ID: 1163437752

View in Genome Browser
Species Human (GRCh38)
Location 19:17305481-17305503
Sequence CATCTGCCCAGCTCCCGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163437746_1163437752 6 Left 1163437746 19:17305452-17305474 CCAGGACAAGCTGCCAGCCAGCT 0: 1
1: 1
2: 2
3: 34
4: 258
Right 1163437752 19:17305481-17305503 CATCTGCCCAGCTCCCGCTGGGG 0: 1
1: 0
2: 2
3: 52
4: 531
1163437747_1163437752 -7 Left 1163437747 19:17305465-17305487 CCAGCCAGCTGTGTGCCATCTGC 0: 1
1: 0
2: 8
3: 45
4: 315
Right 1163437752 19:17305481-17305503 CATCTGCCCAGCTCCCGCTGGGG 0: 1
1: 0
2: 2
3: 52
4: 531

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163437752 Original CRISPR CATCTGCCCAGCTCCCGCTG GGG Intronic
900233890 1:1577432-1577454 CATCTGCCCAGCCACGGCTGTGG + Intergenic
900647393 1:3715157-3715179 CACCTGCCCTGGTCCTGCTGGGG - Intronic
900673832 1:3871796-3871818 CATCTGCTCAGCTGCCGGGGAGG + Intronic
901023177 1:6265332-6265354 CATCTGCCCACTTCTCGCTGGGG - Intronic
901529041 1:9842294-9842316 CAGCTGCCCAGGCCCTGCTGTGG - Intergenic
902564805 1:17304443-17304465 CACCAGCCCAGCTCACGCAGAGG - Intergenic
902745007 1:18467955-18467977 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
902792755 1:18780254-18780276 CATCTGCTCGGCTCCTGCGGAGG + Intergenic
902932673 1:19742499-19742521 CAGCTGCCCCCCTCCCTCTGGGG + Intronic
903606707 1:24580182-24580204 CAGCTGCCCAGTACCCGCCGTGG - Intronic
903944119 1:26951175-26951197 CCTCTCCCCAGCTCCCACTCTGG - Intronic
904282566 1:29431366-29431388 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
904352584 1:29918611-29918633 CATTTGCTGAGCTCCCACTGTGG + Intergenic
904887553 1:33752456-33752478 CATCTGCTCAGCTCCTGGTGAGG - Intronic
905875736 1:41431143-41431165 CAGCAGACCAGCTCCAGCTGGGG - Intergenic
906017253 1:42592853-42592875 CATCTGCTCAGCTTCTGGTGAGG - Intronic
906179191 1:43803861-43803883 TCTCTGCCCAGCTCCAGGTGGGG - Intronic
906531849 1:46528255-46528277 CATCTGGCCATCTCCTGCTTTGG + Intergenic
906747983 1:48234905-48234927 CAGGTGCCCATCTCCCTCTGGGG - Intronic
906829103 1:49013041-49013063 CATCTGCTCAGCTTCTGGTGAGG - Intronic
907048620 1:51315110-51315132 CACCTGCCCAGCCCCACCTGTGG + Intronic
908396268 1:63728412-63728434 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
909690599 1:78403201-78403223 CATCTGCTCAGCTTCTGGTGGGG + Intronic
910116193 1:83734694-83734716 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
910975092 1:92898193-92898215 CATCTGCTCAGCTTCTGATGAGG + Intronic
910990395 1:93049800-93049822 CATCTTCACAGCTCCCCCGGGGG - Intergenic
911126837 1:94348314-94348336 CATCTGCCCAGCCTCTGGTGAGG - Intergenic
911571937 1:99528090-99528112 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
912532133 1:110332916-110332938 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
912761028 1:112367716-112367738 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
912762924 1:112385145-112385167 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
912776541 1:112509288-112509310 AAGCTGCGCAGCTCCCGCTTCGG + Exonic
913693744 1:121304484-121304506 CATCTGCTCAGCTCTTGGTGGGG + Intronic
914143815 1:144975594-144975616 CATCTGCTCAGCTCTTGGTGGGG - Intronic
914409206 1:147408646-147408668 CATCTGCTCAGCTCCTGATGAGG - Intergenic
914800106 1:150954963-150954985 CATCTGACCTGCTCCTGCAGTGG - Intronic
914982870 1:152430724-152430746 CCTCTGCCCAGAGCCCACTGTGG - Intergenic
915120446 1:153627143-153627165 ACTCTGCCCTGCTGCCGCTGAGG - Intronic
915571603 1:156747945-156747967 CAGCTGCCCAGCCCCAGCAGTGG + Intronic
915884945 1:159712613-159712635 CATCTCCCCAGCTCCCTATCTGG - Exonic
916167015 1:161973457-161973479 CACCTGCATAGCTCCTGCTGGGG - Intergenic
917826697 1:178829356-178829378 CTGCTGCCCACCTCCTGCTGTGG - Intronic
917969118 1:180196076-180196098 CATCTGTTGAGCTCCCACTGTGG + Intronic
919767630 1:201137305-201137327 CTCCTTCCCAGCCCCCGCTGTGG - Intronic
920481069 1:206322851-206322873 CATCTGCTCAGCTCTTGGTGGGG + Intronic
920895493 1:210044796-210044818 CATCTGCTCGGCTTCTGCTGAGG + Intronic
922214712 1:223510817-223510839 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
922862965 1:228835140-228835162 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
923994990 1:239484196-239484218 CATCTGCTCAGCTTCTGGTGAGG + Intronic
924044224 1:240011319-240011341 CATCTGACCAGCTCACACTGTGG + Intergenic
924294411 1:242570816-242570838 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1062800435 10:375357-375379 CATCTACTCAGCTCCTGGTGAGG - Intronic
1063161442 10:3421681-3421703 CCTATGCCCAGCTCCCGGAGAGG + Intergenic
1063781510 10:9330481-9330503 TATCTGCTCAGCTCCTGGTGAGG - Intergenic
1064010215 10:11729751-11729773 CGTCTGCCCAGCCACAGCTGTGG + Intergenic
1064836164 10:19533562-19533584 CATCTGCTCAGCTTCTGATGAGG + Intronic
1065084721 10:22163369-22163391 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1066201711 10:33148017-33148039 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1066277130 10:33880318-33880340 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1066684103 10:37964104-37964126 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1066962384 10:42234630-42234652 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1067095018 10:43294532-43294554 CATCCACCCAGCTCCTCCTGTGG + Intergenic
1067128534 10:43540930-43540952 CATCTGCTCAGCTTCTGCTGAGG - Intergenic
1067137786 10:43626509-43626531 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1067667002 10:48287568-48287590 CCTCTGCACAGCCCCAGCTGTGG - Intergenic
1068338710 10:55673013-55673035 AATCTGCTCAGCTTCTGCTGAGG + Intergenic
