ID: 1163438871

View in Genome Browser
Species Human (GRCh38)
Location 19:17311532-17311554
Sequence CAGGGGCCTCAGGGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 653
Summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 585}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163438871 Original CRISPR CAGGGGCCTCAGGGTGAGGA GGG (reversed) Intronic
900146761 1:1162023-1162045 CAGGGGTCTGGGGGTGGGGAGGG - Intergenic
900154054 1:1197049-1197071 CAGTGGGCTCGGGGTGAGGAGGG + Intronic
900494577 1:2970714-2970736 CATGGGGCTCAGTGTGAGGAAGG + Intergenic
900605532 1:3521950-3521972 CAGGGACTTCAGGGAGAGGAAGG + Intronic
900784076 1:4636710-4636732 CAGGGGCCTAAGGGTGAGTGAGG + Intergenic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
901161063 1:7177092-7177114 GAGGGGCCTCAGTGTGTGGGAGG - Intronic
901161145 1:7177454-7177476 GGGGGGCCTCAGGGTGTGGGAGG - Intronic
901208037 1:7508534-7508556 CAGAGAACTCAGGGTGAGCAGGG - Intronic
901224754 1:7606803-7606825 AAGGATCATCAGGGTGAGGAGGG + Intronic
901376201 1:8841275-8841297 CAGGGCCCTCAGGCAGAGGCTGG - Intergenic
901490626 1:9594674-9594696 CAGGGGCCTGAGGGGGAGGCTGG - Intronic
901679797 1:10906397-10906419 CAGTGGGCTCAGGGAGAGGAAGG - Intergenic
901808351 1:11751579-11751601 CATGGGCCTCTGGGTCAGGGAGG + Intronic
902091766 1:13909373-13909395 CAGGGGCAAGAGGGTGAGGAGGG + Intergenic
902480373 1:16708252-16708274 CAGGGGCCTCTGAGGGAGGGTGG - Intergenic
902974569 1:20079694-20079716 CAGGAGCCTCTGGGTTTGGAGGG + Intronic
903024699 1:20419013-20419035 GGGGGGCCCCAGAGTGAGGAAGG + Intergenic
903183791 1:21618492-21618514 CAGGGGACTCAGCGAGATGAGGG - Intronic
903212233 1:21824658-21824680 CATGGGCCTAATGGGGAGGATGG - Exonic
903333229 1:22608211-22608233 CAGGGGCAGAAGGGAGAGGAAGG - Intergenic
903543238 1:24108412-24108434 CAGGGCCCCCAGTCTGAGGAGGG - Intronic
903929506 1:26854212-26854234 CAGGGTCCTCAGGGTGAAGCAGG + Exonic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904431782 1:30469009-30469031 GAGGGGCATGAGGGGGAGGAAGG + Intergenic
904597582 1:31656526-31656548 TGGGGGCCTCAGGCTGTGGAAGG - Intronic
904696164 1:32332737-32332759 CAGAAGCCAAAGGGTGAGGAAGG + Exonic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
905106784 1:35568033-35568055 CTGAGACTTCAGGGTGAGGAGGG + Intergenic
905164243 1:36067575-36067597 CAGGCGCCTGAGGCTGAGGCAGG + Exonic
905168847 1:36098536-36098558 CCTGGGCCTAAGGGTGAGGCAGG - Exonic
905222856 1:36460833-36460855 CAGGGCCCTTGGGGGGAGGAGGG - Intronic
905732089 1:40304372-40304394 CAGGGCCCTAAGGGGGAGCAGGG - Exonic
905892734 1:41527438-41527460 CAGGGGTGTGAGGGTGAGGGTGG - Intronic
905892805 1:41527845-41527867 CAGGGGTGTGAGGGTGAGGGTGG - Intronic
906109805 1:43315068-43315090 CAGGGGCCTGAGGGACAGAAGGG - Intronic
907388607 1:54141794-54141816 CAGGGGCCCCCAGGTGGGGAGGG + Intronic
907507980 1:54935732-54935754 CAGTGTCCTCAGGCTGAGGTGGG + Intergenic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
909420072 1:75454054-75454076 CATTGGGATCAGGGTGAGGATGG - Intronic
910502544 1:87909473-87909495 CAGGGGCCCCAGAGTGACCAAGG + Intergenic
910758332 1:90713201-90713223 CAGGGGGCTTAAGGGGAGGATGG + Intronic
910952650 1:92667177-92667199 CAGGAGGCTCAGGGGGAAGACGG + Intronic
911456251 1:98127868-98127890 CAGGGGCCTCAGATTGCAGAAGG + Intergenic
912262221 1:108121634-108121656 CAGGAGCCTCAGGAAGGGGAGGG + Intergenic
915339213 1:155167133-155167155 CAGAGCCCTGAGGGTGAGAAGGG - Intergenic
915543401 1:156582628-156582650 CCGAGGCCTCAGGGTTGGGAAGG + Intronic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915903009 1:159859907-159859929 CTGGGGCTTCAGGGTAGGGAGGG - Intronic
915912629 1:159924189-159924211 CAGAGGCCTTGGGGTGAGGGAGG + Intronic
916085913 1:161269238-161269260 CAGGGTGCTGAGGGTGGGGAAGG + Intronic
916619895 1:166485960-166485982 CAGTTGGCTCAGGGTGAGGCTGG - Intergenic
917539322 1:175897891-175897913 GAGGGGTCTCAGGGTGCTGAGGG + Intergenic
918059951 1:181052498-181052520 CAGGTCCCCCAGGGTAAGGACGG + Exonic
918474198 1:184905587-184905609 CAGGGGACTTAGGGGGAGAAAGG - Intronic
919910268 1:202106770-202106792 CAGGGTCCTCAGGCTGAGGGCGG - Intergenic
920183356 1:204146206-204146228 CAGGGCCCTCAGAATGAGGTGGG - Intronic
920657344 1:207886785-207886807 GAAGGGGCTCAGGGTGAGGGAGG + Exonic
920848544 1:209613008-209613030 AAAGGGGCTCAGAGTGAGGAGGG - Intronic
923019231 1:230150050-230150072 GATGGACCCCAGGGTGAGGATGG + Intronic
923460726 1:234207157-234207179 CACTGGACTCAAGGTGAGGAGGG - Intronic
923655261 1:235910424-235910446 CAGGGGCCACAGAATGTGGATGG - Intergenic
923977433 1:239279338-239279360 CAGGGGCCTTCGGGGGAGAATGG - Intergenic
924609022 1:245558511-245558533 AAGAGGCCTCAGGGGCAGGAGGG - Intronic
1063090635 10:2863502-2863524 CAGTGGCCTCCGGGTGGGCATGG + Intergenic
1063283675 10:4660243-4660265 TTGGGGCCACGGGGTGAGGAAGG + Intergenic
1065695250 10:28373692-28373714 CAGGGGACCCAGGGAGAGGTAGG - Intergenic
1065695256 10:28373711-28373733 CAGAGGCTTCAGGGAGAGGCAGG - Intergenic
1065892062 10:30129920-30129942 CCAGGGGCTCAGGGTGTGGATGG - Intergenic
1066634030 10:37483499-37483521 CAGGGTCCGCAGGGTCAGGGAGG - Intergenic
1067040714 10:42951851-42951873 CAGCGGGCTCAGGCTGGGGAGGG + Intergenic
1067156584 10:43786080-43786102 CAGGAGCCTCACTCTGAGGACGG + Intergenic
1067711611 10:48655432-48655454 CAGTGACCTCAGGGGGAGAAGGG + Intronic
1067717272 10:48699184-48699206 CAGGGCTCTCAGGGTGACCATGG + Intronic
1067925246 10:50502142-50502164 GAGAGGCCTCTGGGGGAGGAGGG - Intronic
1068119693 10:52772800-52772822 CAGATGCCTCAGAGTGAGGGAGG + Intergenic
1068122856 10:52801613-52801635 CAGTGGCCTGGGGGTGAGGTGGG + Intergenic
1068714119 10:60168698-60168720 CTGGGGCCTGGGGGTGGGGAGGG - Intronic
