ID: 1163437047

View in Genome Browser
Species Human (GRCh38)
Location 19:17302187-17302209
Sequence CAGGGTGTCCACAGGGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 413}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163437037_1163437047 12 Left 1163437037 19:17302152-17302174 CCTCAGAGAGAAAGACTTGGCTA 0: 1
1: 0
2: 4
3: 38
4: 202
Right 1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG 0: 1
1: 0
2: 6
3: 42
4: 413
1163437035_1163437047 22 Left 1163437035 19:17302142-17302164 CCTAGTCTATCCTCAGAGAGAAA No data
Right 1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG 0: 1
1: 0
2: 6
3: 42
4: 413
1163437034_1163437047 23 Left 1163437034 19:17302141-17302163 CCCTAGTCTATCCTCAGAGAGAA 0: 1
1: 0
2: 3
3: 10
4: 150
Right 1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG 0: 1
1: 0
2: 6
3: 42
4: 413

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163437047 Original CRISPR CAGGGTGTCCACAGGGAAGG TGG Intronic
900132192 1:1091886-1091908 CAGGGCCACGACAGGGAAGGTGG + Intronic
900351017 1:2234598-2234620 CAGGGCCTCCAGAGAGAAGGCGG + Intronic
900750663 1:4395062-4395084 CAAGGTGTCCCCAGGGGAGCGGG + Intergenic
900966010 1:5959133-5959155 CATGGTGTCCGGAGGGAGGGAGG - Intronic
901402088 1:9021584-9021606 CAGGGAGTCCACAGACAAGCAGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
902731961 1:18375599-18375621 GAGGCTGTGCACAAGGAAGGAGG + Intronic
903064293 1:20690145-20690167 GAGGCTGTCTCCAGGGAAGGTGG - Intronic
903732318 1:25505596-25505618 GAGGGTCTCCACAGGGGAGGTGG - Intergenic
904596857 1:31652231-31652253 CTGGCTGACCACAGGCAAGGAGG + Exonic
905772218 1:40645714-40645736 CAGGGGGTGAAAAGGGAAGGGGG + Intronic
905908037 1:41632836-41632858 CATGGTGTCCACATGGCTGGAGG + Intronic
906142105 1:43539973-43539995 CAGGGTGCCCACAGGGGATTGGG + Intronic
906776708 1:48536313-48536335 CAGGGTGCTCACAGGGGTGGAGG + Intronic
907454428 1:54566057-54566079 CTGGCTCTCCAGAGGGAAGGGGG - Intronic
909352501 1:74671400-74671422 AAGGGTTTCAAAAGGGAAGGGGG - Intronic
909776845 1:79493028-79493050 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
909784062 1:79587378-79587400 CAGAGTTTCCAAAGAGAAGGGGG - Intergenic
909788407 1:79643215-79643237 AAGGTTGTCCATAGTGAAGGAGG + Intergenic
911642448 1:100303556-100303578 CAGGTTGACCACAGTGGAGGAGG + Intergenic
912561247 1:110553158-110553180 CAGGGGCTCCTCAGTGAAGGTGG + Intergenic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
913218077 1:116637173-116637195 CAGGATGTCCACAGGCACAGGGG - Intronic
913530991 1:119734202-119734224 CAGGGAGTCCTGAGGGAGGGAGG - Intronic
915164425 1:153940774-153940796 CAGGCTGTGCCCAGGGAAAGGGG + Intronic
915510605 1:156384983-156385005 CAGCGTCTCCACAGGGAGAGGGG + Exonic
915953646 1:160205975-160205997 AAGCTTGTCCAGAGGGAAGGAGG + Intronic
916895740 1:169160039-169160061 CAGGGTGTGGCCATGGAAGGAGG - Intronic
918183333 1:182105446-182105468 CAGTAGGACCACAGGGAAGGAGG + Intergenic
921047090 1:211485270-211485292 TAGGGTCTCAACAGGGGAGGAGG + Intronic
922363705 1:224844977-224844999 AAGGTTGTCCATAGTGAAGGAGG + Intergenic
923107444 1:230865583-230865605 CTGGTTCTCCTCAGGGAAGGAGG - Intronic
923546595 1:234927858-234927880 CAAGGTTGCCACAGGGAGGGAGG - Intergenic
923790577 1:237107859-237107881 CAGGGGAACCCCAGGGAAGGAGG - Intronic
1062843295 10:687628-687650 CAAGGTGTTCACAGGGAATTCGG + Intronic
1063280180 10:4620151-4620173 CAAGGTTTCCACAGGACAGGAGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064698260 10:17989510-17989532 GAGGGAGCCCACAGCGAAGGTGG + Intronic
1064847529 10:19671981-19672003 TAGAGTGTCCACAGGCCAGGTGG + Intronic
1066397673 10:35041892-35041914 CAAGGTGTTAAAAGGGAAGGAGG - Intronic
1066651121 10:37656018-37656040 AAGGGTTTCAAAAGGGAAGGGGG + Intergenic
1067720068 10:48721544-48721566 CAGCTTGTCAACTGGGAAGGTGG - Intronic
1068879639 10:62035018-62035040 CTGTGTGTCCACAGACAAGGTGG + Intronic
1069047885 10:63762200-63762222 AAGGGTGGCCACAGGGAAGAGGG + Intergenic
1070159652 10:73858531-73858553 GAGGGTGGGCAGAGGGAAGGGGG - Intronic
1070306989 10:75245612-75245634 CAGGATCTCCTCAGGGCAGGGGG + Intergenic