1068590483 10:58847938-58847960 CATCTGCTCAGCTTCCGGTGAGG - Intergenic
1069121702 10:64576517-64576539 CAGCTGCCCAGCTGTGGCTGTGG + Intergenic
1069130771 10:64699381-64699403 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1069613708 10:69792679-69792701 CATCTGCCCTGTTCCCTCGGGGG + Intergenic
1070476180 10:76831269-76831291 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1070785762 10:79161317-79161339 CAGCTGCCCAGATGCTGCTGTGG + Intronic
1072464589 10:95651540-95651562 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1072683261 10:97521729-97521751 CTGCTGCCCAGCTGCTGCTGGGG - Intronic
1072693230 10:97584929-97584951 CATCTCCCCAGGTCCCACAGAGG - Intronic
1073080365 10:100856030-100856052 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1073924458 10:108499057-108499079 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1075025801 10:118982238-118982260 CGTCTCCCCAACTCCCACTGCGG + Intergenic
1075096870 10:119477736-119477758 AACCTGCCCAGCTCCCTCTCTGG - Intergenic
1075184652 10:120244857-120244879 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1075312947 10:121430051-121430073 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1075360724 10:121830449-121830471 CATCTGCCCAGCTTCTGGTGAGG - Intronic
1075417695 10:122277542-122277564 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1075456225 10:122586768-122586790 CATCTGCTCGGCTTCTGCTGAGG + Intronic
1075586806 10:123664551-123664573 CATCTGCTCAGCTTCTGATGAGG - Intergenic
1076509918 10:131005969-131005991 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1077281003 11:1745415-1745437 CTTCCGACCAGCTCCAGCTGTGG - Intronic
1078753470 11:14187045-14187067 CATCTGCTCGGCTTCCGGTGAGG + Intronic
1079410699 11:20184738-20184760 CATCTGCTCAGCTTCCGGGGAGG - Intergenic
1081533775 11:43982911-43982933 CCTCTGCCCAGGTCACTCTGAGG + Intergenic
1081613906 11:44579333-44579355 CAGCTTCCCAGCTCCTGCTCTGG - Intronic
1083334817 11:61916522-61916544 CTACTGCCCAGCTACAGCTGGGG - Intronic
1084118482 11:67055541-67055563 CCTCTGCCCGGCTCCCGCTCCGG - Intergenic
1084500062 11:69530140-69530162 CATCTCCCCAGCTGACCCTGTGG - Intergenic
1084798379 11:71524685-71524707 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1084963591 11:72731514-72731536 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1086314363 11:85574774-85574796 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1088376494 11:109147070-109147092 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1088678092 11:112215819-112215841 CATCTGCTCAGCTTCTGATGAGG + Intronic
1089584834 11:119503647-119503669 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1090039496 11:123277831-123277853 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1093536914 12:20233018-20233040 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1093690634 12:22104535-22104557 CATCAGCACAGCTTCTGCTGTGG - Intronic
1094068139 12:26383216-26383238 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1095099167 12:38163198-38163220 CAGGTGCCCAGCTCCAGCCGGGG - Intergenic
1095177923 12:39114432-39114454 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1095242777 12:39880134-39880156 CATCTGCCCAGCTTCTGGGGAGG - Intronic
1095728903 12:45483539-45483561 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1096304723 12:50464246-50464268 CATCTGCCCAGCTTCTGGGGAGG + Intronic
1097597578 12:61653380-61653402 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1098198360 12:68026652-68026674 CATCTGCTCAGCTTCCGGGGAGG - Intergenic
1098939396 12:76517709-76517731 CATCTGCTCAGCTTCTGATGAGG + Intronic
1100429618 12:94519028-94519050 CATCTGCTCAGCTTCCAGTGAGG + Intergenic
1101353372 12:103954376-103954398 CATCAGTCCAGCTTCCGGTGAGG + Intronic
1101612025 12:106301789-106301811 CTGCTGCTCAGCTCCTGCTGTGG - Intronic
1101754521 12:107610439-107610461 CCTCTGCCCAGCGCCTGCAGAGG - Intronic
1101844786 12:108354342-108354364 CATCTGCCCAGCTTCTGGTAAGG + Intergenic
1102530917 12:113546132-113546154 CAACTACCCAGGTCCCTCTGTGG + Intergenic
1103887487 12:124213805-124213827 CATCTGCCCAGCTTAGGCTAAGG + Intronic
1103975105 12:124697278-124697300 CATCTCCCCAGCATCCCCTGGGG - Intergenic
1104035123 12:125092552-125092574 CATCAGCCCAGCTGGTGCTGCGG - Intronic
1104363185 12:128153176-128153198 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1104549348 12:129742287-129742309 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1104644561 12:130487513-130487535 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1104974614 12:132546728-132546750 CAGCTGCCCAGCTTCCCCAGGGG + Intronic
1104975969 12:132552123-132552145 CCTCTGCCCAGGCCCCACTGTGG - Intronic
1105801473 13:23906756-23906778 CATCTGCCCAGCTTCTGGTGAGG + Intergenic
1106484823 13:30162869-30162891 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1107354840 13:39556081-39556103 CATCTGCTCAGCTTCTGGTGTGG - Intronic
1107355107 13:39557995-39558017 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1107432723 13:40354581-40354603 CATCTGCTCAGCTTCTGATGAGG + Intergenic
1107972412 13:45656067-45656089 CATCTGCTCGGCTTCTGCTGAGG + Intergenic
1109304069 13:60619569-60619591 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1109348370 13:61145092-61145114 CAGCTGCCCAGCTGTGGCTGTGG + Intergenic
1110297721 13:73887547-73887569 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1110786236 13:79530404-79530426 GCTGTGCCCAGCTCCAGCTGTGG + Intronic
1111583895 13:90260420-90260442 CATCTGCTCAGCTCCTGGGGAGG + Intergenic