1069557341 10:69406921-69406943 CTGGGGGCTGAGTGTGAGGACGG + Intronic
1069613194 10:69789156-69789178 CTGGGGCCTCTGTGTGGGGAAGG + Intergenic
1069826921 10:71260254-71260276 CAGGGGCCTCAGGATAGGGGAGG + Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1071522623 10:86340587-86340609 CAGGGGCCTCCGGGGGAGTAAGG + Intronic
1071994419 10:91133644-91133666 CAGGAGCCTCAGGGTAAGCAAGG - Intergenic
1072449716 10:95530275-95530297 CAGGGTCCTCTGGGAGAGGTAGG - Intronic
1072718873 10:97768769-97768791 CCTGGGCCTCAGGGTGGGGTGGG + Intronic
1073110635 10:101061357-101061379 CAGCGGCCGCAGGGAGAGGCGGG - Intergenic
1073124920 10:101143186-101143208 CAGGCGCCTCACGGGGAGGAAGG - Intergenic
1074381481 10:112984351-112984373 CAGTGGCCTTAGGCTGCGGAAGG + Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1074704975 10:116122447-116122469 CTAGGGCCTCAGGCTGAGGAAGG - Intronic
1074997252 10:118768312-118768334 GAGGAGCCTGAGGGTGAGGATGG + Intergenic
1075615131 10:123885201-123885223 CTGGGGACTCAGGGTGGGGTTGG + Intronic
1076410284 10:130244432-130244454 CAGAGGCCGCAGGCTGAGGCTGG - Intergenic
1076550168 10:131273072-131273094 CCCGGGCCTGAGGGTGAGGTCGG - Intronic
1076699582 10:132264537-132264559 GAACGGCCTCAGGGAGAGGAGGG + Intronic
1076871822 10:133198305-133198327 CAGGGGGCTGAGGGTGTGGGCGG - Intronic
1077014643 11:394171-394193 CAGGCGGCTCTGGGTGAGGCTGG + Intronic
1077089626 11:772559-772581 GAGGGGCTTCAGGGTGCGGGTGG - Intronic
1077124466 11:926207-926229 CCGGGGCCTGAGGGTGCGGGCGG + Intronic
1077366600 11:2163742-2163764 GCGGGGCCTCAGGGTGAGCGGGG + Intergenic
1077390742 11:2299698-2299720 CAGGGGCCTCCTGGTGGGTAAGG + Exonic
1077445104 11:2587161-2587183 CAGTGGCCACACAGTGAGGAAGG - Intronic
1077478055 11:2800240-2800262 CAGTGGCCTGAGGGTGTGGGAGG + Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077554056 11:3217606-3217628 CAGGTGCAGCAGGGTGGGGAGGG + Intergenic
1078527317 11:12110742-12110764 CGCTGGCCTCAGGGTGGGGAGGG + Intronic
1078543760 11:12231449-12231471 CAGGTGGCTCAGGAAGAGGAGGG - Intronic
1079550034 11:21683962-21683984 CAGGAGCCCCAGGCTGAGAAAGG - Intergenic
1081576659 11:44322913-44322935 GTGGGGGCTCAGGGTGGGGAGGG + Intergenic
1081577795 11:44330045-44330067 CAGGGACCACAGGCTGAGGCTGG + Intergenic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1083339165 11:61947565-61947587 CTGGGGCCTCTGGGAGGGGAAGG + Intergenic
1083598581 11:63932248-63932270 CAGGGGCCTCGGAGAGATGAGGG + Intergenic
1083784554 11:64936388-64936410 CAGGAGGCTAAGGGGGAGGATGG - Intergenic
1083791328 11:64988226-64988248 GAGGGGTCTGAGGGTGATGAGGG + Exonic
1083912332 11:65717508-65717530 AAGGGGCCTCAGGGTTGGGGAGG - Intronic
1084033101 11:66492500-66492522 CAGGGGCCTGAGGGAGAGACGGG + Intronic
1084164050 11:67366922-67366944 CAGGGGGTTTAGGGTGTGGATGG - Intronic
1084219114 11:67666820-67666842 CCGGGGCCTCAGGGGCAGAAGGG + Intronic
1084312867 11:68326838-68326860 CATGGTCCTCATGGTGGGGAGGG + Intronic
1084444735 11:69196995-69197017 CAGGGGCCACCGGGAGTGGAAGG - Intergenic
1084675165 11:70629874-70629896 TAGGGTCCTCATAGTGAGGAAGG - Intronic
1085317680 11:75555283-75555305 CAGGGGCCTCGGGCTGGAGAGGG - Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086566805 11:88236520-88236542 CAGAGGCCACAGGGAGGGGATGG - Intergenic
1086667107 11:89496039-89496061 CAAGGGCCTCAGGGACATGATGG - Intronic
1088916392 11:114231044-114231066 CAGGGGCCTCAGGATGACTTTGG + Intronic
1088927355 11:114315865-114315887 CAGGGTGCTAAGGGGGAGGATGG + Intergenic
1089063752 11:115646395-115646417 CAGGGGTGTCTGGTTGAGGAGGG + Intergenic
1089151186 11:116365664-116365686 TGGGGCACTCAGGGTGAGGATGG - Intergenic
1089289394 11:117428606-117428628 CGGGGGCCCCTGGGTGGGGAAGG + Exonic
1089502283 11:118939787-118939809 GAGGGGCCTTTGGGGGAGGAGGG - Intronic
1089684001 11:120135294-120135316 TCGAGGCCTCAGGATGAGGAGGG - Intronic
1089804169 11:121068246-121068268 CAGGGGGCTAGGGGTGAGGGAGG - Intronic
1090851636 11:130575835-130575857 CTGGGTCCTCAGGGTCAGGCAGG + Intergenic
1091324725 11:134677598-134677620 CAGCTGCCTCTGTGTGAGGAAGG + Intergenic
1091333941 11:134752826-134752848 CTGGGACGTCAGGGTGGGGAAGG + Intergenic
1091364012 11:135001805-135001827 CAGTGGCCTCAGAGGAAGGAGGG + Intergenic
1091587110 12:1822630-1822652 CAGGAGGCTGGGGGTGAGGATGG + Intronic
1091727731 12:2857296-2857318 CCCAGGCCTCAGGGTGGGGATGG + Intronic
1092112556 12:5974046-5974068 CTGTGGCTTCAGGGTGATGATGG + Intronic
1092347933 12:7731615-7731637 CAGAGGCCTCTGGCTGAGCAGGG + Intronic
1092646341 12:10577689-10577711 CCAGGGCCTCAGAGAGAGGAAGG + Intergenic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1096078822 12:48820459-48820481 AGGGGGCCTCAGGGAGAGCAAGG - Intronic
1096411492 12:51379872-51379894 CTGGGGCCTCAGCCTGAGAAAGG + Exonic
1096537680 12:52286008-52286030 AAGGGGCCTCAGGAGCAGGAAGG - Exonic
1096691704 12:53325586-53325608 GAGTGGCGTCAGGGTGGGGAGGG + Intergenic
1098222628 12:68286098-68286120 CAGTGGCCTAAGGGCCAGGAGGG - Intronic
1098981223 12:76958396-76958418 TAGGGTCCACAGAGTGAGGAAGG - Intergenic
1099170623 12:79359581-79359603 CAGGGGACTCGTGGTGATGAAGG + Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1100365322 12:93915176-93915198 GAGAGGGCTCAGGATGAGGAAGG + Intergenic
1100386507 12:94109157-94109179 GAGGGGCCTCAGCTTGAGGCAGG + Intergenic
1101132405 12:101702936-101702958 CCGGGGACTAAGGGTGAGGCAGG - Intronic
1102123169 12:110458978-110459000 CTGGAGGCTGAGGGTGAGGAAGG - Intronic
1102207305 12:111099290-111099312 CTGGGACCTCCGGGTGAGCAGGG + Intronic
1102243349 12:111339361-111339383 CAGGGGGCTGAGGCAGAGGAGGG - Intronic
1102476690 12:113193231-113193253 CAGGAGGCTGAGGGGGAGGATGG - Intergenic