1073054013 10:100687459-100687481 CTGGGTGAGGACAGGGAAGGAGG + Intergenic
1073084573 10:100879966-100879988 CAGGGTGGCTACATGGCAGGTGG - Intergenic
1073160909 10:101393775-101393797 CAGGGTGTGCACATGCCAGGAGG - Intronic
1073985358 10:109202292-109202314 CAGGGAGCCCACAAGCAAGGTGG + Intergenic
1074757218 10:116632974-116632996 CAGTGTGGGCACAGGGAACGTGG + Intronic
1074780909 10:116801475-116801497 GAGGGGGTTCACAGGGAAGTTGG + Intergenic
1075474898 10:122726115-122726137 CAGGGTGGCCTCAGGTAGGGAGG - Intergenic
1075679648 10:124323106-124323128 CAGGGGGTCCTCAGAGATGGTGG - Intergenic
1077725824 11:4674062-4674084 AGAGGTGGCCACAGGGAAGGGGG + Intergenic
1078870744 11:15342317-15342339 GAGGCTGGCCAAAGGGAAGGCGG - Intergenic
1081613651 11:44578196-44578218 CTGGGTGTCCAGAGGAAAAGGGG - Intronic
1082982740 11:59138071-59138093 CAGTGTGTGTACAGGGAAGGGGG + Intergenic
1083309471 11:61777037-61777059 CAGGGTCTCCACAGTAAAGCAGG + Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1083935039 11:65865631-65865653 CAGAGTTCCCACAGGGAGGGAGG + Intronic
1084444882 11:69197749-69197771 CTGGGTGGCCTCAGGGAAGATGG + Intergenic
1084568351 11:69944295-69944317 CAGGGTGCGGACAGGGCAGGAGG + Intergenic
1084652431 11:70496952-70496974 CCAGATGTCCACAGGCAAGGTGG - Intronic
1084719224 11:70893377-70893399 GGGGGTGACCACAGGGGAGGGGG + Intronic
1084727886 11:70953732-70953754 GAGGGTGTCGCCAGAGAAGGTGG - Intronic
1084960668 11:72714592-72714614 CTGGGTCTCCACACTGAAGGAGG + Intronic
1085172409 11:74460508-74460530 GAGAGTGTCCACAGTGATGGAGG + Intronic
1086569054 11:88262466-88262488 CAGAGTGTTGACAGGGAATGTGG - Intergenic
1086949531 11:92877353-92877375 CTGGTTGTGCAGAGGGAAGGTGG - Intronic
1087179692 11:95129389-95129411 CATGGTGTACACAGGGAAAGTGG - Exonic
1088810199 11:113387140-113387162 CGGGGTGGCCACGGGGGAGGTGG - Intergenic
1089253072 11:117179063-117179085 CAGGGTCCCCGCAGGGGAGGGGG - Exonic
1089612510 11:119677383-119677405 CAGGAGGGCGACAGGGAAGGAGG + Intronic
1090075820 11:123579453-123579475 CTGGCTGTGGACAGGGAAGGAGG + Intronic
1091156332 11:133377549-133377571 CTGGGAGTTCAAAGGGAAGGTGG - Intronic
1091323882 11:134669882-134669904 CTGTGTGTGCACAGGGAGGGGGG + Intergenic
1091583943 12:1805411-1805433 GAGGCTGTCCCCAGGTAAGGAGG - Intronic
1091897661 12:4118042-4118064 CAGGGTGTTCACAGGGTACCAGG - Intergenic
1092163263 12:6327707-6327729 CTGGGAGTCCTCAGGGGAGGAGG + Exonic
1094096085 12:26706484-26706506 CAGCTTGTACACAAGGAAGGAGG - Intronic
1094723587 12:33089866-33089888 AAGGTTGTCCATAGTGAAGGAGG + Intergenic
1095527663 12:43147103-43147125 CAGGGTGGTCTCAGGGTAGGTGG + Intergenic
1095578843 12:43771382-43771404 CAGGGTGTCCACAATTAGGGTGG + Intronic
1095941853 12:47732661-47732683 CAGGGTGTCAAAAGGGGAAGGGG - Intergenic
1096536537 12:52278745-52278767 CAAGGTGTGGACGGGGAAGGAGG - Intronic
1096661630 12:53128921-53128943 AAGGGTGTCCAAAGAGGAGGGGG - Intergenic
1101303443 12:103504274-103504296 CAGGTTGGCCACAGGTGAGGTGG - Intergenic
1102077679 12:110073144-110073166 CAGGGTGTGCCTGGGGAAGGTGG - Intronic
1102236812 12:111298774-111298796 CAGGGTGGGCCCAGGGTAGGGGG + Intronic
1102256649 12:111418984-111419006 CAGAGTGTCCAGAGGGAACTAGG + Intronic
1102498779 12:113337155-113337177 TAGGGTGTCATCAGGGCAGGGGG - Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102560060 12:113755536-113755558 CTGGCTGTCCACAGGGATAGGGG - Intergenic
1102573997 12:113844480-113844502 CAGGGAGTGCCCAAGGAAGGTGG + Intronic
1104935059 12:132360093-132360115 CAGGGTGTCCCCAGAGGAGAAGG + Intergenic
1105049367 12:133035032-133035054 CAGGGTGCACACTGTGAAGGGGG - Intergenic
1105543350 13:21333872-21333894 CAGGGTGTTAACAGGGATGGGGG - Intergenic
1106928354 13:34636462-34636484 TAGGGTGGCCGCTGGGAAGGAGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1108177832 13:47811849-47811871 CAGGATGAACACAGAGAAGGTGG + Intergenic
1109032741 13:57214072-57214094 CAGGATGTGGACAGGGAAAGGGG + Intergenic
1109278493 13:60328723-60328745 CATGGTGCCCTCAGGGAAGACGG + Intergenic
1110076415 13:71250018-71250040 CAGGGAAGCCACAGGGAAGGTGG - Intergenic
