ID: 1163438683

View in Genome Browser
Species Human (GRCh38)
Location 19:17310531-17310553
Sequence CTCAGGATGCCAACTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163438683_1163438694 -5 Left 1163438683 19:17310531-17310553 CCCCCATTAGTTGGCATCCTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1163438694 19:17310549-17310571 CTGAGGGCTGGGAAGGGTGATGG 0: 1
1: 0
2: 6
3: 105
4: 913
1163438683_1163438695 -4 Left 1163438683 19:17310531-17310553 CCCCCATTAGTTGGCATCCTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1163438695 19:17310550-17310572 TGAGGGCTGGGAAGGGTGATGGG 0: 1
1: 0
2: 5
3: 60
4: 624
1163438683_1163438696 4 Left 1163438683 19:17310531-17310553 CCCCCATTAGTTGGCATCCTGAG 0: 1
1: 0
2: 0
3: 6
4: 81
Right 1163438696 19:17310558-17310580 GGGAAGGGTGATGGGAAGCTTGG 0: 1
1: 0
2: 5
3: 91
4: 734

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163438683 Original CRISPR CTCAGGATGCCAACTAATGG GGG (reversed) Intronic
905082042 1:35331745-35331767 CTCAGGATGCCAGAGTATGGTGG - Intronic
907171133 1:52466264-52466286 TTCAGGAAGCCAACCAATGTGGG + Intronic
909031097 1:70541600-70541622 CTCAGAATGCAAGCTAATAGTGG - Intergenic
909458930 1:75885411-75885433 CTCAGGATACCAACTGAGGTGGG - Intronic
910799285 1:91129612-91129634 CTCAACATGTCAACAAATGGAGG + Intergenic
913159788 1:116134356-116134378 CTGGGGATGCCACCTAATGGTGG + Exonic
915916127 1:159942004-159942026 CTCAGGATTCAAACTAAAGAGGG + Intronic
916023837 1:160816907-160816929 GTCAGGATGCAAACTCTTGGAGG - Intronic
917235584 1:172888554-172888576 CTCAGGATGCAAGCTACAGGTGG + Intergenic
919063337 1:192662528-192662550 CTAAGGAGGCAAACTCATGGAGG + Intergenic
920794475 1:209125327-209125349 TTCAGGATTCCAAGCAATGGAGG - Intergenic
1062885287 10:1011376-1011398 GGCAGGATAGCAACTAATGGAGG - Intronic
1064396271 10:14984305-14984327 CCCAGGATGTCAACCAAGGGTGG - Intronic
1065763601 10:29006514-29006536 CTCTGGTTACCAACTAAGGGAGG - Intergenic
1067484706 10:46637437-46637459 CTCACTATGTCAACTAATGTGGG + Intergenic
1071338411 10:84620976-84620998 CTGAGGTTGCAAACTGATGGTGG - Intergenic
1072424161 10:95315284-95315306 CTTAGGCTGCCAAATAATGCTGG + Intronic
1074765788 10:116699120-116699142 CTCAGGATCCCCCCTGATGGAGG + Intronic
1077736791 11:4800034-4800056 CTCAGGATGCAAGCTACTGTTGG + Intronic
1083748966 11:64750850-64750872 ATGAGGATGCCCTCTAATGGTGG - Intronic
1085086539 11:73671662-73671684 CTCAGGGTGCAAGCTACTGGTGG + Intergenic
1087185864 11:95194272-95194294 CTCAGGTTACCTAGTAATGGGGG - Intronic
1090391261 11:126389674-126389696 CTCAGGAGGCTAACTAAGGTGGG - Intronic
1093757499 12:22868797-22868819 ATCAGAAAGCCAACTAATCGAGG - Intergenic
1095709762 12:45275804-45275826 CCCAGGAGGCCAAGTAATGAAGG - Intronic
1104740364 12:131167499-131167521 CTCAGGATTCCAGTTCATGGTGG - Intergenic
1108936745 13:55891250-55891272 CACAGGATGCAAGCTATTGGTGG + Intergenic
1109426185 13:62168268-62168290 CACAGGATGGAAGCTAATGGGGG + Intergenic
1115053355 14:29092068-29092090 ATCTGGATGGCCACTAATGGGGG + Intergenic
1116965167 14:51007036-51007058 CTCAGGAGGGCAATGAATGGGGG + Intronic
1120442712 14:84560096-84560118 CTCAGGATGGTAACAATTGGAGG - Intergenic
1120974634 14:90237872-90237894 CCCACCATGCCACCTAATGGGGG + Intergenic
1122295283 14:100701987-100702009 CACAGGATGCCAGCTAGTGCAGG + Intergenic
1127287431 15:57543869-57543891 CTTGGGATGCCAAGTAAAGGAGG - Intronic
1136474730 16:30505633-30505655 TTCAGGAGGCCAACCAAAGGGGG + Intronic
1138286368 16:55813169-55813191 CTCAGGATCCTAACTTAGGGGGG + Intronic
1149098042 17:52868883-52868905 CTCAGGATCCCAGGTGATGGAGG + Intronic