1103239048 12:119398074-119398096 AAGGGGCCGCGGGGGGAGGAAGG + Intronic
1103931407 12:124452942-124452964 CAGGGGCCTCGGGGAGTGGCTGG - Intronic
1104010935 12:124929475-124929497 CAGGTGCCTCAGAGTGAGTAAGG + Intergenic
1104561632 12:129850518-129850540 CAAGGGCCTCAGGGTGGGTGAGG + Intronic
1104629848 12:130391174-130391196 CATGGGCCTGAGGAAGAGGAAGG + Intergenic
1104787829 12:131461279-131461301 CAGGGGCCACCTGGGGAGGATGG - Intergenic
1104900502 12:132187438-132187460 CGGGGGCCTCAGGATGTCGACGG + Intergenic
1105883744 13:24624984-24625006 AGGGGGCCTGAGAGTGAGGAAGG + Intergenic
1106099369 13:26681255-26681277 CTGGGGCCTGAGGGGGAGGCGGG - Exonic
1107722889 13:43267413-43267435 CTGGGGCCTGAGGGTGGGAAAGG + Intronic
1108015638 13:46072662-46072684 CAGAGGTGTCAGGGTGAGAAGGG + Intronic
1108984141 13:56561664-56561686 CAGGGGCGGGAGTGTGAGGAAGG + Intergenic
1112606379 13:100910578-100910600 GAGGGTCCTCAGGCTGAGGGTGG + Intergenic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1113123039 13:106944621-106944643 AAAGGGCCTCAGAGTGAGAAGGG + Intergenic
1113659912 13:112099264-112099286 TAGGGTCCTCAGTGTGGGGAGGG + Intergenic
1113843106 13:113371463-113371485 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843237 13:113371780-113371802 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113843276 13:113371879-113371901 GAGGGGCCTCAGGAGGAGGGAGG - Intergenic
1113863688 13:113507806-113507828 CAGGGGCTGCTGGGTGAGGCAGG + Intronic
1113885687 13:113657306-113657328 CAGGGGTCGCAGGGGGAGGTGGG + Intronic
1113890713 13:113734331-113734353 AAGGGGTCACAGGATGAGGAGGG + Intronic
1113914538 13:113862919-113862941 CAGGAGCCGCCGTGTGAGGACGG - Intronic
1113925241 13:113938342-113938364 AAAGGGCCTCAGGGTGCTGAAGG + Intergenic
1114253591 14:20982607-20982629 CAGGGTCATGAGGGTGAGCAAGG - Intergenic
1114266328 14:21074613-21074635 CTGGGGCCTCGGGGCCAGGATGG + Exonic
1114635295 14:24183773-24183795 CAGAGATCTCAGGGTGCGGAGGG - Exonic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1118933281 14:70263029-70263051 GAGGGATCTCAGGGTGAGGATGG + Intergenic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119473085 14:74911350-74911372 CAGGTGCCACATGGTGAGCAGGG - Exonic
1119488432 14:75008580-75008602 TAGGGGCCTGAGATTGAGGAAGG + Intronic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119886974 14:78151580-78151602 CAGGGGACTGAGGGTGGGAAGGG - Intergenic
1120714372 14:87824274-87824296 GAGGGGCTTCAGTGTGATGAGGG - Intergenic
1121043741 14:90773078-90773100 CAGGGCCTTCAGGGACAGGAGGG + Intronic
1121319919 14:92986334-92986356 CAGGAGACTCAGTGTGAGTAGGG + Intronic
1122265639 14:100545475-100545497 GATGGGCCCCAGGGTGAGGCTGG + Intronic
1122412784 14:101534479-101534501 CAGGGGCCTCTGGGTTGGTAGGG + Intergenic
1122521705 14:102348647-102348669 CAGGTAGCTCAGGGTGAGGTCGG + Exonic
1122678704 14:103439245-103439267 AAGGGGAATCAGGTTGAGGAGGG - Intronic
1122817068 14:104319145-104319167 CAGAGGGCTCTGGGGGAGGAAGG - Intergenic
1122886643 14:104713279-104713301 CGGCGGCCTCGGGGAGAGGACGG + Exonic
1122918671 14:104870655-104870677 CAGGGTGCTCAGGGTGAGTTTGG + Intronic
1124292160 15:28463170-28463192 CAGGGGCTTCATGGTGAACATGG + Intergenic
1124613297 15:31223761-31223783 CAGGGGGCCCAGGGTGACCACGG + Intergenic
1124635302 15:31361165-31361187 CAGGGGCCCCTGGGTGCAGAGGG + Intronic
1124817840 15:33014303-33014325 CAGATGCCTGAGTGTGAGGATGG + Intronic
1125715571 15:41818049-41818071 AAAGGGTCACAGGGTGAGGACGG + Exonic
1125984441 15:44036308-44036330 CAGGTGCGTGAGGGTGAAGAGGG - Intronic
1127077320 15:55339848-55339870 CTGGTGACTCAGGGTGGGGAAGG + Intronic
1127547850 15:60006196-60006218 TCGGGGCCTCAGGGAGGGGATGG - Exonic
1128562570 15:68678331-68678353 CTGGGGGCTCAGTGTGAGGGAGG - Intronic
1129661355 15:77554722-77554744 CTGGGGGCTCAGGCTGAAGAGGG + Intergenic
1129671884 15:77612193-77612215 GAGGGGCTTCAGGGTCAGGGAGG - Intergenic
1129776958 15:78243260-78243282 CAGTGGCCTGAGGCTGGGGAAGG + Intronic
1129829915 15:78661946-78661968 CTGGGGCTTCAGGGGGAGGGAGG - Intronic
1130542873 15:84834712-84834734 CAGAGGCCACAGGGTGTGAAGGG + Intronic
1130651462 15:85764330-85764352 GGGTGGCCTCAGGCTGAGGAGGG + Intronic
1131009355 15:89004374-89004396 GATGGGGCTCAGGGAGAGGAGGG - Intergenic
1131629507 15:94161487-94161509 CAGGTGCCTCAGTGGGAGGTGGG - Intergenic
1131823891 15:96300938-96300960 CAGGGGCCTGTGGGTCAGTAAGG + Intergenic
1132362779 15:101231428-101231450 CAGGGGCCGGAGGCAGAGGAAGG + Intronic
1132460046 16:48333-48355 CATGGGACTCAGGGAGGGGAGGG - Intronic
1132675078 16:1118145-1118167 CTGGGGCTACAGGGTCAGGAGGG + Intergenic
1132702585 16:1228451-1228473 AAGGGGGCTCAGGATGGGGAAGG + Exonic
1132709117 16:1258724-1258746 GAGGGGGCTCAGGGTGGGGGAGG - Exonic
1132722956 16:1326002-1326024 CAGAGGGCTCAGCGTCAGGACGG - Exonic
1132724045 16:1331191-1331213 CCTGGGGCTCAGGGTGGGGAGGG + Intergenic
1132998365 16:2836151-2836173 CCTGGGCTCCAGGGTGAGGAAGG + Intronic
1133012539 16:2922469-2922491 CAGGGGCAGGAGGATGAGGAGGG - Intronic
1133026624 16:2991453-2991475 CAGGGGCCGCAGGGAGGGGCGGG + Intergenic
1133144615 16:3775284-3775306 CAGGAGGCTAAGGTTGAGGACGG - Intronic
1134013069 16:10869478-10869500 GAGGGGGCTCAGAGTGTGGAGGG - Intergenic
1134207666 16:12251006-12251028 CAGGGCCCTGAAGGTGAAGAAGG - Intronic
1134336782 16:13307413-13307435 CAGGGGCCTCATGGTGTGAAAGG + Intergenic
1135304215 16:21354841-21354863 CAAGGGCCTCTGGGACAGGACGG - Intergenic
1135423827 16:22322590-22322612 CAGGGGTCTTAGGATGAGGCTGG + Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136079931 16:27845176-27845198 CAGGGACCTCTGGGTAAGGGAGG + Intronic
1136300956 16:29333978-29334000 CAAGGGCCTCTGGGACAGGACGG - Intergenic