1110157141 13:72331169-72331191 TAAGGTGTCCATAGAGAAGGTGG + Intergenic
1111460643 13:88537030-88537052 CAGTTTTTCCACAGAGAAGGCGG + Intergenic
1112450259 13:99501552-99501574 TAGGGGGTCAAGAGGGAAGGAGG - Exonic
1112691698 13:101903616-101903638 CAGGGTGACTATAGGGAAGGAGG + Intronic
1113393295 13:109918546-109918568 CATGGTGTCCACAGGCAGCGGGG - Intergenic
1113531937 13:111033502-111033524 CAGTGTGTGTACAGGGCAGGGGG + Intergenic
1113574720 13:111387111-111387133 CAGGGTGTCCACAGTGATGGTGG + Intergenic
1113896326 13:113766542-113766564 CAGGGTGACCAGAGGGCAGGAGG + Intronic
1115718242 14:36129326-36129348 CAGGCTGCCCCCAGGGTAGGAGG - Intergenic
1115745353 14:36430998-36431020 CATGGTGTCCACAGGCAGTGTGG + Intergenic
1118937454 14:70300660-70300682 AAGGTTGTCCATAGTGAAGGAGG + Intergenic
1119480429 14:74954937-74954959 CAGGGAAGCCACAGGGAGGGAGG - Intronic
1119758314 14:77134020-77134042 CAGGCTTTCCACCGGGAGGGAGG + Intronic
1119976360 14:79028709-79028731 TAGGATGTTGACAGGGAAGGGGG + Intronic
1120251543 14:82065561-82065583 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
1120279809 14:82424787-82424809 CAGGATGCCCACAGGTAAGAAGG + Intergenic
1120487032 14:85126999-85127021 CAGGGTGCTAGCAGGGAAGGTGG - Intergenic
1120495353 14:85227640-85227662 CAGGGTGTCCACAGGACATGTGG + Intergenic
1120733456 14:88027891-88027913 CAGGGTGGCCCCAGGGAAGGAGG + Intergenic
1121509349 14:94500792-94500814 CTGGGGGTCCAGAGGCAAGGTGG - Intronic
1123810034 15:23915572-23915594 CTGGGTGTCAACAGGGAAGTTGG - Intergenic
1124140390 15:27072317-27072339 AAGGGTGTCCATGGAGAAGGAGG - Intronic
1125744435 15:41989067-41989089 CAGGGAGACCACAGGGTAAGGGG - Intronic
1127385054 15:58460399-58460421 CAGGGTGGGCACAGTTAAGGTGG + Intronic
1128069136 15:64783131-64783153 CAGGGGCTCCACATGGAATGAGG + Intergenic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128893246 15:71349843-71349865 CAGTGTGGGCCCAGGGAAGGGGG + Intronic
1129378989 15:75153841-75153863 CATGGGGCCCACAGGCAAGGGGG + Intergenic
1129844366 15:78761485-78761507 CAGGTGGTGCTCAGGGAAGGTGG - Intronic
1129848463 15:78778729-78778751 CTGGGTGGCCTCAGGGCAGGTGG + Intronic
1129913479 15:79247300-79247322 GAGTGTGTGCTCAGGGAAGGAGG - Intergenic
1130257434 15:82332294-82332316 CAGGTGGTGCTCAGGGAAGGCGG + Intergenic
1130332171 15:82930983-82931005 CGGGGTGTGCACAGGGCAGGAGG - Intronic
1130332428 15:82932835-82932857 TGGGGTGTGCACAGGGCAGGAGG - Intronic
1130597511 15:85257671-85257693 CAGGTGGTGCTCAGGGAAGGCGG - Intergenic
1131249051 15:90819041-90819063 CAGGGTCACCACTGGGAAGAAGG + Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132357756 15:101185435-101185457 GAGAGTGTTCACAGGGAAGGAGG - Intronic
1132357765 15:101185475-101185497 GAGGGCGTTCACAGGGAAGGAGG - Intronic
1132357776 15:101185515-101185537 GAGGGCGTTCACAGGGAAGGGGG - Intronic
1132616458 16:843330-843352 CCGTTTGTCCTCAGGGAAGGTGG - Intergenic
1132623540 16:879444-879466 CAGGCTGTCCCCAAGAAAGGGGG + Intronic
1132715119 16:1286283-1286305 AGGGGTGTCCACAAGGAAGACGG + Intergenic
1133099475 16:3470454-3470476 CAGGGCGTCAGCAGGAAAGGAGG + Intronic
1133137323 16:3720987-3721009 CAGCATGTCCTCAGGGAATGGGG + Intergenic
1133639829 16:7706008-7706030 CAGGATGTCCACAGGAATGATGG - Intronic
1133898754 16:9953497-9953519 CAGGGAGTCCACCAAGAAGGTGG + Intronic
1136183374 16:28570253-28570275 CAGTGTGTCCAGAAGGTAGGAGG + Intronic
1137671787 16:50283599-50283621 GAAGGTGTCCACATGGGAGGAGG - Intronic
1137716372 16:50600866-50600888 GAGAGTTTGCACAGGGAAGGTGG - Intronic
1138655780 16:58490475-58490497 CAGGGTGCCCAGAGGGCATGAGG - Intronic
1139265569 16:65635463-65635485 CAGGGGGAACACAGGGTAGGTGG - Intergenic
1139513622 16:67440956-67440978 TTGGCTGGCCACAGGGAAGGAGG - Intronic
1139698993 16:68695677-68695699 CAGAGTATCCAAAGGGTAGGGGG + Intronic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1140483197 16:75273786-75273808 CAGGGTGTAGACATGGAAGTGGG - Intergenic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141557197 16:84844022-84844044 CTGGGTGTGCAGAGGGCAGGAGG + Intronic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1143205383 17:5136962-5136984 CAGTGTGTCCACCGGGAGTGTGG + Intronic