1111736975 13:92154058-92154080 CATCTGCTTAGCTCCTGGTGAGG + Intronic
1111814515 13:93133779-93133801 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1112860136 13:103820051-103820073 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1112929415 13:104715458-104715480 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1113596998 13:111540360-111540382 CACCTGCCCAGCTGCCTTTGCGG + Intergenic
1114081978 14:19209126-19209148 CATCTGCCTAGCTTCTGGTGAGG - Intergenic
1114240935 14:20867285-20867307 AATCTGGCCAGCTCAGGCTGTGG + Intergenic
1114590650 14:23861651-23861673 CATCTGCTCAGCTCCTGGTGAGG + Intergenic
1114687005 14:24542744-24542766 CATCTGCTCAGCTTCCGGGGAGG - Intergenic
1117088886 14:52229494-52229516 CATCTGTCCAGCTCCAGCTGAGG + Intergenic
1118268375 14:64317369-64317391 CATCTGCTCAGCTTCCAGTGAGG + Intronic
1118652953 14:67917293-67917315 CATCTGCTCAACTTCCGCGGAGG + Intronic
1119060376 14:71468380-71468402 CATCTGCCCAGCTTCTGGGGAGG + Intronic
1119378634 14:74214652-74214674 CCTCTGCCCAGCTCTCGCCTTGG - Intergenic
1119531711 14:75366205-75366227 CTTCTGTCCAGCTCCCACTCTGG - Intergenic
1120072694 14:80121680-80121702 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1120237488 14:81909394-81909416 CATCTGCCCAGCTTCTACGGAGG + Intergenic
1120466423 14:84863529-84863551 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1121025004 14:90609106-90609128 CATCATCCCAGCTCCTGCCGAGG - Intronic
1121890726 14:97588078-97588100 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1121982861 14:98469723-98469745 CATCTGCACAGCTCACTCGGTGG - Intergenic
1122831473 14:104399284-104399306 CATCTGCTCGGCTTCCGGTGAGG - Intergenic
1122859621 14:104576714-104576736 CCTGAGCCCAGCTCCCTCTGGGG - Intronic
1122859674 14:104576959-104576981 CCTGAGCCCAGCTCCCTCTGTGG - Intronic
1122859691 14:104577057-104577079 CCTGAGCCCAGCTCCCTCTGTGG - Intronic
1122957537 14:105077835-105077857 CATCTTCCCAGCTGCAGCTGTGG + Intergenic
1123216579 14:106813754-106813776 CCTCTGTCCTGCTCCAGCTGAGG - Intergenic
1202929990 14_KI270725v1_random:27766-27788 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1123411934 15:20067839-20067861 CCTCAGCCCAGCTCCTGCTCGGG - Intergenic
1123521278 15:21074958-21074980 CCTCAGCCCAGCTCCTGCTCGGG - Intergenic
1123578363 15:21695040-21695062 CCTCAGCCCAGCTCCTGCTCGGG - Intergenic
1123614988 15:22137522-22137544 CCTCAGCCCAGCTCCTGCTCGGG - Intergenic
1123736694 15:23191301-23191323 TATCTGCTCAGCTTCTGCTGAGG - Intergenic
1123965751 15:25455625-25455647 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1124203653 15:27699167-27699189 CATCTGCTCAGCTTCCGGGGTGG - Intergenic
1124205887 15:27719800-27719822 CATCTGCTCAGCTCCTGGTGAGG + Intergenic
1124287395 15:28414276-28414298 TATCTGCTCAGCTTCTGCTGAGG - Intergenic
1124287918 15:28419978-28420000 TATCTGCTCAGCTTCTGCTGAGG - Intergenic
1124295308 15:28497349-28497371 TATCTGCTCAGCTTCTGCTGAGG + Intergenic
1124472503 15:30000760-30000782 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1124877927 15:33613088-33613110 CACCTCCCCACCTCCCGCAGAGG + Intronic
1125407929 15:39372314-39372336 CATCTGCTCAGCTCCTGGGGAGG + Intergenic
1125549850 15:40537186-40537208 CATCTGCCCAGCGCCTGAGGTGG - Intronic
1125628215 15:41126542-41126564 CTTCTGCCTAGCTCCTGCTGTGG - Intergenic
1126073416 15:44885824-44885846 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1126084849 15:45001801-45001823 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1126186132 15:45831993-45832015 CATCTGCTCAGCTTCCGGGGAGG + Intergenic
1128154642 15:65384990-65385012 CGTCTGCCCAGTTCCAGCAGGGG + Exonic
1128797546 15:70476745-70476767 CATGCACCCAGCTCCCACTGAGG + Intergenic
1130255978 15:82326281-82326303 CACCTGCCCACCACCTGCTGAGG - Intergenic
1130580154 15:85130056-85130078 CATCTGCTCAGCTTCCGGTGAGG + Intronic
1130598976 15:85263705-85263727 CACCTGCCCACCACCTGCTGAGG + Intergenic
1130747189 15:86667945-86667967 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1131206307 15:90451322-90451344 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1202987233 15_KI270727v1_random:429285-429307 CCTCAGCCCAGCTCCTGCTCGGG - Intergenic
1132524205 16:406269-406291 CATCTGCCCAGCTCCTGAGCAGG - Intronic
1133927874 16:10207955-10207977 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1134025681 16:10951254-10951276 CATCTGCAGAGCTCCTGCTGGGG + Intronic
1135850682 16:25960245-25960267 CATCTGCTCAGCTTCCGGTAAGG - Intronic
1136075631 16:27815386-27815408 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1136354092 16:29732464-29732486 CATCTGCTCAGCTTCCGGGGAGG + Intergenic
1136718574 16:32302862-32302884 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1136773392 16:32859288-32859310 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1136836945 16:33509126-33509148 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1136897222 16:34002231-34002253 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1137236748 16:46623898-46623920 CCTCTGCCCAGGTCACCCTGTGG - Intergenic
1137746983 16:50829532-50829554 CATCTGCTCAGCTTCTGCGGAGG - Intergenic
1138114546 16:54350076-54350098 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1138137193 16:54533282-54533304 CAGCTGAGCAGCTCCCACTGTGG - Intergenic
1138179697 16:54933071-54933093 CTTCTGCTCAGCTCCTCCTGCGG - Exonic
1138999677 16:62494411-62494433 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1139026306 16:62822615-62822637 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1139224281 16:65218922-65218944 CTTCTACCCAGCTCCAGCTTGGG - Intergenic