1137405474 16:48185818-48185840 CAGGGGCCACAGAGTGACCAGGG - Intronic
1138454206 16:57112199-57112221 CAGGGGCCCCAGAGTGGGTAGGG + Intronic
1139477125 16:67208366-67208388 CAGGGCCCGCAGCGTGAGCAGGG + Exonic
1140031337 16:71341548-71341570 CAGGGGTCTCTGGATGGGGATGG + Intergenic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140944202 16:79752577-79752599 CAGTGGCCTCTGAGTGAGCAAGG + Intergenic
1141177025 16:81727666-81727688 ATGTGGCCTGAGGGTGAGGATGG - Intergenic
1141180891 16:81752742-81752764 CAGGGCCCTCAGGGTGCCCAGGG + Intronic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1141439527 16:84020706-84020728 CAGAGGCCTCAAGGGCAGGATGG - Intronic
1142132229 16:88436337-88436359 CAGGGCCCACAGGCTGAGGCCGG - Exonic
1142223511 16:88866467-88866489 CTGGGGCCAGAGGGTGGGGAAGG - Exonic
1142281030 16:89147536-89147558 GAGGGGCCACAGAGCGAGGAGGG + Intronic
1142428022 16:90011102-90011124 CAGGGTCCTCAGGGTGCTGCTGG - Intronic
1142806387 17:2373205-2373227 GACGGGCCTCAGGGTAAGGACGG - Intronic
1143020437 17:3914728-3914750 CAGAGGCCTGGGGGTCAGGAGGG + Intronic
1143095266 17:4475476-4475498 GAGGGGAGTGAGGGTGAGGAAGG + Intronic
1144525561 17:15986647-15986669 CAGGGGCCTTGGGGTGGGGGAGG + Intronic
1144582072 17:16464731-16464753 CACTGGCCTCATGGTCAGGAGGG + Intronic
1144626027 17:16844909-16844931 GTGGGACCTCAGGGTGGGGAAGG - Intergenic
1144880407 17:18427811-18427833 GTGGGACCTCAGGGTGGGGAAGG + Intergenic
1145023866 17:19453231-19453253 CAGGGGATCCTGGGTGAGGATGG - Intergenic
1145151828 17:20516576-20516598 GTGGGACCTCAGGGTGGGGAAGG - Intergenic
1146006157 17:29162025-29162047 TAGGGGCCTGAGGGAGAGGAGGG - Intronic
1146055037 17:29576759-29576781 CAGGGGCCTGAGGGACAGGTGGG - Intronic
1146275914 17:31515478-31515500 CAGGGGTCTCCTGGTGGGGACGG + Intronic
1146376114 17:32295624-32295646 TTGGTGCCTCAGGGTGAGGAAGG + Intronic
1146499751 17:33354315-33354337 CAGGGGGCTCATAGTGGGGATGG - Intronic
1146805238 17:35859614-35859636 AAGGGAGCTGAGGGTGAGGAAGG - Intronic
1147167489 17:38601300-38601322 AAGGGGCCCCAGGGCGTGGATGG + Intronic
1147744841 17:42688725-42688747 CTGGGGCCTCAGGGAGTGGAAGG + Intronic
1148325059 17:46778524-46778546 CAGGAGGCTCAGGGTGGGGGTGG - Intronic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1148911197 17:50944139-50944161 CAGGAGTCTCAGGCTGGGGAGGG - Intergenic
1149432512 17:56605643-56605665 CAGAGGCCTGAGGGCGAGGATGG - Intergenic
1149499897 17:57144545-57144567 CATGGTCCTCTGGGTGGGGAAGG + Intergenic
1149695541 17:58613349-58613371 CTGGGGCAAGAGGGTGAGGAGGG + Intronic
1149848578 17:60021781-60021803 AGGCAGCCTCAGGGTGAGGAAGG + Intergenic
1149861591 17:60124743-60124765 AGGCAGCCTCAGGGTGAGGAAGG - Intergenic
1150343869 17:64389134-64389156 CAGTGGCCCCAGGCTGGGGAGGG - Intronic
1150415370 17:64983882-64983904 CAGTGGCCTCACGTGGAGGAAGG - Intergenic
1151588465 17:75026562-75026584 CAAGGGCCTGATGGTCAGGAAGG + Intergenic
1151828436 17:76536445-76536467 GAGGGGCTTGAGGGTGAGCATGG + Intronic
1152073688 17:78146331-78146353 CAGGGGCCTCAGGGTGGGGGAGG + Exonic
1152367592 17:79865665-79865687 CGGGGGACTCACGGTGGGGATGG - Intergenic
1152469603 17:80483347-80483369 AAGGGGCCTGAGGGTGCAGAGGG + Intergenic
1152713086 17:81884643-81884665 CAGGGACCTCAGGCTGAAGACGG + Intergenic
1152894048 17:82900199-82900221 CAGGGGCCTCAGGGTGGGGGAGG - Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153449663 18:5213143-5213165 CAGGGGCATCACAGTGAGAAGGG + Intergenic
1157221706 18:45832862-45832884 CAGAGGACTCAGGGTGAGGGTGG - Intronic
1159626842 18:70704999-70705021 TTGGAGCCTCAGGGTCAGGAAGG + Intergenic
1159812971 18:73038997-73039019 CTGGGGCCTCTGGGAGAAGAGGG - Intergenic
1160507770 18:79436960-79436982 GGGTGGCCTCAGGGTGCGGACGG - Intronic
1160528942 18:79552520-79552542 CAGAGTCCTCTGGGTGAGGGTGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160779862 19:872915-872937 CAGAGGCTTCATGGAGAGGAGGG + Intronic
1160990021 19:1856688-1856710 CAAGGGCCTCAGTCTGGGGACGG + Intronic
1161021502 19:2013628-2013650 CAGGGGTCTCTGGCTGAGGTGGG + Intronic
1161028279 19:2046579-2046601 GAGGGGCCCGAGGGGGAGGAGGG - Intronic
1161283221 19:3456692-3456714 CGGGGGGCTCAGGGCGAAGAGGG + Intronic
1161349641 19:3784753-3784775 AAGGGGTCTCAGGGTGTGGACGG + Intronic
1161394292 19:4037193-4037215 CAGGGGCCTGAGGGCGGGGGAGG + Intronic
1161477879 19:4496422-4496444 CGGGGCCCCCAGGGTGTGGAGGG - Intronic
1161485708 19:4534740-4534762 CAGGGGCCGCAGGGGTAGCAGGG - Intronic
1161579139 19:5071104-5071126 GAGGGGCCTGTGGGTGGGGAAGG + Intronic
1162112139 19:8405030-8405052 CAGGGTCTTCAGGGTGTGGGTGG - Intronic
1162334143 19:10049904-10049926 CAGGCATCTCAGGGTGGGGAGGG + Intergenic
1162365235 19:10244583-10244605 CAGGAGGCTGAGTGTGAGGATGG + Intergenic
1162727572 19:12699314-12699336 CAGGGGGAAGAGGGTGAGGAGGG + Exonic
1162965002 19:14151370-14151392 CAGGGGGCTCAGGCGGTGGAGGG + Exonic
1163369346 19:16893386-16893408 ACGGGGCCTCGGGCTGAGGAAGG + Intronic
1163404333 19:17112971-17112993 GAGGAGGCTCAGGGTCAGGACGG + Intronic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1163679534 19:18672664-18672686 CAGGGATCTGATGGTGAGGAGGG - Intergenic
1163834264 19:19563554-19563576 CAGAGTCCGCAGGGTGAGGAAGG + Exonic
1164451833 19:28372723-28372745 CAGGTTCCACAGGGTGAGGAGGG - Intergenic
1164609698 19:29623811-29623833 CTGGGGCCACAGGGTGCGGTGGG + Intergenic
1164779480 19:30880862-30880884 CAGGGGGCACAGGGAGAGGTGGG + Intergenic
1165102849 19:33449075-33449097 CAGGGGCCTCGGGGGAAGGCAGG + Intronic
1165171061 19:33891921-33891943 AGGGGGCCACAGGGTGAGCAAGG + Intergenic
1165358072 19:35316374-35316396 CATGGGCCTGAGAGTGGGGAGGG - Intergenic
1165769174 19:38368423-38368445 TAGGGGGCTCAGGGCCAGGATGG - Intronic