1143407434 17:6686704-6686726 GAGGAGGTCCACAGGGAAGCTGG - Intronic
1143586261 17:7852123-7852145 CGGGGTGGCCACAGGTCAGGTGG - Intronic
1144447684 17:15346077-15346099 CAGAGTGGCCACAGAGCAGGTGG + Intergenic
1144738630 17:17568895-17568917 CAGGGTGGCCAGACGGTAGGTGG - Intronic
1144777941 17:17794156-17794178 CTGGGTGTCCACAGAGCTGGTGG - Exonic
1145225304 17:21123505-21123527 TTGGGTGTCCACAAGGCAGGTGG - Intronic
1145291377 17:21549277-21549299 CAGGGTTTACACAGGGGTGGGGG + Intronic
1145305649 17:21673621-21673643 GAGGCTGACCACAGGAAAGGTGG + Intergenic
1145388698 17:22437776-22437798 CAGGGTTTACACAGGGGTGGGGG - Intergenic
1146636609 17:34510878-34510900 CAGGGAGTTAACAGAGAAGGAGG + Intergenic
1146843240 17:36168830-36168852 CAGTGTGTCCACCGGGAGTGTGG - Intronic
1146855550 17:36256771-36256793 CAGTGTGTCCACCGGGAGTGTGG - Intronic
1146865071 17:36331604-36331626 CAGTGTGTCCACCGGGAGTGTGG + Intronic
1146866940 17:36345193-36345215 CGTGGTATCCACAGAGAAGGAGG + Intronic
1146871456 17:36380682-36380704 CAGTGTGTCCACCGGGAGTGTGG - Intronic
1146878815 17:36431764-36431786 CAGTGTGTCCACCGGGAGTGTGG - Intronic
1146882759 17:36452910-36452932 CAGTGTGTCCACCGGGAGTGTGG - Intergenic
1147067930 17:37932198-37932220 CAGTGTGTCCACCGGGAGTGTGG + Intronic
1147069810 17:37945802-37945824 CGTGGTATCCACAGAGAAGGAGG + Intergenic
1147074342 17:37981306-37981328 CAGTGTGTCCACCGGGAGTGTGG - Intronic
1147079461 17:38011753-38011775 CAGTGTGTCCACCGGGAGTGTGG + Intronic
1147081339 17:38025340-38025362 CGTGGTATCCACAGAGAAGGAGG + Intronic
1147085864 17:38060844-38060866 CAGTGTGTCCACCGGGAGTGTGG - Intronic
1147095402 17:38135695-38135717 CAGTGTGTCCACCGGGAGTGTGG + Intergenic
1147097283 17:38149297-38149319 CGTGGTATCCACAGAGAAGGAGG + Intergenic
1147101811 17:38184810-38184832 CAGTGTGTCCACCGGGAGTGTGG - Intergenic
1147544968 17:41394062-41394084 CAGGGTGTGCAGGGGGCAGGAGG + Exonic
1148694344 17:49550050-49550072 CAGGGACTCCAGAGTGAAGGGGG - Intergenic
1149846404 17:60011320-60011342 CAGCGTGTCCACCGGGAGTGTGG - Intergenic
1149889601 17:60375178-60375200 CGTGGTATCCACAGAGAAGGAGG - Intronic
1150084754 17:62267895-62267917 CAGCGTGTCCACCGGGAGTGTGG - Intergenic
1151325891 17:73379603-73379625 GAAGGTGTCCCCAGGGAGGGTGG + Intronic
1151338731 17:73456161-73456183 CAGGATGACCACAGGGAAGGAGG + Intronic
1152453745 17:80400768-80400790 AAGGTTGCCCACAGTGAAGGAGG - Intergenic
1152525282 17:80884839-80884861 CAGAGTGGCAACGGGGAAGGAGG - Intronic
1152528431 17:80902843-80902865 CAGGGTTTCGGGAGGGAAGGCGG - Intronic
1153387304 18:4511671-4511693 CGGGGTGTGCACAGGGTAGTCGG - Intergenic
1153712867 18:7817966-7817988 CAGATGGTACACAGGGAAGGTGG + Intronic
1153747764 18:8198020-8198042 CAGAGTGTCCACACAGAAGAAGG - Intronic
1153999129 18:10468638-10468660 CTGGGTCTCCACAGGGTAAGAGG + Exonic
1154308951 18:13253030-13253052 CAGGGTGCCCAGAGTGAAGCAGG - Intronic
1154493681 18:14940366-14940388 CAGAGTGGCCACAGGGATAGAGG + Intergenic
1155025198 18:21934718-21934740 CAGAGAGTCCACAGGGAGGCAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156352519 18:36313074-36313096 TATGGTGTCCTCAGGGTAGGTGG + Intronic
1157537536 18:48471016-48471038 CATGGTGTCAACAGAGTAGGTGG + Intergenic
1158397124 18:57088214-57088236 CAGGGAGACCACAGGGCTGGGGG + Intergenic
1158778287 18:60614477-60614499 CAGTTTTTCCACAGGGCAGGGGG - Intergenic
1160715541 19:574898-574920 CTGGGTTTCCACAGGGCTGGCGG - Intronic
1161077697 19:2294366-2294388 CAAGGTGTCCGCAGGGCCGGGGG - Intronic
1161717540 19:5885222-5885244 GATGGTGTGAACAGGGAAGGCGG + Intronic
1162621323 19:11846783-11846805 CAGGGTTTCCCCAGGGAATTTGG + Intergenic
1162911797 19:13851551-13851573 CTGGGTGTCCCCCGGGGAGGGGG + Intergenic
1162936469 19:13983996-13984018 CAGGGTCACCCCAGAGAAGGTGG - Intronic
1163437047 19:17302187-17302209 CAGGGTGTCCACAGGGAAGGTGG + Intronic
1163481732 19:17560506-17560528 CTGGGTATCCCCAGGGAAGGCGG + Intronic
1164573503 19:29391176-29391198 CAGGGTGTGCTCAGGGACTGTGG + Intergenic
1164637078 19:29799432-29799454 CAGAGGGGCCACAGGTAAGGAGG + Intergenic