1139315527 16:66064884-66064906 CATCTGCCCATCTCCCTCTGAGG + Intergenic
1139675299 16:68519407-68519429 TTTCTGCCCAGCTCAGGCTGTGG + Intergenic
1140906557 16:79414297-79414319 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1141196949 16:81867209-81867231 CATCCTCCCAGCTTCTGCTGTGG - Intronic
1141571061 16:84933925-84933947 GATCTGGCCACCTCCCGCTGAGG - Intergenic
1141663328 16:85453305-85453327 AATCTGCCCAGCCTCCGCGGAGG - Intergenic
1141814946 16:86403524-86403546 CATCTGCTCAGCTTCTGCTGAGG + Intergenic
1203007857 16_KI270728v1_random:214909-214931 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1203075808 16_KI270728v1_random:1121398-1121420 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1203123927 16_KI270728v1_random:1560055-1560077 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1203147123 16_KI270728v1_random:1809405-1809427 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1143035547 17:3994017-3994039 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1143275412 17:5706200-5706222 CCTCTGCCCAGCTCCCCATATGG - Intergenic
1143851768 17:9818188-9818210 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1144664021 17:17090028-17090050 CGTCTCCCCACCTCCCCCTGGGG - Intronic
1146422423 17:32700382-32700404 CCTCTGCTCATCTCCTGCTGTGG + Intronic
1146630040 17:34463214-34463236 ATTCTGCCCAGCACCAGCTGGGG - Intergenic
1146966788 17:37037997-37038019 CATCTGTCCAGCTTCTGATGAGG - Intronic
1147318680 17:39633181-39633203 CAGGTTCCCAGCTCCCTCTGCGG - Intronic
1148782713 17:50130488-50130510 CCCCAGCCCAGCTCCCGCCGCGG - Intergenic
1148870964 17:50658614-50658636 CATCTGCCCTGTGCCCACTGCGG - Intronic
1149566463 17:57643996-57644018 CATTTTCCCAGCTGCAGCTGAGG + Intronic
1150281015 17:63929672-63929694 CATCTCCCCAGCTCTCGTTGTGG - Intronic
1150968073 17:69994761-69994783 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1152064866 17:78105329-78105351 CTTCCGCTCAGCTCCCGCCGCGG - Exonic
1152260653 17:79265095-79265117 CCTCTGCCCAGCTCACCCTGTGG - Intronic
1152441234 17:80311517-80311539 CCTGTGCCCAGCCCCCTCTGCGG + Intronic
1155694177 18:28664921-28664943 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1155928817 18:31685115-31685137 CCTGTGCTCAGCTCCCGCGGCGG - Intronic
1156678266 18:39557586-39557608 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1157271260 18:46278069-46278091 CCTCTGACCAGCTGCAGCTGTGG + Intergenic
1157890591 18:51412711-51412733 CATCTGCTCGGCTTCTGCTGAGG - Intergenic
1158936439 18:62369228-62369250 CATCTGCCCAGTTGGGGCTGGGG - Exonic
1159616304 18:70583940-70583962 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1159732573 18:72048694-72048716 CATCTGCTCAGCTACTGGTGAGG + Intergenic
1160062341 18:75543986-75544008 CATTTGCCCAGCTTCTGTTGGGG - Intergenic
1160734040 19:653690-653712 CATCTGCCCAGCCCCTGGTGAGG - Intronic
1160933014 19:1579469-1579491 CTTCTGCCCACCTCCCTCTCCGG + Intronic
1161396892 19:4049453-4049475 CCTTTGCCGAGCGCCCGCTGAGG + Intronic
1161774531 19:6252182-6252204 CATCTGCCTCTCTCCCTCTGTGG + Intronic
1162398359 19:10430804-10430826 CAGCTCCCCAGCGCCCGCCGAGG + Intronic
1162733850 19:12734777-12734799 CATTCGCCCCGCCCCCGCTGCGG - Intergenic
1163121339 19:15220046-15220068 CATCTGCCCGGCCCCAGCTCTGG + Intergenic
1163437752 19:17305481-17305503 CATCTGCCCAGCTCCCGCTGGGG + Intronic
1163963182 19:20717213-20717235 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1164429306 19:28172902-28172924 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1164530346 19:29043752-29043774 CTTCTGCCCAGCTCCTGGTGAGG + Intergenic
1164591601 19:29510660-29510682 CCTCTGTCCAGCCCCAGCTGTGG - Intergenic
1167113198 19:47473869-47473891 CATCTGTCTACCTCCCGCTATGG - Intergenic
925024880 2:599809-599831 CTTCTACCCAGGTCCTGCTGTGG + Intergenic
925516431 2:4688824-4688846 CATCTTCCTAGCTTCTGCTGAGG + Intergenic
926802550 2:16671908-16671930 CATCTGCCCAGCTTCTGGGGAGG + Intergenic
927033624 2:19149701-19149723 CATCTGCTCAGCTCCTGGGGAGG + Intergenic
928149253 2:28811138-28811160 CCTCAGCCCAGAGCCCGCTGCGG - Intronic
929511684 2:42569347-42569369 CAACTCCCCACCTCCGGCTGAGG - Intronic
929547928 2:42868089-42868111 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
929570017 2:43016811-43016833 CATCTGCTCAGCTTCTGCCGAGG - Intergenic
929725476 2:44422231-44422253 CATCTGCTCAGCTTCCGGTGAGG - Intronic
929847254 2:45542392-45542414 CAGCTGCCCAGCTACAGCTCTGG - Intronic
930026375 2:47031682-47031704 TACCTGCCCAGTTCCAGCTGAGG + Intronic
930360149 2:50367599-50367621 GATCTGCCCAGCTCAGGATGAGG - Intronic
931427262 2:62182613-62182635 CATCTGGCCAGCTGCCGGTAAGG - Intergenic
931689416 2:64822552-64822574 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
931704488 2:64936032-64936054 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
932070110 2:68611699-68611721 CATCTGCTCAGCTTCTGGTGAGG + Intronic
932325634 2:70859138-70859160 CATCTGCCTAGCTTCTGGTGAGG - Intergenic
932565389 2:72903324-72903346 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
932618099 2:73248733-73248755 CATCTGGACAGCACCAGCTGTGG + Intronic
933874850 2:86609280-86609302 CATCTGCTCAGCTTCTGGTGAGG - Intronic
933974330 2:87496314-87496336 CAGCTGCTCACCTCCTGCTGAGG + Intergenic
934102225 2:88664068-88664090 CATCTACTCAGCTTCTGCTGAGG - Intergenic
934238458 2:90249964-90249986 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
934322570 2:91982489-91982511 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
934460881 2:94213306-94213328 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