1166061534 19:40328608-40328630 CAGCAGTCTCAGGGTCAGGATGG + Intronic
1166781353 19:45345167-45345189 CAAGGGCCTTGGGGTGGGGAAGG + Intronic
1166948371 19:46411244-46411266 CAGGAACCTCAGGGTGCTGAGGG - Exonic
1166985723 19:46659285-46659307 CAGAGGGCTGAGGGGGAGGAGGG + Intronic
1167069217 19:47209984-47210006 CTGGGGCTTCAGGGCTAGGAGGG + Exonic
1167353506 19:48990280-48990302 CCAGGGCCCCAGGGTGAAGACGG - Intronic
1167504387 19:49863369-49863391 CAGGGCCCTCACGGCGAGGGCGG - Intronic
1167712660 19:51122006-51122028 CAGGGGACTCTGGGCCAGGAAGG - Intergenic
1168607251 19:57769915-57769937 CAGGGGCCTCAGGGTCTGGGTGG - Intronic
1202714414 1_KI270714v1_random:34154-34176 CAGGGGCCTCTGAGGGAGGGTGG - Intergenic
924980332 2:214076-214098 CAGGGGCCTCGGGGGGAAGGAGG - Intergenic
925048922 2:796219-796241 CAGGGGCCTGAGGGAGTGGAGGG - Intergenic
925290315 2:2743706-2743728 CAAGGGTCTCAAGGTGGGGAGGG - Intergenic
925305822 2:2847385-2847407 CTGGGGCCTGAGGGTGTGGGCGG + Intergenic
925380739 2:3423960-3423982 AAGGGGCCACAGGCTAAGGAAGG - Intronic
925556294 2:5134620-5134642 CAGGGCCCTCAGCAGGAGGAGGG + Intergenic
925830007 2:7884472-7884494 CAGGAGCCTGGGGGTGGGGAGGG + Intergenic
927709182 2:25314522-25314544 TAGGGGCCTCTGGGGGAGGCTGG - Intronic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
928113990 2:28532740-28532762 CATGGGCCAAGGGGTGAGGATGG - Intronic
928879928 2:36086632-36086654 ATAGGGCCTCAGGGTGAAGAGGG + Intergenic
929075177 2:38074801-38074823 CAGCGGCCTCGGGTCGAGGAAGG + Exonic
931829257 2:66034097-66034119 CATGGGTATCAGGGTGAGGAAGG + Intergenic
933050996 2:77602251-77602273 CAGGGGCCTTAGTTTAAGGAAGG + Intergenic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934680713 2:96281955-96281977 CAGGGGTCTCCGGGTGAAGTAGG + Intronic
934702170 2:96451334-96451356 TAGGAGCATGAGGGTGAGGAGGG - Intergenic
934808909 2:97265206-97265228 CTGGGGCCTGGGGGAGAGGATGG + Intergenic
934828596 2:97491963-97491985 CTGGGGCCTGGGGGAGAGGATGG - Intergenic
935792127 2:106602161-106602183 CAGTGTCCTGAGGGTGAGCAGGG + Intergenic
936024615 2:109021727-109021749 CCAGGGCCACAGGGTGTGGAGGG + Intergenic
936350269 2:111707089-111707111 CTGGGGCACCAAGGTGAGGAGGG + Intergenic
937098967 2:119254131-119254153 CAGAGGGCTCAGGGTGAGACAGG + Intronic
937225996 2:120369103-120369125 CAAAGGCTTCAGGGTGAGGGAGG - Intergenic
938453794 2:131445417-131445439 CATGGCCCTCTGGGTGCGGACGG + Intergenic
942116663 2:172735576-172735598 CAGAGGCCCCGGGGTGAGGGTGG + Intronic
942795493 2:179814142-179814164 CAGGGACCTCAGGGGCAGAAGGG + Intronic
944539591 2:200743059-200743081 CTGGGGCACCAGGATGAGGATGG + Intergenic
946147947 2:217744902-217744924 GAGGGGCCTCAGGGGGTGGATGG - Intronic
946313314 2:218894830-218894852 CAGGGACATGAGGGTGGGGAAGG - Intronic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
947526181 2:230878102-230878124 CAGGGGGTTCTGGGGGAGGAGGG - Exonic
947569032 2:231216553-231216575 AAGGAGCCTCAGAGAGAGGATGG + Intronic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948705997 2:239792799-239792821 CAGGGCCCTCAGGGACAGGGAGG + Intronic
948827189 2:240578421-240578443 CAGGGGACACAGGGAGAGGATGG + Exonic
948831275 2:240599331-240599353 CAGGGGGCTGAGGTTGAGGCTGG + Intronic
948853883 2:240721204-240721226 CAGGGGCCACAGGGGCTGGAGGG - Intronic
948860729 2:240751486-240751508 CAGGGGTATTAGGGTGTGGAGGG - Intronic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1169661414 20:7982384-7982406 CAGGGGCCCCCAGGAGAGGACGG - Exonic
1170295071 20:14815075-14815097 CTGGGGCCTCAAGGTGAGAGAGG + Intronic
1171192029 20:23165555-23165577 CACGGCCCTGTGGGTGAGGAGGG + Intergenic
1171796096 20:29567764-29567786 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1172055168 20:32149814-32149836 CAGGTGCCTCAAGGAGAGAAGGG + Intronic
1172846099 20:37930771-37930793 CAGGGCACCCAGGGTGAGGTGGG - Intronic
1173443308 20:43096512-43096534 CAGGAGCCCCAGGAGGAGGAGGG - Intronic
1173646457 20:44636155-44636177 CAGGGGCCTCTGGGTGGAGCTGG + Intronic
1173737752 20:45373764-45373786 TAGGGGCCTCGGGGTGGGGGTGG + Exonic
1174197928 20:48786380-48786402 AAGGAGACTCAGGGAGAGGAGGG + Intronic
1174220577 20:48951425-48951447 CAGGGCCCTCAGACTGATGAAGG + Exonic
1174715379 20:52752151-52752173 AAGAGGCCTCAGGGTTAGAAGGG - Intergenic
1175315837 20:58045982-58046004 ATGGGGCCTCAGGAGGAGGAAGG - Intergenic
1175445454 20:59016551-59016573 CAGGGGCCCCTGGGTGGGGAGGG + Intergenic
1175874023 20:62220949-62220971 CGGCGGCCTCAGGCTGAGGAGGG + Intergenic
1175967286 20:62665976-62665998 CAGAGGCCCCTGGGGGAGGAGGG + Intronic
1175998220 20:62820772-62820794 CAGGGCCCAGAGGGTGTGGAGGG + Intronic
1176079680 20:63266006-63266028 CTGGGGTCTCAGGATGAAGACGG + Intronic
1176147927 20:63573707-63573729 GAGGGGCCTCACGGAGAGGAGGG + Intronic
1176204814 20:63882532-63882554 CAGGGGCCTCTGGGGGCCGAGGG + Intronic
1176216090 20:63948534-63948556 CATGCGCCTCGGTGTGAGGAGGG + Intronic
1177565645 21:22817993-22818015 GAGGGGGAACAGGGTGAGGAAGG + Intergenic
1177709348 21:24751589-24751611 CAAGGGCCTGAAGGTGAGGGAGG - Intergenic
1178790559 21:35695837-35695859 CAGTGGCCTCAGGGTTCGGCAGG + Intronic
1179548081 21:42125517-42125539 GAGGGGCTGAAGGGTGAGGAAGG - Intronic
1179629010 21:42665434-42665456 CAGGGGTCTCTGGGTGGGGGAGG - Intronic
1179719414 21:43306791-43306813 CAGGGGCTTCTGGGTGGGGCTGG - Intergenic
1179725413 21:43338963-43338985 CAGGGGCCACAGGCTGTGGTGGG + Intergenic
1179933985 21:44591059-44591081 CGGGGGGCACAGGGTGAGGTGGG - Intronic
1179980027 21:44891013-44891035 CAGGGACCTGAAGGTGAGGAAGG + Intronic
1180050923 21:45330663-45330685 CCAGGGCCTCAGGGTGAAGGGGG + Intergenic
1180200659 21:46222178-46222200 CAGGCGGGTCACGGTGAGGAAGG - Intronic