1165101896 19:33443803-33443825 CAGTGTGTCCTCAGGCAGGGAGG + Intronic
1165101911 19:33443993-33444015 CAGTGTGTCCTCAGGCAGGGAGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1167106379 19:47432156-47432178 CAGGGTGTTACCAGGGATGGAGG + Exonic
1167437419 19:49487468-49487490 CAGAGATTCCCCAGGGAAGGCGG - Intergenic
1167591491 19:50406786-50406808 CAGGGAGTCCACAGGGCCAGAGG - Intronic
1168294092 19:55370324-55370346 CAGGGGTTCCCCAGGGCAGGGGG + Exonic
925247706 2:2399137-2399159 GCTGGTGTCCACAGGGCAGGGGG + Intergenic
925501548 2:4510667-4510689 AATGGTGTACACAGAGAAGGGGG - Intergenic
925537079 2:4929326-4929348 AAGGGTGTCGATAGAGAAGGAGG + Intergenic
925740697 2:7003776-7003798 CAGAGTGGCCACATGGCAGGTGG - Intronic
925841357 2:7995181-7995203 CAGGTAGATCACAGGGAAGGTGG - Intergenic
926108966 2:10170067-10170089 CAGGCTTTCCAGAGAGAAGGAGG + Intronic
926164050 2:10507195-10507217 CAGGGTTCCCACAGGGTCGGGGG - Intergenic
927295853 2:21452384-21452406 CAGGGTGAATACAGGGAAGTGGG - Intergenic
927336763 2:21933525-21933547 CAGGGTCACCACAGGTAAGTAGG + Intergenic
927519755 2:23691624-23691646 CACGGTGGCCGCAGGGCAGGAGG + Intronic
927574159 2:24187379-24187401 CAGGATGTCAACAGTGGAGGAGG - Intronic
928233055 2:29516425-29516447 AAGGGGGTCCACTGGGTAGGTGG + Intronic
928825520 2:35415971-35415993 CAGGGGGTGCACAGGGAACGAGG - Intergenic
931246739 2:60498440-60498462 CAGGGTGTGCCCTGAGAAGGTGG + Intronic
931785916 2:65619402-65619424 CAGGGCTTACACAGGGAAGGAGG - Intergenic
934534096 2:95118605-95118627 CAGGGATTCCAGAGGGAAGGGGG - Intronic
934673067 2:96228929-96228951 CAGGGTGTCCCATGGCAAGGGGG + Intergenic
934772047 2:96913405-96913427 CAGGGAGTCCACAGTGGAGAAGG + Intronic
934869996 2:97854917-97854939 TTAGGTGTGCACAGGGAAGGCGG - Intronic
935578392 2:104734557-104734579 CAGGGTATCCCCAGGGCAGGAGG - Intergenic
935597495 2:104890598-104890620 CAGGATAGCCACAGAGAAGGAGG - Intergenic
937362500 2:121238814-121238836 CAAGGAGTCCCCAGGGAAGCGGG - Intronic
938766630 2:134464243-134464265 CAGCATCTCCCCAGGGAAGGTGG - Intronic
939363627 2:141205426-141205448 CAGGCTCTCCACATGGAATGGGG + Intronic
939460881 2:142494334-142494356 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
940786729 2:157989425-157989447 CAGGGAGCCCACAGAGAGGGGGG - Intronic
941333522 2:164210465-164210487 CAAGGTGTCCACAGGGCTGGGGG - Intergenic
941998382 2:171622981-171623003 CAGGCTGTCCACATGCAGGGTGG + Intergenic
943761252 2:191611888-191611910 AAGTGTGTGCACAGGGATGGCGG + Intergenic
945358960 2:208872348-208872370 CAGGGAGTCCAGAGGAAATGGGG + Intergenic
946178145 2:217934444-217934466 CAGTGTCTCCACTGGGTAGGTGG - Intronic
947593193 2:231396313-231396335 CGGGGGGTGCACCGGGAAGGCGG - Intronic
947868778 2:233420472-233420494 TAGGATGCCCCCAGGGAAGGGGG - Intronic
948155308 2:235776723-235776745 CAAGGTGTGCAAGGGGAAGGGGG - Intronic
948426008 2:237886924-237886946 TCGAGTGTCCACAGGGGAGGCGG - Intronic
948463623 2:238141987-238142009 CAGCTTGTGCACAGGCAAGGAGG + Intronic
948465325 2:238149288-238149310 CAGAGGGCCCACAGTGAAGGGGG + Intronic
948550929 2:238772681-238772703 CAGGGTCCCCACAGGCACGGAGG + Intergenic
948807817 2:240460529-240460551 CAGGATGTCCCCAGGCCAGGAGG - Intronic
949069167 2:242013170-242013192 CAGAGGCTCCACAGAGAAGGGGG + Intergenic
1172108136 20:32528685-32528707 CAGGGAAACCACAGGGCAGGAGG + Intronic
1172845121 20:37925619-37925641 CAGTGTGTCCACAGGACAAGTGG - Intronic
1173851262 20:46219908-46219930 CAGGGGCTGTACAGGGAAGGTGG + Intronic
1174080773 20:47969363-47969385 CAGGGTGTCCACAAAGGAGGCGG + Intergenic
1174178526 20:48659825-48659847 CTGGTTATGCACAGGGAAGGGGG - Intronic
1174758381 20:53182214-53182236 GAGGGAGTCAAGAGGGAAGGAGG - Intronic
1175364174 20:58440098-58440120 CAGGATGTACACTGGGAAGAGGG - Intronic
1175422480 20:58843235-58843257 CAGGGTGTAAAGAGGGAAGCTGG - Intronic
1175482536 20:59321650-59321672 GAGGGTGGCCAAAGAGAAGGGGG - Intronic
1175643938 20:60655424-60655446 TATGGTGTCCTTAGGGAAGGTGG - Intergenic
1175817915 20:61893223-61893245 ATGGGTGACCACAGGGATGGTGG + Intronic
1175820638 20:61907125-61907147 CCTGGTGTCCTCAGGGGAGGTGG - Intronic
