131387753 15:92021286-92021308 AAATGTATACAGAATGGGAGAGG - Intronic
1132154792 15:99487817-99487839 AATTAAAAAAAAAATGGGGGTGG + Intergenic
1132336700 15:101052562-101052584 AACTAGAGAGAGAATCGGGGAGG + Intronic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1133705091 16:8346961-8346983 AGTGGTATAGAGAAGGGGGGTGG + Intergenic
1135574002 16:23571059-23571081 AATTGTATGCAAAATGGGGGTGG + Exonic
1135844212 16:25903778-25903800 TATTGTTTAGAGAATGTGGGAGG - Intronic
1136107070 16:28037540-28037562 TATTATATATAGCATGAGGGAGG - Intronic
1137069084 16:35883296-35883318 AATTATCTTGAGAAAGGGAGGGG + Intergenic
1137399624 16:48142650-48142672 TATAATATAAAGAATGGGGAAGG - Intronic
1137827200 16:51509102-51509124 AATTATATATAGAAAGGGGACGG + Intergenic
1139076794 16:63461165-63461187 TATTAAAGAGAGAATGGGGTAGG + Intergenic
1139131431 16:64151182-64151204 AATTAAAGATAGAATGGGGGAGG - Intergenic
1139253559 16:65519705-65519727 CATTATAAAGAGAAGGGGAGAGG - Intergenic
1142728582 17:1834651-1834673 AATTATATAACGAAAGGGGAAGG + Intronic
1143566188 17:7722174-7722196 ATTTTTATAGAGACGGGGGGGGG + Intronic
1145771478 17:27496417-27496439 AACAAAATAGAGAAAGGGGGCGG - Intronic
1146643904 17:34563653-34563675 AATTACATGGGGAATGTGGGAGG - Intergenic
1149369277 17:55977364-55977386 AATTATGTATAGCATGGGTGGGG - Intergenic
1152051658 17:77983770-77983792 AATTATATATAAAATAAGGGGGG - Intergenic
1152994898 18:397313-397335 AATAAAATAGAGCATGGGGTGGG - Intronic
1153547264 18:6220492-6220514 TATTATATAGAGAGTCAGGGTGG - Intronic
1155108623 18:22691678-22691700 AATTAAATAGAAAATGGGAAAGG + Intergenic
1158326125 18:56315468-56315490 AATTATTGAGAGAATGAGAGAGG - Intergenic
1158828229 18:61248452-61248474 AATTAAAGGGAGAATGGGGTGGG + Intergenic
1159015433 18:63098625-63098647 AATGGCATGGAGAATGGGGGAGG - Intergenic
1159280814 18:66282510-66282532 AATTTTACATAGAATGGGGTAGG + Intergenic
1160076179 18:75679855-75679877 AAATATAGAGGGTATGGGGGAGG - Intergenic
1160264834 18:77333086-77333108 AATTATTTAGTAAATGGTGGTGG - Intergenic
1163195087 19:15713254-15713276 AGTTATTTAGAGAATGTGGAAGG + Intergenic
1163436535 19:17299237-17299259 AATTATATAGAGAATGGGGGGGG - Intronic
1165009253 19:32831977-32831999 AATTAAAAAGAAAATGGGGCTGG + Intronic
1166367037 19:42283090-42283112 GATTATATAGAGGGTGGGGTCGG + Intronic
1166570219 19:43790997-43791019 ACTGATATAGAGAAGGGGCGAGG - Intergenic
1166791907 19:45403804-45403826 GATTAAAAACAGAATGGGGGAGG - Intronic
1167682304 19:50931339-50931361 AAGTTTAAAGAGACTGGGGGTGG - Intergenic
1168121819 19:54256011-54256033 AATTATATAAAGAAGTGTGGTGG + Intronic
927532629 2:23822574-23822596 GATTATATAGAGCAGGGGAGTGG - Intronic
928464338 2:31507191-31507213 CATAATATAGAGAATGGTAGAGG + Intergenic
929734165 2:44527789-44527811 GAGTATATTGATAATGGGGGGGG - Intronic
930557269 2:52914135-52914157 AAATATATAGAAAATGGAGGAGG - Intergenic
932113340 2:69021947-69021969 AAGTATGCAGAGAATGGGGAAGG - Intronic
934910864 2:98253219-98253241 TGTTATATAGGGGATGGGGGTGG - Intronic
935403891 2:102688196-102688218 AATTATATTCAAAATTGGGGAGG + Intronic