1180252231 21:46597237-46597259 AAGGTGCCTCTGGGTGAGGGCGG + Intergenic
1180260305 21:46663815-46663837 AAGGGGCCTCAGGCTGATGTGGG - Intronic
1180612293 22:17105789-17105811 TGGGGGCCTCAGGGTGGGCAGGG + Intronic
1180800690 22:18630557-18630579 CAGGGGCCTGAGGGTAAGCAAGG - Intergenic
1180851922 22:19026114-19026136 CAGGGGCCTGAGGGTAAGCAAGG - Intergenic
1180860119 22:19073972-19073994 CAGGGGCGTCTGGGAAAGGAGGG + Intronic
1181221029 22:21364705-21364727 CAGGGGCCTGAGGGTAAGCAAGG + Intergenic
1181434362 22:22901586-22901608 AAGGGGTGTCTGGGTGAGGAAGG - Intergenic
1181462736 22:23095006-23095028 CAGGTGCATGAGGGAGAGGAGGG - Intronic
1181491027 22:23260871-23260893 CAGGGCCCTCTGAGAGAGGAGGG - Intronic
1181533810 22:23531621-23531643 CAGGCGCCTCATGGTGGGGTGGG - Intergenic
1181542382 22:23580309-23580331 CAGGGACCAGAGGATGAGGATGG - Intergenic
1181623330 22:24105753-24105775 GAGGGGCTTTTGGGTGAGGAGGG - Intronic
1181955746 22:26586891-26586913 CAGGGTCCTAGGGGTGGGGAAGG + Intronic
1182057674 22:27372650-27372672 CAGGGTCCTCAGAGTGAAGGTGG + Intergenic
1182077771 22:27506539-27506561 CAGGTGCTTCAGGGGGAGGGAGG + Intergenic
1182711488 22:32325976-32325998 CAGGGCCCACGGGGTGAGGAGGG + Intergenic
1183365251 22:37403411-37403433 GAGGGGCCGGAGGGTGGGGATGG + Intronic
1183545442 22:38452806-38452828 CTGGCCCCTCAGAGTGAGGAGGG - Intronic
1183677662 22:39308764-39308786 CACGGGCCTGAGAGTGAGGGAGG - Intergenic
1183834607 22:40441938-40441960 CAGGGGCCCCAGGGCCAGAATGG + Intronic
1184399014 22:44262765-44262787 CAGGGCCCACGGGGTGAGGAGGG + Intronic
1184509737 22:44926432-44926454 CTGGGGCATCTGAGTGAGGACGG - Intronic
1184514407 22:44953093-44953115 CCTGGGCCTCAGAGAGAGGAAGG - Intronic
1184858364 22:47158778-47158800 CAGGTGCCTCTGGCTGAGGCAGG - Intronic
1185265533 22:49900704-49900726 CAGGGTCCTCAGGGTGGAGATGG + Exonic
1185338957 22:50283199-50283221 CAGGGGCACTCGGGTGAGGACGG + Intronic
1185372952 22:50469361-50469383 CTGGGGCCCCACGGAGAGGAGGG - Intronic
1185401514 22:50620613-50620635 GAGGGGCCACAGGGAGGGGAGGG + Intergenic
949892238 3:8741952-8741974 GAGGGGCTGGAGGGTGAGGAAGG - Intronic
950153586 3:10707048-10707070 CTGAGGCCTCAGGGCAAGGAGGG + Intronic
950565102 3:13764670-13764692 CAGGGCCCTGATGGTGAAGAGGG + Intergenic
950630112 3:14276666-14276688 CAGAGGCCTGGAGGTGAGGAAGG + Intergenic
950661548 3:14469789-14469811 CAGGGGTCTCAGGATGGGGCTGG - Intronic
950665287 3:14491603-14491625 CAGAGGCCTCAGCCCGAGGAGGG + Exonic
951663305 3:25094610-25094632 CAGGAGGCTTAGGGAGAGGATGG + Intergenic
951782683 3:26381951-26381973 CAGTGGTCTCATGGTGAGCAGGG - Intergenic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952194304 3:31056865-31056887 GAGGGGCCTGACTGTGAGGAGGG - Intergenic
953464079 3:43104529-43104551 CAGGGGCCCAAGGCTCAGGAAGG + Intronic
953692927 3:45134806-45134828 CTGGGCCCTCTGGGTGAGGAAGG - Intronic
954136429 3:48584171-48584193 CTGAGGCGTCATGGTGAGGATGG + Intronic
954149405 3:48649982-48650004 TAGGGTCCTCAGACTGAGGAGGG + Intronic
954390948 3:50267648-50267670 CAGCGGCCCCAGGGTGGGAAGGG + Intronic
954580867 3:51702348-51702370 CTGGGGCCTCAGCAAGAGGAGGG + Intronic
954581614 3:51706314-51706336 CAGGGGCATCTGGGAGGGGAGGG - Intergenic
954582014 3:51707968-51707990 CAGGGCCCTGAAGCTGAGGATGG + Intronic
954674899 3:52310416-52310438 CGGGGCCCTCAGGCTCAGGAGGG - Intergenic
956376917 3:68623112-68623134 CAGGGGACTAAGGGTGGGGCAGG - Intergenic
957293789 3:78310639-78310661 CCTGGGCAACAGGGTGAGGAAGG + Intergenic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961332962 3:126153772-126153794 CAGTGGCCTCAGGGAGCTGATGG + Intronic
961365603 3:126397664-126397686 CAGGGGTCTCAGAGTCAGGTGGG + Intronic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
963740710 3:149077796-149077818 CAGGGGCCTTAGAGTGTTGAAGG + Intronic
964757148 3:160098572-160098594 CATGGGCTCCAGGGTGAGGGAGG - Intergenic
965405287 3:168260646-168260668 AAGGGGCCTGAGGCTCAGGAAGG + Intergenic
967529618 3:190533537-190533559 AAGGGGACTTAGGATGAGGAAGG + Intronic
967896133 3:194397335-194397357 CAGGCGGCTCAGGTTGCGGAAGG + Exonic
968603858 4:1522371-1522393 AAGGGGCATGAGGGTGAGGGGGG - Intergenic
968708016 4:2092404-2092426 CAGGGCCGTCAGGCTGGGGACGG + Intronic
969095630 4:4730243-4730265 CATGGGGCTCAGGGTGGGGATGG + Intergenic
969519230 4:7666128-7666150 CAGGAGACTCAGGGGGAGGCAGG + Intronic
969645544 4:8426685-8426707 CAGGGGCATATGGGTGTGGATGG - Intronic
969656072 4:8499269-8499291 CAGGGGGCCCAGGCTGAAGATGG - Intergenic
970175174 4:13332131-13332153 CAGGGGCCTGAGTGTGAGCCAGG - Intergenic
972503221 4:39697232-39697254 CAGGGGACTCGGGGTGGGGGAGG - Intergenic
973816734 4:54626243-54626265 CAGGGACCTGCGGGTGAGGTGGG + Intergenic
974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG + Intronic
974270674 4:59647183-59647205 CTGTAGCCTCAGGGTGAGGTGGG + Intergenic
974935809 4:68408717-68408739 CAGGAGGCTCAGGCTGAGGCAGG - Intergenic
977213310 4:94246606-94246628 GGTGGGCCTCAGAGTGAGGATGG + Intronic
978018455 4:103778475-103778497 TAGGGCCCTCTGGGTGAAGAGGG + Intergenic
981847078 4:149181818-149181840 CAGGGCCTTCAGGGTGTGGGGGG + Intergenic
985118581 4:186616462-186616484 CTGGGGCCAGAGGGTGAGAAGGG - Intronic
985732433 5:1556694-1556716 GTGGGGCTACAGGGTGAGGAGGG + Intergenic
985773010 5:1824821-1824843 CAAGGGCCTGAGGGTGGGGAGGG + Intergenic
985851270 5:2390632-2390654 CCTGGGCCACAGGGGGAGGAAGG + Intergenic
989498966 5:42143514-42143536 TAAGGGCCTCGGGGTAAGGAAGG + Intergenic
989674699 5:43960108-43960130 CCGGGGCCTCAGGGGGTGGGGGG - Intergenic
990061215 5:51651241-51651263 CTGGGTCCTTAGGCTGAGGAGGG + Intergenic
990544357 5:56807577-56807599 CAGGGGCCTCTGTGAGGGGAAGG - Intergenic