1176003761 20:62848068-62848090 CAGCGTGTCCGCAGGAAAGGAGG + Intronic
1176061765 20:63175673-63175695 TAGGGTGACCCAAGGGAAGGGGG + Intergenic
1178782988 21:35623870-35623892 CAGGATGACCACAGTGGAGGGGG - Intronic
1179187657 21:39097113-39097135 CAGGGCCTCCACGGGGAAGGTGG - Intergenic
1180712089 22:17846279-17846301 CAGTGTTTCCAAAGGGAAGGTGG + Intronic
1180819384 22:18815257-18815279 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181116320 22:20634475-20634497 CAGTCTGGCCTCAGGGAAGGGGG - Intergenic
1181205609 22:21249702-21249724 CAGGATGTCCACAGGCACAGGGG - Intergenic
1181388817 22:22564388-22564410 CTGGGTGTACAGAGGGCAGGAGG + Exonic
1183162387 22:36123519-36123541 CAGGCTTTCAACATGGAAGGTGG + Intergenic
1183343029 22:37292527-37292549 CTGGGTTTCCGGAGGGAAGGGGG + Intronic
1183588416 22:38766413-38766435 CAGGCTGGGCCCAGGGAAGGGGG + Intronic
1183859302 22:40657873-40657895 CGTGGTGCCCACAGGGAAAGTGG + Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184290994 22:43498168-43498190 CAGGGTGGTCAGAGGGAATGCGG - Intronic
1184859467 22:47165045-47165067 CAGCCTCTCCACAGGGCAGGGGG + Intronic
1185041906 22:48508424-48508446 CAGGGTGTGCCCAGGTGAGGGGG + Intronic
1203221314 22_KI270731v1_random:45711-45733 CAGGATGTCCACAGGCACAGGGG + Intergenic
1203269512 22_KI270734v1_random:41110-41132 CAGGATGTCCACAGGCACAGGGG - Intergenic
949879775 3:8652186-8652208 CAAGGACTCAACAGGGAAGGTGG - Intronic
950420960 3:12899273-12899295 CACGCTGTCCACTGGGAACGCGG + Exonic
950424868 3:12919713-12919735 CAGGGTTCCCACAGGGACTGAGG + Intronic
950447328 3:13045797-13045819 CAGGGTGGCCCCAGGGAAGGAGG - Intronic
951894718 3:27599953-27599975 AAGGTTGCCCACAGTGAAGGAGG - Intergenic
953386662 3:42510185-42510207 CAGCGTGTGCACAGGCATGGAGG - Intronic
953790051 3:45940524-45940546 CAGGCTGTCCGCAGGCATGGTGG - Intronic
954422783 3:50427338-50427360 CTGGGGGTCCCCAGGGATGGGGG - Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955105769 3:55896200-55896222 AAGGGTTTCCACAGGGAAGTTGG + Intronic
955366697 3:58316522-58316544 TAGGATGTCCAAAGGTAAGGCGG - Exonic
959193761 3:103150329-103150351 CAGATTGTCCACATGGGAGGTGG - Intergenic
959891964 3:111567039-111567061 CAGGATGTCCACAGTGGGGGAGG + Intronic
960672711 3:120168066-120168088 CAGCTTCTCCCCAGGGAAGGAGG - Exonic
962376545 3:134863101-134863123 CAGTGTGTGCACAGGCATGGGGG - Intronic
963364159 3:144313344-144313366 CTGGGTGTCTACAGGAAAGAAGG - Intergenic
964983490 3:162713617-162713639 AAGGGTGCCCATAGTGAAGGAGG - Intergenic
965286878 3:166828558-166828580 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
966250804 3:177863393-177863415 CAGAGCCTACACAGGGAAGGAGG - Intergenic
966770599 3:183500346-183500368 CAGGGTGTGGCCAGGGAGGGAGG + Intronic
967657855 3:192072855-192072877 CAGGGTGTGGACAGGAAAGAAGG + Intergenic
968943090 4:3649321-3649343 CAGGATGAACACAGGGAAGGAGG - Intergenic
968969832 4:3788019-3788041 GTGGGTGGCCACAGGGAATGGGG + Intergenic
969056442 4:4405661-4405683 CAGAGTCTGCACAGGGCAGGGGG + Intronic
969591788 4:8126362-8126384 CAGGGGGTACACAGGGGAGGGGG - Intronic
970300294 4:14674016-14674038 CACAGTGTCCACAGTGCAGGAGG - Intergenic
970547055 4:17140441-17140463 AAGGGTTTCAAAAGGGAAGGGGG - Intergenic
970811589 4:20100458-20100480 CAGAGTCTCCACAAGGAAGCTGG + Intergenic
972337825 4:38123620-38123642 CAGGGTGGCCGCAGGAAAGTGGG - Intronic
972945451 4:44248850-44248872 CAGGTTCTCCAGAGGGGAGGAGG - Intronic
973707316 4:53593221-53593243 CAGGGTGTCCCCTGGGCAAGGGG + Intronic
974741441 4:66013277-66013299 CAGGGTTTCAAAAGGGGAGGGGG - Intergenic
975609121 4:76186430-76186452 TAGGGTGACCACAGAGAAGAGGG + Intronic
975761043 4:77620163-77620185 CATGGTGTCCACAAGGACAGAGG + Intergenic
977860342 4:101950714-101950736 CAGGTTTTCCACTGTGAAGGTGG - Intronic
979439453 4:120734105-120734127 CAGAGTGTCCAGGAGGAAGGGGG + Intronic
980758640 4:137199000-137199022 CAGGCTGTCCACAGGCACAGTGG + Intergenic
981482869 4:145256019-145256041 AAGGTTGCCCACAGTGAAGGAGG + Intergenic
983942043 4:173544364-173544386 CAAGGTAACCTCAGGGAAGGGGG - Intergenic
984173767 4:176391093-176391115 CATAGTGTACACAGGCAAGGAGG - Intergenic