935422498 2:102884459-102884481 AATTATATATAGGCTGGGAGTGG + Intergenic
935524789 2:104152552-104152574 ATATATATAATGAATGGGGGTGG + Intergenic
935990836 2:108717967-108717989 AAATATATATAGATTTGGGGGGG + Intergenic
938942018 2:136177805-136177827 AATTATATATAGGTTGGGCGCGG + Intergenic
939801626 2:146718431-146718453 GATTATAAAGAGAATAGTGGTGG + Intergenic
939914650 2:148023677-148023699 AATTATGTAGATAATTGGGGTGG + Intronic
940603709 2:155893128-155893150 AATGAGATAGAGAATGTTGGTGG - Intergenic
941829507 2:169939209-169939231 AATGAAATAGAAAATGGGGGTGG - Intronic
941981758 2:171465779-171465801 AATGAAATAGAAAATGGGGCTGG - Intronic
943068078 2:183109622-183109644 AATTATATTGCAAATGGGGAAGG + Intergenic
943437447 2:187884241-187884263 AGTTATAGAGAAAATGGGGATGG - Intergenic
944379036 2:199085486-199085508 AATTAGATGGAGAATAGGGTTGG + Intergenic
947665333 2:231901782-231901804 AATTCTATAGTGAATTGGGCCGG + Intergenic
1172510050 20:35494344-35494366 AATTGTATTGAGGAAGGGGGTGG + Intronic
1173885143 20:46450971-46450993 ATTTGCATAGAGATTGGGGGTGG + Intergenic
1174774273 20:53329633-53329655 AATTATATGGATAATGGTTGTGG + Intronic
1178036197 21:28585760-28585782 AATTATAGGGAGAATAGGGAAGG + Intergenic
1178455389 21:32745294-32745316 AATTATACAGAGTTTGAGGGAGG - Intronic
1178964065 21:37098680-37098702 AATCATATAGACAATGTGTGAGG - Intronic
1180302465 22:11048269-11048291 AAATAAATAAATAATGGGGGGGG - Intergenic
1180747304 22:18098660-18098682 TATTATAAAGAAAATGAGGGAGG - Exonic
1180923296 22:19534194-19534216 AATTATATTATAAATGGGGGAGG + Intergenic
1180926668 22:19559912-19559934 AGTTATATACAGAATGGTGATGG + Intergenic
1181618805 22:24073490-24073512 AATTATAGAGAGAATGTGAAGGG - Intronic
1184961926 22:47936102-47936124 AATTATATTAAAAATGGGGAAGG + Intergenic
949095390 3:79582-79604 AATTATATCATAAATGGGGGAGG - Intergenic
949636107 3:5982821-5982843 AATTATGTAGAGATTCGGGTGGG + Intergenic
950256320 3:11509651-11509673 AATTAGAGATAGATTGGGGGAGG - Intronic
950327817 3:12129142-12129164 GATAATATAGAGAATGATGGAGG + Intronic
950761858 3:15237529-15237551 AATTCTATAGAGCATGGCTGGGG - Intronic
951031356 3:17885246-17885268 AATTTCATGGAGAATGGGGGTGG + Intronic
951276616 3:20695019-20695041 AATTATTTAAAGTATTGGGGGGG - Intergenic
952480974 3:33761347-33761369 AATTATATTGTCAATGGGAGTGG - Intergenic
952580130 3:34823653-34823675 AAATAGAGAAAGAATGGGGGTGG + Intergenic
952723849 3:36561221-36561243 GATTTTGTAGAGATTGGGGGAGG - Intergenic
954095059 3:48319773-48319795 AATTATATACATATTGTGGGTGG - Intronic
954295258 3:49670941-49670963 AAGTATTTACAGCATGGGGGTGG - Exonic
954475400 3:50739681-50739703 AAGTATAAAGAGAATGGGCTTGG + Intronic
954944875 3:54413528-54413550 AAATATAAAGAGAAAGGGGCAGG - Intronic
955870215 3:63430645-63430667 TATTATATAGACAATGTGGAAGG + Intronic
956989385 3:74745524-74745546 GATGATATAGAGAAAGGAGGAGG - Intergenic
957204529 3:77178654-77178676 AATTATATACACACTGTGGGGGG - Intronic
959995644 3:112677522-112677544 AAATGCATAGAGAATGGGAGGGG - Intergenic
960516954 3:118612718-118612740 AATTCTATAAAGAATGATGGTGG - Intergenic