990843928 5:60115329-60115351 CAGAGACCTCATGATGAGGAAGG - Intronic
990943460 5:61227060-61227082 CAGGGACCACAGGGTGAGAGAGG - Intergenic
992189873 5:74281282-74281304 CTGGGCCATCAAGGTGAGGAGGG - Intergenic
992477561 5:77118444-77118466 CAGAGTACTCTGGGTGAGGAGGG + Intergenic
993691345 5:91004746-91004768 CTGGGGCTTCAGGGGGAGAATGG + Intronic
996200956 5:120672408-120672430 CAGGAGCCTCCTGGTGTGGATGG + Intronic
997277802 5:132612330-132612352 CAGGGGGCTAGAGGTGAGGAAGG + Intronic
997366356 5:133327671-133327693 TAAGGGCTTCAGGGGGAGGAGGG + Intronic
998105951 5:139469362-139469384 CAGGGGCTTCAGGGTCAGCCAGG + Intergenic
999329443 5:150662605-150662627 CAGGGGCATCCGGGTGGGGCAGG - Intronic
999687664 5:154117195-154117217 CAGGGGACCCATGCTGAGGAGGG + Intronic
1001321617 5:170687018-170687040 CAGGGAACTCAGGGGGAGAATGG - Intronic
1001639028 5:173232470-173232492 CAGGGGACTCAGGGTCATGTTGG + Exonic
1001799616 5:174531607-174531629 CAGGGGCTGGAGGGTGGGGAAGG + Intergenic
1002321517 5:178378729-178378751 CACCTGCCTCAGGGTGAGGAAGG + Intronic
1002428354 5:179188775-179188797 CAGATGCCTCAGGGTGGGGACGG + Intronic
1002606968 5:180389343-180389365 GAGGGGCCTCAGAGAGAGGGTGG - Intergenic
1003235480 6:4291784-4291806 CAGGGGCCACTGGGTCAGGAAGG + Intergenic
1004014552 6:11720161-11720183 AAGGGGGCTCAGGCTGTGGAAGG + Intronic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1005573394 6:27168923-27168945 CAGGCGCCTCATGGTGAGAGAGG - Intergenic
1005735087 6:28738245-28738267 CAGGGGCGTAAGGGAGAGTAGGG + Intergenic
1005983701 6:30856879-30856901 CTGTGGCCTCAGGTTGAGGTGGG - Intergenic
1006118995 6:31792638-31792660 CAGGGTCCTGCGGGAGAGGAGGG - Intronic
1006188384 6:32192797-32192819 GAGGGGGCTCATGGTGGGGAAGG + Exonic
1006312324 6:33269575-33269597 AAGGGGCCTCATGGTGAAGATGG + Intronic
1006441952 6:34058585-34058607 GAGGGGATTCAGGGTGAGGCAGG + Intronic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1007076928 6:39074134-39074156 CCTGGGCCTCAAGGTGGGGAGGG + Intronic
1007655735 6:43450068-43450090 CAGGGACCTCCGAGTGAGGCAGG - Exonic
1007698033 6:43746316-43746338 CAGTGGTCTCTGGGGGAGGAGGG + Intergenic
1008043532 6:46828426-46828448 CACGTGCCTCAGTGTGAGGCAGG + Intronic
1008365869 6:50678957-50678979 CAGGAGGCTCAGGGGGAGGATGG + Intergenic
1009937615 6:70252145-70252167 CAGGGGCCTCCAGGAGAGGTGGG - Exonic
1011633806 6:89352506-89352528 CTGGGGCCCCTGGGCGAGGAGGG - Intronic
1013793455 6:113859579-113859601 CAGGGGCCTTAGGGGGAAGCGGG + Intronic
1014140699 6:117938844-117938866 CAGGGGCCTGAGGGCGGGGGAGG - Intronic
1015221850 6:130813270-130813292 CAGGGTCTTCAGGGAGATGAGGG - Intergenic
1015352668 6:132241194-132241216 CAGGGGCCTCAGTTGGAAGACGG + Intergenic
1018379017 6:163240741-163240763 CAGCGCCCCGAGGGTGAGGACGG - Intronic
1018612709 6:165660945-165660967 GAGGGGGAGCAGGGTGAGGACGG - Intronic
1018727652 6:166626605-166626627 CAGGGAGCCCCGGGTGAGGAGGG - Intronic
1018736392 6:166689929-166689951 CAGAGGCCTCCTGGTGAGGTGGG - Intronic
1018923007 6:168188786-168188808 CAGTGTCCTCAGTGGGAGGATGG + Intergenic
1019414814 7:922320-922342 CCAGGGCCTCAGGGTCAGGTGGG + Intronic
1019560010 7:1651215-1651237 CTGGGTCCTCAGGCCGAGGATGG + Intergenic
1019788878 7:2997424-2997446 CAGGGGAGGCAGGGCGAGGATGG + Intronic
1019922355 7:4171154-4171176 CAGTGGCCACAGGGTGTGGACGG + Intronic
1020512994 7:9082917-9082939 CAGGGGTCTGATGGTGAAGAAGG + Intergenic
1023116194 7:36864945-36864967 CAGGGGCCTCAGGGCATGGAAGG - Intronic
1023907298 7:44531720-44531742 CAGGGGCCTAAGGGTTGAGAAGG + Intronic
1023926926 7:44676062-44676084 CAGCGGCCTCAAGGTGGGAAGGG - Exonic
1023982928 7:45080168-45080190 GAGGGGACACAGGGTGATGAAGG + Intergenic
1025988937 7:66480082-66480104 CAGGAGGCTGAGGCTGAGGAAGG + Intergenic
1026390972 7:69901273-69901295 CGGGGGCCTGAGGGAGAGGGGGG - Intronic
1026731416 7:72914912-72914934 CAGGTGGGTCAGGGTGGGGAGGG - Intronic
1026940911 7:74287517-74287539 GAGGGGACTCAGGGTGGAGAGGG - Intergenic
1027112624 7:75452911-75452933 CAGGTGGGTCAGGGTGGGGAGGG + Intronic
1029101579 7:98135415-98135437 CAGGAGCCTGAGTGGGAGGATGG - Intronic
1029413980 7:100431534-100431556 CCGGGGGCAGAGGGTGAGGAAGG + Exonic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1029514942 7:101018389-101018411 GGGTGGCCCCAGGGTGAGGAGGG - Intronic
1029521961 7:101068539-101068561 CAGGAGCCTGAGGGTGAGCCCGG + Intergenic
1031074354 7:117198706-117198728 CAGGTGCAACAGGGAGAGGAAGG - Intronic
1032083389 7:128870907-128870929 CAAGGGTCTCAGGTTGGGGATGG - Intronic
1032248689 7:130234332-130234354 AAGGGGCCCCAGGTGGAGGAGGG + Intergenic
1032364308 7:131285061-131285083 CAGAAGCTGCAGGGTGAGGATGG + Intronic
1033831733 7:145263035-145263057 CCTGGGCCTGAGGGTGAAGAAGG - Intergenic
1034213178 7:149382844-149382866 CGGGGGCCAGACGGTGAGGAGGG - Intergenic
1034248240 7:149665730-149665752 CAGGGGCCTCAGGAGGTGAAAGG - Intergenic
1034467719 7:151239614-151239636 CCGGGACCTCAAGGTGAAGAGGG - Exonic
1034746434 7:153527752-153527774 CAGGGGCCTCAGGGGAAGCCTGG + Intergenic
1035176605 7:157056356-157056378 TAGGGGCCTCTTGGGGAGGAGGG + Intergenic
1035446089 7:158944191-158944213 CAGGGCCCTCAGGGCCAGCACGG + Intronic
1035563523 8:626730-626752 CCAGGGGCTCAGGATGAGGATGG - Intronic
1035820799 8:2589485-2589507 CAGAGGCCTGAGTGTGAGGACGG - Intergenic
1037887512 8:22602596-22602618 CAGGGGGCTCAGGGTGGTGGTGG - Exonic
1037905445 8:22713597-22713619 CAGGGGCCTGAGAGGGAGGCCGG + Intronic
1037914733 8:22766130-22766152 CTGTGGCGTGAGGGTGAGGAAGG - Intronic
1038047518 8:23778324-23778346 CAGGGAACTCTGGGTGAAGAAGG + Intergenic
1038885824 8:31662049-31662071 AATGGGCCTCAGGGAGAAGAAGG + Intronic
1039610108 8:38912984-38913006 CAGGGGCCTCACGGTGGGAGAGG - Intronic