985680480 5:1253328-1253350 CAGGGTCTCCACCTGGATGGTGG + Exonic
985880969 5:2638907-2638929 TTGGGTGCCCACTGGGAAGGTGG - Intergenic
986331701 5:6721113-6721135 CTGAGTCTCCTCAGGGAAGGAGG + Intronic
986469141 5:8057111-8057133 GAGGCTTTCCCCAGGGAAGGAGG + Intergenic
986602734 5:9489461-9489483 CAGGGCACCCACAGGGATGGCGG + Intronic
987034167 5:14003800-14003822 CAGGGTGGCCTCAGGGCAGTGGG - Intergenic
990191478 5:53264838-53264860 CAGGGGGTGCACATGAAAGGAGG - Intergenic
990399443 5:55423390-55423412 TAGGGCCTCCACAGGGAAGGTGG + Intronic
990977633 5:61573296-61573318 CAGGCTGGCCTCAGGGAAGGGGG - Intergenic
991093103 5:62711782-62711804 CAGAGTGTCCACAGGGAAGTGGG + Intergenic
991624278 5:68583081-68583103 GAGGGTGTCTAAAGAGAAGGGGG + Intergenic
991973590 5:72164284-72164306 CAGGGTTTTCACAAGGTAGGAGG + Intronic
993257323 5:85607990-85608012 AAGGGGGTCAACAGGGCAGGAGG + Intergenic
993288499 5:86033976-86033998 CAGGGTTTCCACAGGAAAGCAGG - Intergenic
993972198 5:94433118-94433140 CAGGATGTCAACCCGGAAGGTGG - Intronic
994026034 5:95085051-95085073 GAGGGTGTCAACAGAGTAGGAGG - Intronic
994165921 5:96608100-96608122 AAGGGTGTGGACAGGGAAAGGGG - Intronic
994768585 5:103953858-103953880 CCGGGAGCCCACGGGGAAGGGGG + Intergenic
995829147 5:116334455-116334477 CAGTGGGCCCACAGGGATGGGGG - Intronic
996491520 5:124103561-124103583 CAAGGTGTCCACATAGAATGAGG + Intergenic
997696133 5:135862541-135862563 CAGGGTGTCCACAGTCTAGTGGG + Intronic
997881879 5:137599006-137599028 CAGTATGTCCACATGGCAGGAGG + Intergenic
997957003 5:138286553-138286575 CTGGGTGTCCAAAGGGACGATGG + Exonic
999257539 5:150217930-150217952 CAGAGTGTCAAAAGGGGAGGAGG + Intronic
1001239183 5:170055393-170055415 CTCGTTGTCCACAGGGAAGAAGG + Intronic
1001293889 5:170485422-170485444 CAGGGTGTGGACGGGGAGGGTGG + Intronic
1001724775 5:173887896-173887918 AAGGGTGCCCACAGTAAAGGTGG - Intergenic
1001811154 5:174629282-174629304 CAGGTGGTCCACAGGGAACAAGG + Intergenic
1001855982 5:175011270-175011292 CAGAGTGTGCACAGGGATGTTGG + Intergenic
1001923276 5:175617318-175617340 GAGGGTCTCCACTGAGAAGGAGG + Intergenic
1004198743 6:13529012-13529034 CAGGCTGTCACCATGGAAGGGGG + Intergenic
1004469341 6:15915510-15915532 CAGGGAGGCCACACTGAAGGCGG + Intergenic
1005894765 6:30168564-30168586 GAGGGACTCCACGGGGAAGGGGG + Intronic
1006014638 6:31070618-31070640 CAGTCTGTCCACTGGGGAGGGGG - Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007235946 6:40391738-40391760 CGGGGTGTGCTCAGGGAATGTGG - Exonic
1007702951 6:43775019-43775041 CAGGGTGTCCCCAGAGAAATGGG - Intronic
1007776398 6:44226678-44226700 CAGGGGCTCCCCAGGGAGGGTGG + Intronic
1007925519 6:45646676-45646698 CAGAGTGTCCCCAGAGGAGGAGG - Intronic
1010958106 6:82114519-82114541 CACGGTGTCTTCAGGAAAGGAGG - Intergenic
1012553080 6:100482016-100482038 CAGGGACTCCAGAGGGAAGCGGG + Intergenic
1013808287 6:114017169-114017191 AAGGCTGCCCACAGTGAAGGAGG + Intergenic
1014060585 6:117066949-117066971 CATGGTGCCCACACGTAAGGAGG - Intergenic
1017849936 6:158296457-158296479 AAGGGTTTCAAAAGGGAAGGGGG + Intronic
1017965323 6:159259370-159259392 CATTGTGTCAACAGGGAAGGTGG + Intronic
1018431580 6:163726620-163726642 CAGGGTCTCCACAGGGACCCTGG - Intergenic
1018788852 6:167130974-167130996 GAGGGGGTCCAGAGGGAGGGTGG - Intronic
1019131842 6:169882692-169882714 CAAGGTGTCCACAGGCATGGAGG - Intergenic
1019480499 7:1264582-1264604 CAGGGTGCACACAGGGTGGGTGG - Intergenic
1019556041 7:1631945-1631967 CAGAGTGTGCACAGGTCAGGTGG - Intergenic
1019556140 7:1632529-1632551 TAGGGTGTGCACAGGGTAGGTGG - Intergenic
1019726933 7:2608005-2608027 CAGGGTGGAGTCAGGGAAGGAGG + Intronic
1020261314 7:6532056-6532078 GAGGGAGGCCACAGGAAAGGAGG + Intronic
1021905577 7:25329925-25329947 CATGGTGACCTCAGAGAAGGTGG + Intergenic
1023159303 7:37282196-37282218 CAGGAGGTCCACAGGGAGGAAGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024260924 7:47573333-47573355 CAGGGTGTCCCCAGGGTGGGAGG - Intronic
1025606127 7:63041273-63041295 CCGGGAGTCCAACGGGAAGGGGG - Intergenic
1027157723 7:75780354-75780376 AAGGTTGTCCATAGTGAAGGAGG - Intronic