935553625 2:104483612-104483634 CATCTGCTCAGCTTCTGGTGGGG - Intergenic
935815714 2:106844072-106844094 CATCTGCTCAGATGCTGCTGGGG + Intronic
936319494 2:111454505-111454527 CAGCTGCTCACCTCCTGCTGAGG - Intergenic
936449985 2:112626727-112626749 CATCTTCCCAGCACCTGCTTAGG + Intergenic
936460977 2:112713634-112713656 AACCTGCTCAGCTCCCACTGAGG - Intergenic
937290726 2:120780282-120780304 CACTTGCCGAGCTCCAGCTGGGG + Intronic
938295209 2:130173729-130173751 CTGCTGCCCAGCTCCCTCTGAGG + Intronic
938461414 2:131500109-131500131 CTGCTGCCCAGCTCCTTCTGAGG - Intergenic
938494606 2:131787472-131787494 CATCTGCCTAGCTTCTGGTGAGG + Intergenic
940720933 2:157280947-157280969 CATCTGCTCAGCTCTTGGTGAGG - Intronic
941192631 2:162404667-162404689 CATCTGCTCGGCTCCTGCAGAGG - Intronic
942592096 2:177557122-177557144 CATCTGCTCAGCTTCCAGTGGGG - Intergenic
942817281 2:180066800-180066822 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
942853068 2:180513380-180513402 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
943038919 2:182780448-182780470 CATCTGCTCAGCTTCTGGTGAGG - Exonic
943769097 2:191695566-191695588 CATCTGCTCAGCTTCTGATGAGG + Intronic
944508183 2:200437076-200437098 CATCTGCTCAGCTTCTGGTGAGG - Intronic
945109005 2:206344852-206344874 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
946196579 2:218035793-218035815 CATCTGCTCAGCTCCAGCCTTGG + Intronic
946358511 2:219204647-219204669 CATCTGCTCAGCTTCTGGTGAGG - Intronic
946809285 2:223506136-223506158 CATCTGCTCAGCTTCCAGTGAGG - Intergenic
946936546 2:224727182-224727204 CATCTGCTCAGCTCCTGGGGAGG - Intergenic
947183190 2:227431109-227431131 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
948456257 2:238105975-238105997 CAGCTCCCCAGCTGCCCCTGGGG + Intronic
1169313769 20:4571083-4571105 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1170572329 20:17639484-17639506 CATCTCCCCAGCTCCCGAGGGGG + Intronic
1171354529 20:24533971-24533993 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1171756214 20:29112461-29112483 CATCTGCTCAGCTTCTGCGGAGG + Intergenic
1172017755 20:31888715-31888737 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1172116001 20:32574033-32574055 CATCTTCCCAGCTACCCCTTGGG + Intronic
1172775310 20:37403592-37403614 ACTCTGTCCAGCTCCCGCTGTGG + Exonic
1172911394 20:38411838-38411860 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1175182204 20:57156555-57156577 GTTCTGCGCAGCTCCTGCTGGGG + Intergenic
1175832829 20:61976467-61976489 CAGCACCCCAGCTCCAGCTGTGG - Intronic
1175895592 20:62334347-62334369 CACCTGACCAGCCCCTGCTGTGG - Intronic
1175951313 20:62584831-62584853 CAACTGTCCAGGTCCAGCTGAGG - Intergenic
1176061463 20:63174646-63174668 CAGCTTCCCAGTTCCAGCTGGGG - Intergenic
1176592007 21:8656348-8656370 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1176613323 21:9006799-9006821 CATCTGCCTAGCTTCTGGTGAGG - Intergenic
1176711850 21:10156994-10157016 CATCTGCCTAGCTTCTGGTGAGG + Intergenic
1177379278 21:20317375-20317397 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1177660018 21:24070701-24070723 CTGCTGACCACCTCCCGCTGTGG - Intergenic
1178205077 21:30455702-30455724 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1178205214 21:30456659-30456681 CATCTGACCAGCTTCTGGTGAGG + Intergenic
1178392046 21:32206648-32206670 CTTCTGCCCATCTCCCGTTACGG - Intergenic
1178786306 21:35656808-35656830 CATCTGTTCAGCTTCCGGTGAGG - Intronic
1180274856 22:10633477-10633499 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1180498795 22:15913544-15913566 CATCTGCCTAGCTTCTGGTGAGG + Intergenic
1180549322 22:16528393-16528415 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1181000262 22:19984829-19984851 CATCTGCCCAGCATCCACTCTGG + Intronic
1181114536 22:20622924-20622946 CTGCTGCCCAGCTCCCTCTGAGG + Intergenic
1181855713 22:25780182-25780204 CAGCTGCTCAGCTCCAGGTGAGG + Exonic
1182271177 22:29154522-29154544 CGCCCGCCCAGCTCCCGCTGCGG + Intronic
1182456711 22:30456426-30456448 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1182489868 22:30664391-30664413 CATCTGCCCAACTAGAGCTGTGG - Intronic
1182803171 22:33048669-33048691 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1183040769 22:35176205-35176227 CATCTGCTCACCTTCTGCTGAGG + Intergenic
1183650983 22:39153027-39153049 CATTTGCTCACCTCCCGCAGCGG + Intergenic
1184431950 22:44446259-44446281 CATATGCCCAGCACCCACTAAGG + Intergenic
1184739250 22:46417627-46417649 CCTCTGCCCAACTCTGGCTGAGG + Intronic
1185179360 22:49350256-49350278 CCCCTGCCCAGCTCCCACAGGGG - Intergenic
1185270099 22:49925816-49925838 CCTCTGCTCATCGCCCGCTGAGG - Intronic
950661773 3:14471330-14471352 CATCTCCCCAGCTCTCCCTCAGG + Intronic
951838883 3:27012101-27012123 CTTCTGCCCAGCTCTCCCTCAGG - Intergenic
953560378 3:43985482-43985504 CATCTGCTCAGCTTCTGATGAGG - Intergenic
953972058 3:47355601-47355623 CACCTGTCCAGCTCACTCTGGGG - Intergenic
955141987 3:56278688-56278710 CATCTGCTCAGCTTCTGATGAGG + Intronic
956449180 3:69356327-69356349 CATCTGATCAGCTGCCGCTGTGG + Intronic
957447296 3:80330202-80330224 CACCTGCTCAGCTTCTGCTGAGG - Intergenic
958042837 3:88246676-88246698 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
958498501 3:94875280-94875302 CAGCTGCCCAGCTGGGGCTGTGG - Intergenic
958659083 3:97042356-97042378 CATCTGCTCAGCTTCTGATGAGG - Intronic
958863720 3:99475008-99475030 CATCTGCTCAGCTTCTGCTGAGG - Intergenic
959121740 3:102241114-102241136 CATATACCCAGCTCCTTCTGAGG - Intronic
959124886 3:102278915-102278937 CATCTGCTCAGCTTCCGGGGAGG + Intronic
959188715 3:103082042-103082064 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