1149175696 17:53867732-53867754 CTCAGGATGCAAGCTGCTGGTGG + Intergenic
1150632987 17:66893377-66893399 CTCATGATGCCAACCAATGTTGG + Intergenic
1154426615 18:14277193-14277215 CTCAGGATGCCAGCAGTTGGCGG - Intergenic
1154429357 18:14296785-14296807 CTCAGGATGCCAGCAGTTGGCGG - Intergenic
1156041844 18:32831754-32831776 CTCAGGGTTCAAACTATTGGAGG + Intergenic
1159358313 18:67365877-67365899 CTCAGGATGCTAAATGAAGGAGG - Intergenic
1160062316 18:75543774-75543796 CTCAAGATGCCATCGAATAGTGG + Intergenic
1163438683 19:17310531-17310553 CTCAGGATGCCAACTAATGGGGG - Intronic
1164489380 19:28692684-28692706 CTCAGGGTGCAAGCTGATGGTGG - Intergenic
1168148924 19:54434710-54434732 CTCAACATGCCAACAAATGCTGG - Intronic
925429398 2:3778146-3778168 CTCAGGAAACCCACTGATGGAGG - Intronic
932747442 2:74345472-74345494 CTCAGGAATCCTCCTAATGGAGG + Intronic
938771367 2:134504022-134504044 CTCAGGAGGCCACCAAATGGTGG - Intronic
1169268199 20:4180490-4180512 CCCAGGACACCAGCTAATGGAGG - Intronic
1172272998 20:33664802-33664824 CTCAGGATGCCCTCTTTTGGGGG + Intronic
1177125088 21:17184360-17184382 CTCAGGATGGCCACAATTGGAGG + Intergenic
949195340 3:1299001-1299023 CTCAGCAATCCAAATAATGGTGG + Intronic
951634509 3:24758027-24758049 CTCAGGGTACCAACTAGAGGGGG - Intergenic
952555992 3:34531995-34532017 CTCAGGATGCCACATGATAGTGG - Intergenic
969272589 4:6112980-6113002 TTCAGGATCCCAAGTGATGGTGG - Exonic
969439134 4:7207149-7207171 CTCAGGGGGCCTTCTAATGGAGG + Intronic
969920444 4:10533611-10533633 CTCAGGTTTCCAACTAAAAGCGG - Intronic
973845710 4:54910951-54910973 CTCAGGCTACCAACTGATGGGGG + Intergenic
974166419 4:58210617-58210639 CTCAGTATACCATCTAATAGAGG + Intergenic
983907025 4:173194198-173194220 CTAAGGATGTAAACTAATTGGGG + Intronic
986575342 5:9206909-9206931 AGCAGGATGCCAATAAATGGTGG + Intronic
989308194 5:39981532-39981554 CTCAGGATGCAAGCTGCTGGTGG - Intergenic
994166293 5:96612177-96612199 GTCATGGTGCCCACTAATGGTGG + Intronic
995189049 5:109301452-109301474 CTCAGGATCCTATTTAATGGTGG + Intergenic
995338022 5:111025023-111025045 CTCAGTAAGCCAAGTCATGGAGG + Intergenic
997752771 5:136364486-136364508 CTCAGAATGCCACCTGCTGGTGG - Intronic
1003721467 6:8707800-8707822 CCCTGGATACTAACTAATGGTGG + Intergenic
1007545975 6:42695002-42695024 CTCAGGATGGCATCAAATGGAGG - Intergenic
1010397119 6:75405284-75405306 ATCAGGAAGCCAACAAATGTAGG + Intronic
1014703056 6:124713511-124713533 CTAAGAATTCCAAATAATGGAGG + Intronic
1023132469 7:37016474-37016496 CTCTTGATGTCAACTAAAGGAGG - Intronic
1023326330 7:39062168-39062190 TTCAGGATGCAAAACAATGGTGG - Intronic
1023558137 7:41444771-41444793 CTCATGATGCCAACAAGTAGAGG - Intergenic
1026430840 7:70345690-70345712 CTCATGATGCATACTAAGGGGGG - Intronic
1030144642 7:106341065-106341087 CTCATGGTGCAAACTATTGGTGG + Intergenic
1037459903 8:19098378-19098400 CTGGGGATGCCAACTGAGGGTGG + Intergenic
1038165871 8:25084537-25084559 CTCAGGATCCCAGCTAGTGTTGG - Intergenic
1039158943 8:34595548-34595570 CTCAGGGTGCAAATTATTGGTGG + Intergenic
1040463669 8:47674732-47674754 GTCATGATGCAAACTACTGGAGG - Intronic
1043033528 8:75168863-75168885 CACAGGATGCAAACTGCTGGTGG + Intergenic
1051545607 9:18271028-18271050 CTCATGATGCAGACTAATGTAGG - Intergenic
1058303890 9:103412077-103412099 CTCAGGAAGCAAAATAATGTGGG + Intergenic
1058828975 9:108798592-108798614 CTCAGGATGGCTACAATTGGAGG + Intergenic
1059717909 9:116930849-116930871 CTCAGGAAGCAATCTAATGGAGG - Intronic
1060428236 9:123524695-123524717 CTCAGGCTGCCCTCTGATGGAGG + Intronic
1196332806 X:114492068-114492090 CTCAGCCTCCCAAGTAATGGGGG - Intergenic