960699039 3:120423146-120423168 AATAATAAAGAAAATGGTGGAGG - Intronic
962973570 3:140426876-140426898 ACTTAAAGAGAGAATGGGGCTGG + Intronic
963008965 3:140751684-140751706 AATTACATAGCACATGGGGGAGG + Intergenic
964498309 3:157318968-157318990 AATTCTCTAGAGAATGGGGGAGG + Intronic
965177805 3:165358349-165358371 AATTATATAGAGACTGCTGATGG + Intergenic
970844532 4:20520783-20520805 AAATAAAGAGAGAATTGGGGTGG - Intronic
972100212 4:35406560-35406582 GATAATATAGATCATGGGGGAGG + Intergenic
972478153 4:39472477-39472499 ATTTGTGAAGAGAATGGGGGAGG - Intronic
972882023 4:43436731-43436753 AAAGATAGTGAGAATGGGGGTGG - Intergenic
972896213 4:43623921-43623943 AATTATATAGGCATTGGGGCAGG + Intergenic
973645955 4:52951521-52951543 AATTATATTGAAAATTTGGGGGG + Intronic
973946134 4:55958088-55958110 GATTATACAGAGAATGTGGGGGG + Intronic
974588557 4:63914767-63914789 AATTATATAAAAAATAGAGGGGG - Intergenic
975497121 4:75047041-75047063 AGTTATAGAGAGAAAGGGAGAGG + Exonic
976292015 4:83429001-83429023 AAGTATATAGAGAATAAGGTAGG - Intronic
976721786 4:88176346-88176368 AATTATAAAGAGAACAGGAGAGG - Intronic
976725786 4:88214397-88214419 GATTTGAGAGAGAATGGGGGAGG - Intronic
977111426 4:92961092-92961114 AATGATACAAAGAATGGAGGGGG - Intronic
977484925 4:97632937-97632959 AATTATATTTAGAAGGGGGATGG + Intronic
977749484 4:100591823-100591845 TGCTATATAGAGAATGGGGAAGG - Intronic
977912136 4:102549553-102549575 AATTATATATATATGGGGGGAGG + Intronic
978811450 4:112854127-112854149 ACTTCTATAGAGAAGGGGTGAGG + Intronic
979013217 4:115396949-115396971 ATATAAATAAAGAATGGGGGTGG - Intergenic
980137814 4:128876958-128876980 AATTATATAGCAAATGGTGGTGG - Intronic
981796747 4:148604401-148604423 AATTATCATGAGAATGGGGATGG + Intergenic
982497518 4:156109434-156109456 AATTATATAAATAATGAGGTTGG + Intergenic
983868170 4:172792849-172792871 ATTTATATAGATAAAGAGGGAGG - Intronic
986643031 5:9890494-9890516 AATGATATATATAATGGGGTTGG - Intergenic
986807572 5:11323217-11323239 AAACATTTAGAGATTGGGGGGGG + Intronic
986983212 5:13473056-13473078 AATTATAGTGAGAATGGGAGGGG - Intergenic
987550328 5:19371284-19371306 ATTTATATAGAGAATGCAAGAGG + Intergenic
989755323 5:44945754-44945776 AATTATATAGAGGAAAGGAGAGG + Intergenic
992014240 5:72559519-72559541 ATTTATATAGAAAAGGGGGTTGG + Intergenic
992325605 5:75656665-75656687 AATGATGAAGGGAATGGGGGTGG + Intronic
992840966 5:80694434-80694456 AATTATATTATAAATGGGGGAGG - Intronic
992987072 5:82241754-82241776 TAATATATAGAGAATGATGGGGG - Intronic
993330547 5:86594696-86594718 CATTATATAGGGAAGGTGGGCGG - Intergenic
995385931 5:111588746-111588768 AATCTTATAGATAATGGGGCAGG - Intergenic
995792907 5:115911907-115911929 AATTAAATAGTGAATAGGGCTGG - Intronic
995793908 5:115922424-115922446 AATTATAAAGAGCATGGGATTGG + Intergenic
996456067 5:123683080-123683102 AATTATATAATAAATGGGGGAGG + Intergenic
996502852 5:124236007-124236029 AGTTATAGAGAGGAGGGGGGAGG - Intergenic
999496966 5:152108536-152108558 AATTATCTGGAAAATGGTGGAGG + Intergenic
999793495 5:154965767-154965789 TTTGATATACAGAATGGGGGAGG + Intronic