959699190 3:109282353-109282375 CATCTGCTCAGCTTCTGGTGTGG + Intergenic
961326552 3:126112615-126112637 ACTCAGCACAGCTCCCGCTGTGG + Intronic
961749868 3:129088596-129088618 CCTCTGCCCAGGTCACCCTGTGG - Exonic
962763935 3:138543542-138543564 CATCTGCCCAGCCACAGCTTGGG - Intronic
963803130 3:149697198-149697220 CATCTGCTCAGCTTCTGGTGAGG + Intronic
966440161 3:179935958-179935980 CATCTGCTCAGCTTCTGGTGGGG - Intronic
967239331 3:187421931-187421953 CATCTGCTCAGCTTCTGCAGTGG + Intergenic
967734223 3:192935264-192935286 CATCTGCTCAGCTTCTGATGAGG - Intergenic
968506260 4:972735-972757 CAGCTGCCCAGCTCTTGCTGGGG - Intronic
968522916 4:1042298-1042320 CTTCTGCCCAGTCCCTGCTGGGG - Intergenic
969198574 4:5582952-5582974 CATCTGCCCAGCTTCTGGGGAGG - Intronic
969978792 4:11132813-11132835 CCTCTCCCCAGCTTCTGCTGGGG + Intergenic
970075001 4:12208403-12208425 CATCTTCTCAGCTTCTGCTGAGG + Intergenic
970768253 4:19577561-19577583 AATCTGCCCACCTCCAGCTGTGG + Intergenic
973091135 4:46137648-46137670 CATCTGCTCAGCTTCTGATGAGG - Intergenic
973614505 4:52665230-52665252 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
973647674 4:52966383-52966405 CATCTGCTCATCTGCTGCTGTGG + Intronic
973708584 4:53603558-53603580 CATCTGCTCAGCTTCTGATGAGG + Intronic
973716063 4:53677416-53677438 CATCTGCTCAGCTCCTGGGGAGG - Intronic
974179055 4:58360900-58360922 CAGCTGCCCAGCTGTGGCTGTGG - Intergenic
975159577 4:71110166-71110188 CATCTTCCCAGCATCCTCTGTGG + Intergenic
975684375 4:76905038-76905060 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
975870764 4:78776332-78776354 CAGCTGCCCGGCTCCCGCAGAGG - Intronic
975975229 4:80087945-80087967 CATCTACCTAGCTCCTGGTGAGG + Intronic
976847865 4:89510787-89510809 CATCTGCTCAGCTGCTGGTGAGG - Intergenic
979348075 4:119612497-119612519 CATCTGCCCAGCTTCTGGGGAGG - Intronic
979778982 4:124625470-124625492 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
981041622 4:140228057-140228079 CATCTGCTCAGCTTCTGATGAGG - Intergenic
981062493 4:140440010-140440032 CATCTGCTCAGCTCCTGATGAGG - Intergenic
981131242 4:141160812-141160834 CATCTGCTCAGCTCCTGGGGAGG - Intronic
981300790 4:143184630-143184652 CATCTGCGCAGCGTCCGCCGGGG + Intergenic
982188917 4:152833985-152834007 CATCTGCTCAGCTTCTGGTGGGG + Intronic
982598173 4:157412479-157412501 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
982694266 4:158581866-158581888 CATCTGCTCAGCTTCTGATGAGG + Intronic
983141011 4:164149180-164149202 CATCTGCTCAGCTTCTGATGAGG - Intronic
983549535 4:169001759-169001781 CATCTGCTCAGCTTCTGGTGAGG - Intronic
984256915 4:177400483-177400505 CATCTGCTCAGCTCCCAGTGAGG + Intergenic
984915282 4:184718141-184718163 CCTCTGCCCAGCTGCTGCAGTGG - Intronic
985159203 4:187026674-187026696 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
985235704 4:187871555-187871577 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
985590377 5:761459-761481 CATTGGCCCAGCTTCTGCTGTGG - Intronic
985624816 5:979819-979841 CCTCTGCCCACCTCCCTGTGCGG - Intronic
986421850 5:7593104-7593126 CAGCTGCCCAGCGCCCTCTGGGG + Intronic
987007448 5:13724851-13724873 CATCTGCTCAGCTTCTGGTGAGG - Intronic
987144416 5:14978486-14978508 TATCTGCTCAGCTCCTGGTGAGG + Intergenic
988924653 5:35977624-35977646 CATCTGCTCAGCTTCTGGTGAGG - Intronic
988940301 5:36139074-36139096 CAGCTGCCCAGCTGTGGCTGTGG + Intronic
991742609 5:69697253-69697275 CAGCTGCTCAGCTCCAACTGTGG + Intergenic
991755085 5:69857951-69857973 CAGCTGCTCAGCTCCAACTGTGG - Intergenic
991794182 5:70276991-70277013 CAGCTGCTCAGCTCCAACTGTGG + Intergenic
991821999 5:70572566-70572588 CAGCTGCTCAGCTCCAACTGTGG + Intergenic
991834412 5:70733099-70733121 CAGCTGCTCAGCTCCAACTGTGG - Intergenic
991886560 5:71276533-71276555 CAGCTGCTCAGCTCCAACTGTGG + Intergenic
992104158 5:73436671-73436693 CAGCTGCCGGGCTCCGGCTGTGG - Intergenic
992453418 5:76893749-76893771 CATATGCCCATCTGCCCCTGGGG - Intronic
993986760 5:94606820-94606842 CATCTGCTCAGCTTCTGGTGAGG + Intronic
994570525 5:101507709-101507731 CATCTGCTCAGCTTCCAGTGAGG - Intergenic
994926349 5:106121591-106121613 CATTTGCCCAGCTTCTGGTGAGG + Intergenic
995145917 5:108787078-108787100 CAGCTGCCCAGCTGCAGCTTGGG + Intronic
995250295 5:109985443-109985465 CATCTGCTCAGCTCCTGGTGAGG + Intergenic
997032508 5:130147663-130147685 CATCTGCTCAGCTTCTGATGAGG + Intronic
997905413 5:137811652-137811674 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
999310253 5:150547262-150547284 CATCTTCCCAGGTCCTCCTGGGG - Intronic
999320912 5:150614482-150614504 CATAAGCCCTGCTCCCTCTGAGG - Intronic
999818263 5:155199251-155199273 CATCTGCCCATCTTCTGGTGCGG - Intergenic
999853611 5:155569567-155569589 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1000525819 5:162356283-162356305 CATCTGCCCAACTTCTGGTGAGG + Intergenic
1001156866 5:169280119-169280141 AAGCTGCCCAGCTTCCGCTGGGG + Intronic
1001724403 5:173884954-173884976 CTACTGCCCAGCCCCCTCTGGGG - Intergenic
1001927797 5:175651527-175651549 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1002658640 5:180774131-180774153 CATCTGCTCACCTTCCGGTGAGG + Intergenic
1003050909 6:2780552-2780574 CATCTGAGCAGGCCCCGCTGAGG - Intronic
1003500161 6:6696558-6696580 CAGCTCCCCAGCTCCCACTCTGG - Intergenic
1004271537 6:14200458-14200480 CATCTGCCCAGCTTCTGGGGAGG - Intergenic
1005553015 6:26943270-26943292 CAGCTGCTCAGCTCCAACTGTGG + Intergenic
1005573404 6:27168986-27169008 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1005680205 6:28199282-28199304 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1005724400 6:28634834-28634856 GATCTGCCCGGCTAACGCTGGGG + Intergenic