1040298374 8:46175075-46175097 CTGGGGCCTCAGGGCGACGTGGG + Intergenic
1040342236 8:46446887-46446909 ATGGGGCCACAGGGTGATGAGGG - Intergenic
1040888848 8:52294419-52294441 GAGGGGCCTCACAGTGAGGGAGG - Intronic
1041650231 8:60294990-60295012 CAAGGGGGTCAGGGTAAGGAGGG - Intergenic
1043846255 8:85167408-85167430 CCGGGGCCTATGGGGGAGGAGGG + Intergenic
1043927472 8:86053474-86053496 CCTGGGGCTCATGGTGAGGAGGG - Intronic
1045420514 8:102010071-102010093 AAGGGGCCCCAGGTTGGGGAGGG + Intronic
1046514755 8:115244009-115244031 CAGGGGTCTCAGGGTAAGATAGG - Intergenic
1047300450 8:123609417-123609439 CAGGGTCCTCAGGGAGGGAAGGG + Intergenic
1047725429 8:127679950-127679972 AAGAGGACTCAGGGTGGGGAAGG + Intergenic
1047773563 8:128049972-128049994 CAAGGGCTTCAGGGTGGGCAAGG + Intergenic
1049238447 8:141524545-141524567 CAGAGGCCCCAGGGAAAGGAGGG + Intergenic
1049276133 8:141721003-141721025 CGGGGGCCTCCGGGTGCTGACGG - Intergenic
1049333536 8:142069111-142069133 CAGAGGCCGCAGGGTGGGCAGGG + Intergenic
1049462101 8:142735023-142735045 CAGAGGCCTCAGGGTGACAGGGG - Intronic
1049587431 8:143438564-143438586 CAGAGGCCCCAGGGTGAGGCGGG + Intronic
1049624067 8:143612292-143612314 CAGAGCCCTCAGGCTGAGGCAGG + Intergenic
1049675882 8:143888821-143888843 CTGTGGCCTGAGGGTGGGGAGGG + Intergenic
1049718635 8:144105354-144105376 CAGCAGCCCCAGGGTGAGCAGGG + Intronic
1049747414 8:144268874-144268896 GGGGGCCCTGAGGGTGAGGAGGG + Intronic
1049800264 8:144514409-144514431 CATGGGCCTAGGGGTGAGGGAGG - Intronic
1049803884 8:144530290-144530312 CAGGGGCCTGGGGGAGTGGAGGG + Exonic
1049845174 8:144797280-144797302 CAGGGGAAACTGGGTGAGGAGGG - Intergenic
1053138207 9:35664976-35664998 CAGGGACCCCAGGGTGTGGGAGG - Intronic
1053274227 9:36771146-36771168 CAGGGGGCACATGGTGGGGAAGG - Intergenic
1054155218 9:61635096-61635118 AAGGGGCCACAGGATGAGGTGGG - Intergenic
1055599206 9:77897775-77897797 CAGGGGCCACAATGTGAGGCTGG + Intronic
1056081902 9:83103742-83103764 CAGGGGTCTAAGGAAGAGGATGG - Intergenic
1056554190 9:87675641-87675663 CTGGAGCCTCAGGGTCAGGATGG + Intronic
1056711705 9:88996851-88996873 CAGGAGCCTCAGGGCGGGGTGGG + Exonic
1057318245 9:93986441-93986463 CAGGGGACTCAGGATGATTAAGG - Intergenic
1058146345 9:101416066-101416088 CAGGGCCCTCAGGGGGAGGGGGG - Intergenic
1058429777 9:104907806-104907828 CTCGGGCTTGAGGGTGAGGACGG - Intronic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059283863 9:113156403-113156425 CACGGGGCTCAGGGTGGAGAGGG - Intronic
1059438079 9:114288452-114288474 CAGGGGGAGCAGGGCGAGGACGG + Exonic
1059465402 9:114466257-114466279 CAGCGGGCTCAAGGTGAGGGAGG - Exonic
1059714707 9:116903191-116903213 CAGGGGCTTAAGAGTGATGATGG - Intronic
1060055335 9:120408315-120408337 CAGTAGCCTCAAGGTGAGAAGGG + Intronic
1060395100 9:123310757-123310779 CAGGGGACTGAGGCTGAGGCAGG - Intergenic
1060747314 9:126146148-126146170 CAGGGACCTGAGGCTGAGGCTGG - Intergenic
1060903064 9:127278761-127278783 CACGGCCCTCAGAGGGAGGATGG - Intronic
1060966129 9:127713217-127713239 CAGGGGCCCCAGGGAAAGCAAGG + Intronic
1061132036 9:128713679-128713701 CTGGGGCGTCAGGGCCAGGAAGG + Intronic
1061234416 9:129334323-129334345 CAGAGCCTTCAGGGGGAGGAAGG - Intergenic
1061316732 9:129801089-129801111 CAGAGGCCTGTGGGTGGGGAGGG - Intergenic
1061321235 9:129831084-129831106 CAGAGGCCTCAGGGAGGGGTGGG + Intronic
1061408670 9:130406402-130406424 CAGAGACCTCAGGGCCAGGAAGG + Intronic
1061423518 9:130485012-130485034 CTGGGGGCTCAGGAAGAGGAGGG + Intronic
1061472099 9:130835153-130835175 CAGGGGCCCCTGGGTGCGGACGG + Intronic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062191157 9:135248526-135248548 CAAGGGCTTCAGGGAGAGGCAGG + Intergenic
1062262129 9:135667974-135667996 CAGGGGCCTCAGGTGGACAAAGG + Intergenic
1062485885 9:136775407-136775429 CAGGGGCCTCTGGGTGGCCAAGG + Intergenic
1062572804 9:137193390-137193412 GAGGGGCAGCAGGGTGAGGAAGG - Intronic
1185927538 X:4163927-4163949 CAGAGGCTGAAGGGTGAGGAGGG + Intergenic
1187427120 X:19188039-19188061 AAGGGGCCCCAGGTGGAGGAGGG - Intergenic
1189304356 X:39975519-39975541 CCAGGGCCTCAGCGCGAGGATGG - Intergenic
1190264287 X:48818124-48818146 CAGGGGCCGCAGTGTGATCAGGG + Intronic
1190327791 X:49217507-49217529 CTGGGGGCTCAGGGTGGGAATGG + Intronic
1190547595 X:51544998-51545020 TTGGGGCCTCAGGGTTGGGAAGG - Intergenic
1192034134 X:67545408-67545430 CAGCAGCAGCAGGGTGAGGATGG + Exonic
1192194591 X:69019677-69019699 CAGGGACATCAGGGAGGGGAGGG + Intergenic
1192238687 X:69313163-69313185 CAGAGGCCTTAGAGTGAGGGAGG - Intergenic
1192318231 X:70067863-70067885 CAGGGGGCACAGGCTGGGGAGGG + Intergenic
1193659373 X:84238338-84238360 CTGGGGACTCAGGGGAAGGATGG + Intergenic
1194224968 X:91245094-91245116 GAGGGGCCACAGGGTGAAGGAGG - Intergenic
1194225304 X:91249246-91249268 GAGGGGCCACAGGGTGAAGGAGG + Intergenic
1194279828 X:91936101-91936123 TAGGGGGCTCTGGCTGAGGAGGG + Intronic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195794245 X:108626206-108626228 ACAGGGCCTCAGGGTGTGGAAGG + Exonic
1197812857 X:130463537-130463559 CTGGGGGCTGAGGGTGGGGATGG - Intergenic
1199950980 X:152706139-152706161 CAGGGGCCTGAGGGAGAGAAGGG + Intergenic
1199953277 X:152722753-152722775 CAGGAGCCTGAGGGAGAGAAGGG + Intergenic
1199953634 X:152725337-152725359 CAGGGACCTGAGGGAGAGAAGGG + Intergenic
1199956046 X:152743113-152743135 CAGGGACCTGAGGGAGAGAAGGG - Intergenic
1199956405 X:152745697-152745719 CAGGAGCCTGAGGGAGAGAAGGG - Intergenic
1199958702 X:152762322-152762344 CAGGGGCCTGAGGGAGAGAAGGG - Intergenic
1200091523 X:153638327-153638349 CAGCAGCCTGAGGGTGGGGATGG + Intergenic
1200561432 Y:4708404-4708426 GAGGGGCCACAGGGTGAAGGAGG - Intergenic
1200597305 Y:5159581-5159603 TAGGGGGCTCTGGCTGAGGAGGG + Intronic