1000614640 5:163413683-163413705 AAATGTAAAGAGAATGGGAGAGG + Intergenic
1000635733 5:163641692-163641714 AAGGAAATAGAGAAAGGGGGAGG + Intergenic
1000642659 5:163721071-163721093 AATTATAGAGAGAATGGAGGAGG - Intergenic
1002874205 6:1196962-1196984 AATTATATAGAAAAATAGGGGGG + Intergenic
1003810013 6:9768653-9768675 AATTTACTAGAGAATGGGGAAGG - Intronic
1004049156 6:12057794-12057816 AATTATTTGGACAATGGGAGGGG + Intronic
1004087821 6:12468805-12468827 AATTTTAAAGGGAATGGGGCAGG - Intergenic
1004942066 6:20569083-20569105 TATTATATAGAGCATAGAGGTGG + Intronic
1005605770 6:27475658-27475680 AATAATAGAGAAACTGGGGGAGG + Intergenic
1005825605 6:29630059-29630081 AATTATATAAGGAATGGTGAGGG + Intronic
1005827618 6:29644250-29644272 AATTATAAGTAGGATGGGGGAGG + Intergenic
1006795945 6:36732403-36732425 AATTTTAGGGAGAATGTGGGGGG + Exonic
1007668205 6:43529222-43529244 AATTATAAGGAGAATGGTGAAGG - Intronic
1009023516 6:57970685-57970707 AATTCTATACAGAAGGAGGGTGG + Intergenic
1009199088 6:60722250-60722272 AATTCTATACAGAAGGAGGGTGG + Intergenic
1010237857 6:73589999-73590021 AGTTTTATTTAGAATGGGGGTGG + Intergenic
1010772462 6:79847115-79847137 AAATATATAGAGAAGGGGTTAGG - Intergenic
1010941460 6:81922914-81922936 AATTATATTATAAATGGGGGAGG + Intergenic
1010962574 6:82163413-82163435 AAATGTATAAAGAATGGGTGAGG - Intergenic
1011984477 6:93425718-93425740 AATCAAATAGAGAATGTGGCAGG - Intergenic
1012408723 6:98931147-98931169 AGTTTTATAAAGAAAGGGGGAGG - Intronic
1012551557 6:100468116-100468138 AAAAATAAAGAGAATGGTGGTGG - Intergenic
1013637333 6:112041609-112041631 AGTTTTATTGGGAATGGGGGTGG + Intergenic
1014696126 6:124623155-124623177 AATTATGGAGATAATTGGGGAGG + Intronic
1015957821 6:138616472-138616494 AAGTAAATAGAGAAAGGGGGAGG + Intronic
1016354638 6:143204751-143204773 GATTATCTTTAGAATGGGGGAGG + Intronic
1017755891 6:157528829-157528851 AATTAGATGAAGACTGGGGGTGG + Intronic
1017755899 6:157528885-157528907 AATTAGATGAAGACTGGGGGTGG + Intronic
1017755907 6:157528941-157528963 AATTAGATGAAGACTGGGGGTGG + Intronic
1018139425 6:160814281-160814303 TATCATAAAGAGAATGGGCGTGG + Intergenic
1018236110 6:161725283-161725305 AATTATAAAGACAATGGGTAGGG + Intronic
1018659204 6:166069574-166069596 GATTAGATAGATCATGGGGGTGG + Intergenic
1020711745 7:11614756-11614778 ATTTATATAGAGTATGTTGGTGG + Intronic
1020905600 7:14060770-14060792 AATTATATAGAGCCTAGGTGCGG + Intergenic
1021312814 7:19113975-19113997 AATAATTTAGAAAATGGAGGTGG + Intronic
1021453074 7:20799341-20799363 ATTTATAAAGAGAAGGTGGGAGG - Intergenic
1023639529 7:42243318-42243340 AATTATACAGAGAATTTGGTAGG + Intergenic
1025899466 7:65732139-65732161 TTTTAAATAGAGATTGGGGGGGG + Intergenic
1026310222 7:69176950-69176972 AAATATATAGGGAAAGAGGGGGG - Intergenic
1028182655 7:87744336-87744358 AATTCTATGAAGAATGGTGGTGG + Intronic
1028230912 7:88305906-88305928 AATTGGATAGAGAATGGGGGAGG - Intronic
1028714128 7:93944771-93944793 TATTATAGAGAGACTGTGGGTGG + Intergenic
1028994123 7:97080831-97080853 AATTATGTAGAGGATTAGGGAGG + Intergenic