1006576544 6:35050690-35050712 CATCTGCACAGCTCAGGCTGAGG + Intronic
1007225304 6:40309557-40309579 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1007421740 6:41723825-41723847 CATCTGCCTAGGGCCCTCTGAGG - Intronic
1008189758 6:48439816-48439838 CACCTGCTCAGCTCCTGATGAGG - Intergenic
1008932519 6:56955085-56955107 CATCAGCCGAGCCCCCGCCGCGG - Intergenic
1009684178 6:66935733-66935755 CAGCTGCCCAGCTGCAGCTCCGG + Intergenic
1010508600 6:76689764-76689786 CATCTGCTCAGCTTCTGCTGAGG - Intergenic
1010764669 6:79765332-79765354 CAGCTGCCCAGCACCAGCAGAGG - Intergenic
1011135819 6:84099694-84099716 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1011738988 6:90340525-90340547 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1011846367 6:91567929-91567951 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1011898534 6:92262362-92262384 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1012760691 6:103296932-103296954 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1012975856 6:105780378-105780400 CATCTACCAAGCTCACGCTTAGG + Intergenic
1013112245 6:107073397-107073419 CACCTGCCCCACTCCCTCTGGGG + Intronic
1013126049 6:107185587-107185609 CATACGCTCAGCTCCAGCTGGGG + Intronic
1014136588 6:117896567-117896589 CATCCGCTCAGCTTCTGCTGAGG - Intergenic
1014509776 6:122306967-122306989 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1014520609 6:122438197-122438219 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1014520853 6:122440096-122440118 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1014893686 6:126873224-126873246 CATCTGCCCAGCTCCTAGGGAGG - Intergenic
1015104785 6:129523203-129523225 CATCTGCTCGGCTTCTGCTGAGG + Intergenic
1015748393 6:136535323-136535345 CATCTGCTCGGCTTCTGCTGAGG - Intronic
1015772500 6:136783605-136783627 CATTTGCCCCGCTCCACCTGGGG - Intronic
1016068109 6:139704812-139704834 CATCTGCTTAGCTTCCGGTGAGG - Intergenic
1016126289 6:140408331-140408353 CAGCCACCCAGCTCCAGCTGTGG + Intergenic
1016319240 6:142824386-142824408 CATCTGACCAGTTCACGTTGTGG - Intronic
1017809808 6:157976761-157976783 AATCTGCACAGCTCACTCTGTGG - Intergenic
1017925292 6:158906604-158906626 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1018245176 6:161815721-161815743 AGTCTGCTGAGCTCCCGCTGGGG - Intronic
1018969679 6:168517740-168517762 AGTCTGCCCAGCCCCAGCTGAGG - Intronic
1019192484 6:170260903-170260925 TATCTGCACAGCTGCCTCTGGGG - Intergenic
1019385095 7:750654-750676 CATCTGCTCACCTCCTGCTGTGG + Intronic
1019506366 7:1393473-1393495 GAACTGCCAACCTCCCGCTGTGG - Intergenic
1019734823 7:2645424-2645446 CATTTCCTCAGCACCCGCTGCGG - Intronic
1019999084 7:4744726-4744748 CACCTGCCCTGCTCTTGCTGCGG + Intronic
1020089710 7:5332447-5332469 CAGGTGCCCAGCTCCTGCTGTGG + Intronic
1021102795 7:16602925-16602947 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1021343225 7:19489553-19489575 CAGCTGCCCAGCCACAGCTGTGG - Intergenic
1022039895 7:26571045-26571067 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1022416399 7:30181410-30181432 CATCTGCTCAGCTGCTGGTGAGG + Intergenic
1022441448 7:30436549-30436571 CACCTACCCAGCCCCCGCTTAGG - Intronic
1022862085 7:34377652-34377674 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1023032686 7:36104524-36104546 CACCTGCCCATCTGCTGCTGAGG - Intergenic
1023773718 7:43583430-43583452 CACCTGCCCAGCTCCCGGCCCGG - Exonic
1023896140 7:44434454-44434476 CTGCTGCCCAGCTCTCACTGAGG + Intronic
1025041674 7:55651296-55651318 CATCTCCCCAGCACCAGCAGGGG - Intergenic
1026591851 7:71703294-71703316 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1026633617 7:72060835-72060857 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1027881530 7:83844876-83844898 CATCTGCACAGATGCAGCTGTGG - Intergenic
1027924738 7:84446940-84446962 CAGCTGCCCAGCCACAGCTGGGG + Intronic
1028136658 7:87230174-87230196 CAGCTGCCCAGCTGCAGCTGTGG + Intergenic
1028479042 7:91284568-91284590 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1028859539 7:95633235-95633257 CATCTGCCCAGGTTCTGCTGAGG + Intergenic
1029291534 7:99505324-99505346 CATCTTCCCAGCCTCGGCTGCGG + Intronic
1029696172 7:102214711-102214733 GACCTGCCCCGCTCCCGGTGAGG + Intronic
1029973966 7:104815331-104815353 CATATGCCCTTCTCCTGCTGGGG - Intronic
1030243700 7:107359114-107359136 CAGCTGCCCAGCCACAGCTGTGG + Intronic
1030756237 7:113291226-113291248 CAGCTGCCCAGCCACGGCTGTGG + Intergenic
1033018264 7:137694471-137694493 CATCTTGCCAGCTCCCTCTCTGG + Intronic
1033808427 7:144980863-144980885 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1034141043 7:148816724-148816746 CATAGCTCCAGCTCCCGCTGAGG - Exonic
1035031771 7:155865558-155865580 CATCTGTCCAGCTCCCTGGGCGG + Intergenic
1035046459 7:155970818-155970840 CATCAGCCCAGCTCTGGATGAGG - Intergenic
1035788071 8:2278239-2278261 CCTGTGCCCATGTCCCGCTGGGG - Intergenic
1035804736 8:2443474-2443496 CCTGTGCCCATGTCCCGCTGGGG + Intergenic
1035854910 8:2964360-2964382 CATTTCCCCAGCCCTCGCTGTGG - Intronic
1035984556 8:4412445-4412467 CATCTGCCCGGCTTCTGTTGAGG - Intronic
1036243888 8:7100733-7100755 AATCTGCCCCCCTCCAGCTGGGG - Intergenic
1036998590 8:13689542-13689564 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1037961020 8:23098443-23098465 CATCTGCTCAGCTTCTGGTGAGG + Intronic
1037970657 8:23169416-23169438 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1038175105 8:25175192-25175214 CGTTTGCCCAGCTCTTGCTGTGG + Intergenic
1038536062 8:28353397-28353419 CATCTGGCCAGCTTCCCGTGCGG - Exonic