1029696576 7:102217580-102217602 CATGGTGTCTAGAGGGAGGGAGG + Intronic
1029700900 7:102246297-102246319 CAAGGTAGCCCCAGGGAAGGGGG + Intronic
1031554233 7:123151877-123151899 CAGGGTGACAACAGTGGAGGTGG - Intronic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032525406 7:132575958-132575980 CAGGGTGTCCAAAGGCCACGGGG + Intronic
1032688513 7:134259340-134259362 CTGGGTGTCAATAGGAAAGGTGG + Intronic
1033239161 7:139663015-139663037 CATGGTGGCCAGTGGGAAGGTGG - Intronic
1034139402 7:148802171-148802193 CAGTGTGTCCCCAGGAGAGGAGG + Intergenic
1034554235 7:151839830-151839852 CACGGTGTCCCTGGGGAAGGCGG - Intronic
1034978152 7:155459642-155459664 GAGGATGCACACAGGGAAGGAGG + Intronic
1035183282 7:157106428-157106450 CAGGGTATCAACATGGCAGGTGG - Intergenic
1035238697 7:157516491-157516513 CAGGGTGCTGACAGGGAGGGTGG + Intergenic
1035286494 7:157810422-157810444 CAGGCTCTCCACGGGGACGGCGG + Intronic
1035286516 7:157810492-157810514 CAGGGTCTCCATGGGGACGGCGG + Intronic
1035286617 7:157810806-157810828 CAGGCTTTCCACGGGGACGGCGG + Intronic
1035629183 8:1095324-1095346 CAGGGTCTGCAGAGGGCAGGTGG - Intergenic
1036165714 8:6430965-6430987 AGGTGTGTCCACAGGGCAGGAGG + Intronic
1037776242 8:21837810-21837832 TAGGGTGGGCAGAGGGAAGGAGG - Intergenic
1038347711 8:26747553-26747575 CAGGGCTTGCCCAGGGAAGGTGG + Intergenic
1038400329 8:27279649-27279671 CAGGGTGTAGACAGGGGAGAGGG + Intergenic
1038463693 8:27740290-27740312 GAGAAAGTCCACAGGGAAGGAGG + Intronic
1039311578 8:36322414-36322436 CAGGGCGGCCACGGAGAAGGCGG - Intergenic
1039450680 8:37672542-37672564 CAGGGTGTCCATAGAGAGAGGGG + Intergenic
1040104922 8:43536128-43536150 CAGGGTGTTCCCAGGCAAGGTGG + Intergenic
1040358759 8:46644946-46644968 CAGGCTGTACCCAGGTAAGGTGG + Intergenic
1040944946 8:52874378-52874400 AAGGGTGGCCTCAGAGAAGGAGG - Intergenic
1048019405 8:130524680-130524702 TACGGTAACCACAGGGAAGGAGG + Intergenic
1049251887 8:141593585-141593607 CAGTGTCTGCACAGGCAAGGTGG + Intergenic
1049377028 8:142294149-142294171 CAGAGTGGCCAGAGGGAAGGTGG + Intronic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1049703237 8:144024373-144024395 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049703244 8:144024389-144024411 AAGGGGGTCCTGAGGGAAGGGGG - Intronic
1049757379 8:144316739-144316761 CATGGTGACCACAGGGCTGGGGG + Intronic
1049782745 8:144436263-144436285 CAGGGTCTCCCCAGGGCAGGCGG - Exonic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053364694 9:37514361-37514383 TGGGGTCTCCAAAGGGAAGGAGG + Intronic
1056899393 9:90584012-90584034 CAGGGTATCCACAGGGTCGCTGG - Intergenic
1057514919 9:95712868-95712890 CATGGTATCCATAGGGATGGTGG - Intergenic
1057547891 9:96031738-96031760 CAGTGGGTCCCCAGGGATGGTGG - Intergenic
1057565329 9:96161558-96161580 AAGGGCATTCACAGGGAAGGCGG - Intergenic
1060967761 9:127721189-127721211 CCAGGTGTCCCCAGGGCAGGGGG + Intronic
1061189867 9:129076154-129076176 CAGGGAGTTCACAGACAAGGTGG - Intergenic
1061436408 9:130565540-130565562 CAGGTTGGCCACAGGAAAGAAGG + Intergenic
1061746056 9:132741064-132741086 CAGGGTGCCCCCAGGAAATGGGG - Intronic
1061953444 9:133949268-133949290 CAGGGCGTCCTCGGGGAAGGAGG - Intronic
1062053200 9:134457760-134457782 CAGGATGACCCCAGGGCAGGAGG - Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1062504335 9:136865694-136865716 CAGGGTGGGCACTGGGAACGGGG - Intronic
1185506193 X:633548-633570 CAGGGTGTCTACAGGGAACGGGG - Intronic
1187216492 X:17282157-17282179 CACTGTGTGCACAGGCAAGGTGG - Intergenic
1189177584 X:38973399-38973421 CAGGGAGGGGACAGGGAAGGAGG - Intergenic
1189695766 X:43660276-43660298 AAGGGTGGCCACTGGGAAGGGGG - Intronic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1192509314 X:71712589-71712611 CAGGATGCCCACAGAGAGGGTGG - Intergenic
1192517383 X:71768964-71768986 CAGGATGCCCACAGAGAGGGTGG + Intergenic
1197783364 X:130177894-130177916 TATGGTGCCCACAGGAAAGGAGG + Intronic
1200057830 X:153470770-153470792 CAGGGCGGACACAGGGAAGGGGG + Intronic
1200057840 X:153470793-153470815 CGGGGCGGACACAGGGAAGGGGG + Intronic
1200223629 X:154404629-154404651 CAGAGTGTCCATAGAGCAGGAGG - Intronic