1032543904 7:132726428-132726450 CATTATTTAGAGAATGAGGCTGG + Intronic
1033623690 7:143087385-143087407 AATTCTGTAAAGAATGGTGGTGG - Intergenic
1033681009 7:143596640-143596662 AATTTAATGGAGAAGGGGGGGGG - Intergenic
1033703883 7:143865173-143865195 AATTTAATGGAGAAGGGGGGGGG + Intronic
1033889229 7:145988327-145988349 AAGGATATGGATAATGGGGGAGG - Intergenic
1036662666 8:10717954-10717976 CATTATACAAAGAATGGGAGAGG - Intergenic
1036974472 8:13395408-13395430 AATTATAAAGAGGCTGGGTGCGG - Intronic
1037557844 8:20042844-20042866 AAGTATTTAGATCATGGGGGTGG + Intergenic
1039380627 8:37081568-37081590 ACTTTTAAAGGGAATGGGGGAGG - Intergenic
1044446317 8:92280888-92280910 AATTAGAGAAAGAAAGGGGGGGG + Intergenic
1045239660 8:100388149-100388171 AATTTGATGGAGAATGGAGGAGG - Intronic
1045301947 8:100918928-100918950 CATTATTTAGAGAATAGAGGAGG + Exonic
1045472921 8:102528424-102528446 ATTTATCTACAGAATGGGGTGGG - Intergenic
1046135629 8:110022904-110022926 TTTTATATATAGCATGGGGGGGG + Intergenic
1046583057 8:116117023-116117045 AATGATAGAGTGAAAGGGGGAGG + Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1047448861 8:124944390-124944412 AATAGGATAGAGAATGGCGGGGG - Intergenic
1047658973 8:127011718-127011740 AATCACATAGAGAAGGGGGGTGG + Intergenic
1047702845 8:127467075-127467097 ATTTATATAGTGGATGGGGAAGG - Intergenic
1047819445 8:128502550-128502572 AATTATGCATAGAATAGGGGTGG - Intergenic
1048188682 8:132267864-132267886 GAGGATATTGAGAATGGGGGAGG - Intronic
1051363068 9:16299077-16299099 AATTCTGTGGAGAATGGTGGTGG - Intergenic
1054747187 9:68866321-68866343 TATTATAAAGAAAATGAGGGAGG - Intronic
1055345955 9:75339091-75339113 AATTCTATAAAGAATGATGGTGG + Intergenic
1055387904 9:75783868-75783890 AATTATATAAAAAATGAGGTTGG + Intergenic
1055490354 9:76798723-76798745 AATAATAGAGAAGATGGGGGAGG - Intronic
1056024377 9:82477644-82477666 AATTTAATAGAGAATGAGGCGGG + Intergenic
1059027582 9:110652032-110652054 AAGTAAGCAGAGAATGGGGGTGG - Intergenic
1060571063 9:124641032-124641054 TATTATCTATAAAATGGGGGTGG - Intronic
1060957945 9:127657578-127657600 TATTGTATAGAGAATGTGGTTGG + Intronic
1186074947 X:5867864-5867886 AATGATATTGATAATGGTGGGGG - Intronic
1186382838 X:9078972-9078994 AATTATATGGAGGCTGGGTGCGG + Intronic
1188013787 X:25085623-25085645 TAGGATATAGAGAAAGGGGGAGG - Intergenic
1189236033 X:39488201-39488223 TTTTATATTGAGGATGGGGGTGG + Intergenic
1189289514 X:39875432-39875454 CATAATATAAAGAATGGGGGTGG + Intergenic
1193557224 X:82969917-82969939 AATTGAATACAGAATGTGGGAGG - Intergenic
1194217733 X:91151582-91151604 AATTATAATGAGAATGGGATTGG + Intergenic
1194828039 X:98586907-98586929 AATGAAATAGAAAATGGAGGGGG - Intergenic
1196835171 X:119807327-119807349 AAGAATAGAGAGAAAGGGGGTGG - Intergenic
1198308446 X:135405507-135405529 TATAAAAGAGAGAATGGGGGAGG + Intergenic
1198651806 X:138871355-138871377 CAGTATATAGAAGATGGGGGGGG + Intronic
1199693045 X:150323606-150323628 AATTATATTATAAATGGGGGAGG + Intergenic
1200554241 Y:4615378-4615400 AATTATAATGAGAATGGGATTGG + Intergenic
1200842155 Y:7793428-7793450 GATTATGCAGAGATTGGGGGAGG - Intergenic