1039015228 8:33140802-33140824 CATCTGGCCAGCTTCTGGTGAGG + Intergenic
1039135795 8:34321470-34321492 CATCTGCTCAGCTCCTGAGGAGG - Intergenic
1039948407 8:42149587-42149609 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1040626697 8:49157958-49157980 CATCTGCTCAGCTTCTGGTGCGG + Intergenic
1040856998 8:51958681-51958703 TATTTGCCCAGCTCCTTCTGAGG - Intergenic
1040984785 8:53281520-53281542 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1041315963 8:56562815-56562837 CATCTGCTCAGCTCCTGGGGAGG - Intergenic
1041499474 8:58524454-58524476 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1041598813 8:59690621-59690643 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1045527187 8:102951031-102951053 CTTCCTCCCAGCTCCCACTGTGG - Intronic
1046527875 8:115404466-115404488 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1047139829 8:122125507-122125529 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1048696022 8:137029040-137029062 CATCTCCCCAGCTTCTGTTGAGG + Intergenic
1048838703 8:138546189-138546211 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1049053160 8:140215063-140215085 CACTTGCACAGCTCCCGCTCCGG + Intronic
1049216345 8:141410061-141410083 GCTCTGCCCAGCCCCTGCTGCGG + Intronic
1050912010 9:11083097-11083119 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1052698211 9:31906075-31906097 CATCTGCTCAGCTTCTGATGAGG - Intergenic
1053177308 9:35937069-35937091 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1053648848 9:40142682-40142704 CATCTGCCTAGCTCCTGGTGAGG + Intergenic
1053691377 9:40589004-40589026 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1053756896 9:41321171-41321193 CATCTGCCTAGCTCCTGGTGAGG - Intergenic
1054273425 9:63048481-63048503 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1054302637 9:63389975-63389997 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054329827 9:63740623-63740645 CATCTGCCTAGCTCCTGGTGAGG + Intergenic
1054401409 9:64716475-64716497 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054435017 9:65200795-65200817 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1054495373 9:65820886-65820908 CATCAGCCCTGCTCTCTCTGTGG - Intergenic
1054535735 9:66233488-66233510 CATCTGCCTAGCTCCTGGTGAGG - Intergenic
1054701106 9:68414175-68414197 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1055377057 9:75659820-75659842 CATCTGCTCAGCTTCTGATGAGG - Intergenic
1055435581 9:76288874-76288896 GATGTGCACAGCTCCCACTGTGG + Intronic
1056694217 9:88832746-88832768 CATCTGCCCAGCTTCTGGGGAGG + Intergenic
1057047791 9:91899293-91899315 CAACTGCCCAGCCTCAGCTGTGG - Intronic
1057680472 9:97177052-97177074 CATCTGCCCAGTTAACTCTGAGG + Intergenic
1058532113 9:105916404-105916426 CATCTGCTCAGCTCCTGGTGGGG + Intergenic
1058786938 9:108397657-108397679 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1060793950 9:126502550-126502572 CAGCTGCCCTGGCCCCGCTGTGG + Intronic
1060824222 9:126678447-126678469 CAAATGCCCAGCTTCAGCTGGGG - Intronic
1061714560 9:132510542-132510564 CATCAGCCCACATCCCACTGTGG + Intronic
1061790898 9:133058291-133058313 CAGCTGCCCAGCTCCACCTCCGG - Exonic
1061817340 9:133205183-133205205 CATCTCCCCAGCTTCCCTTGTGG + Intergenic
1061826541 9:133261553-133261575 CTCCTGCCCACCTCCCGGTGTGG - Intronic
1062242623 9:135548379-135548401 GAGCTGCCCAGGTCCCCCTGGGG + Intronic
1062243065 9:135550043-135550065 CATCTCCCCAGCTTCCCTTGTGG - Intergenic
1062332735 9:136051640-136051662 CACCTGCCCAGCTCCCGGCGCGG - Intronic
1062721116 9:138044679-138044701 CACCTGCCCAGCCCCTGCTCTGG - Intronic
1202796604 9_KI270719v1_random:125983-126005 CATCTGCCTAGCTTCTGGTGAGG + Intergenic
1203622056 Un_KI270749v1:135195-135217 CATCAGCCCTGCTCTCTCTGTGG + Intergenic
1185699255 X:2217999-2218021 CATCTGCCAAGCTTCCCATGGGG - Intergenic
1185745548 X:2569839-2569861 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1185769491 X:2754783-2754805 CATCTAATCAGCTGCCGCTGTGG - Intronic
1186001969 X:5022512-5022534 CATCTGCCCAGCTTCTGGAGAGG - Intergenic
1187114399 X:16334377-16334399 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1188238099 X:27753595-27753617 CATCTGCTCAGCTCCTGGTGAGG + Intergenic
1188713340 X:33429480-33429502 CATCTGCTCAGCTTCTGGTGAGG - Intergenic
1189109074 X:38268321-38268343 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1189155132 X:38749367-38749389 CTTCTCCCCAGCTCTAGCTGAGG + Intergenic
1189188053 X:39070869-39070891 CATCTGCTCAGCTTCCGAGGAGG - Intergenic
1189473731 X:41333584-41333606 AATCTGCCTAGCTCCCACTAAGG + Exonic
1190081265 X:47358509-47358531 CATCTGCCCAGCTTCTGAGGAGG + Intergenic
1191974236 X:66852280-66852302 CCTCTGCCCTGCTCTGGCTGTGG - Intergenic
1192602904 X:72483496-72483518 CATCTGCTCAGCTTCTGGTGAGG - Intronic
1194242968 X:91474393-91474415 CATCTGCTCAGCTTCTGCGGAGG + Intergenic
1194381623 X:93198924-93198946 CATGTGCCCAGCTAAAGCTGGGG + Intergenic
1194853082 X:98892657-98892679 CATCTGCTCAGCTTCTGATGAGG - Intergenic
1196777490 X:119352808-119352830 CATCTGCTCAGCTCCTGGTGAGG + Intergenic
1197031212 X:121818401-121818423 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1197705232 X:129630088-129630110 CAGCTCCCCAGCTCTCACTGGGG - Intergenic
1197813796 X:130476118-130476140 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1198314280 X:135451035-135451057 CATCTGCTCAGCTTCTGGTGAGG + Intergenic
1199175219 X:144780171-144780193 CATCTGCTCAGCTTCTGATGAGG - Intergenic
1199188092 X:144939858-144939880 CAGCTGCCCTGCTACAGCTGTGG - Intergenic
1202583564 Y:26404262-26404284 CATCAGCCCTGCTCTCTCTGTGG - Intergenic