ID: 1163438885

View in Genome Browser
Species Human (GRCh38)
Location 19:17311596-17311618
Sequence TCTGTGAGCTTCAGCCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 263}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163438879_1163438885 22 Left 1163438879 19:17311551-17311573 CCTGGCCACCTCTATGACCTTAT 0: 1
1: 0
2: 2
3: 23
4: 223
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263
1163438880_1163438885 17 Left 1163438880 19:17311556-17311578 CCACCTCTATGACCTTATCTCCA 0: 1
1: 1
2: 3
3: 34
4: 476
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263
1163438877_1163438885 24 Left 1163438877 19:17311549-17311571 CCCCTGGCCACCTCTATGACCTT 0: 1
1: 0
2: 3
3: 65
4: 478
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263
1163438878_1163438885 23 Left 1163438878 19:17311550-17311572 CCCTGGCCACCTCTATGACCTTA No data
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263
1163438883_1163438885 -3 Left 1163438883 19:17311576-17311598 CCACTCTCTTCTCCACTCTGTCT 0: 1
1: 0
2: 15
3: 180
4: 1348
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263
1163438882_1163438885 5 Left 1163438882 19:17311568-17311590 CCTTATCTCCACTCTCTTCTCCA 0: 1
1: 0
2: 4
3: 74
4: 759
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263
1163438881_1163438885 14 Left 1163438881 19:17311559-17311581 CCTCTATGACCTTATCTCCACTC 0: 1
1: 0
2: 2
3: 38
4: 375
Right 1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163438885 Original CRISPR TCTGTGAGCTTCAGCCACCC TGG Intronic
900895799 1:5482131-5482153 TCTGTTGGCCTCAGACACCCTGG + Intergenic
901141548 1:7036839-7036861 GCTGTGAGCTTCAGCCAGGCAGG + Intronic
901702485 1:11053121-11053143 TCTGTGACCTGCAGCCACGCAGG - Intergenic
902684392 1:18066569-18066591 TCTGTGAGCAAAAACCACCCAGG + Intergenic
902927614 1:19707121-19707143 TCTCTGTGCTCCAGCCACACTGG + Intronic
903605578 1:24572915-24572937 TCTCTGAGCCTCAGTGACCCTGG + Intronic
903674844 1:25056965-25056987 TCAGTGAGCTGCAGGCACCCCGG + Intergenic
903953347 1:27009281-27009303 CCTGTGAGCTTCAGTTTCCCAGG - Intronic
904634843 1:31871954-31871976 TCACTGAGCTTCAGCCACACTGG - Intergenic
905248220 1:36629311-36629333 TCTGTGAGCTCCAAGCACTCAGG - Intergenic
905268852 1:36773498-36773520 GCTGTGAGATCCAGCGACCCCGG - Intergenic
905731121 1:40300134-40300156 TCTGTGAGTTTCAGCACCCACGG - Intergenic
905937959 1:41839728-41839750 TCTGTGACATACAGCCAGCCAGG - Intronic
905951020 1:41950611-41950633 GCTGTGAGCTACTGCCACCTGGG + Intronic
907273821 1:53305955-53305977 TGTGTGCGCCTCAGACACCCTGG - Intronic
907533139 1:55122343-55122365 TCACTGTGCTTCGGCCACCCTGG - Intronic
907849091 1:58236723-58236745 GGTTTGAGCTTCAGCCTCCCAGG - Intronic
908000825 1:59677261-59677283 TCTTTGAACTTCAGGGACCCTGG + Intronic
909484069 1:76154557-76154579 TCTGTGAGCGTCAAAAACCCTGG - Intronic
911337841 1:96602492-96602514 TCTGTTAGCTTCAGACATCCTGG - Intergenic
913472878 1:119207424-119207446 CCTGTGAGCTTCAGCTGCCTTGG + Intergenic
913683834 1:121213151-121213173 TTTTTGTGCCTCAGCCACCCCGG + Intronic
914035673 1:144000766-144000788 TTTTTGTGCCTCAGCCACCCCGG + Intergenic
914153782 1:145067179-145067201 TTTTTGTGCCTCAGCCACCCCGG - Intronic
914710520 1:150208830-150208852 TTTTTGTGCCTCAGCCACCCGGG - Intergenic
915986630 1:160472374-160472396 TCTCTCAGCTCCAGCCACACTGG - Intergenic
916223587 1:162466984-162467006 TCACTCAGCCTCAGCCACCCTGG + Intergenic
917355265 1:174120710-174120732 TCTCTGTACTTCAGCCACACTGG - Intergenic
917735745 1:177918502-177918524 TCTCTGAGCAACAGCCATCCAGG + Intergenic
919757711 1:201076184-201076206 TCACTGTGCTTCACCCACCCAGG + Intronic
920471140 1:206231643-206231665 TTTTTGTGCCTCAGCCACCCCGG + Intronic
921639215 1:217532246-217532268 TCTGAGAGTTTCTGCCACCTAGG - Intronic
922235346 1:223718231-223718253 TCTGTGAGGTTCAGGAACCAGGG + Intronic
923152367 1:231244975-231244997 TCACTGGGCTTTAGCCACCCTGG + Intronic
1063054145 10:2484752-2484774 TCTGTGGGATTCAGCCTCCCTGG + Intergenic
1064023876 10:11831037-11831059 TGTGTGAGCTTCTTCCACCCTGG + Intronic
1069967758 10:72135570-72135592 CCTGAGAGCTTCAGCTAACCTGG - Intronic
1070165453 10:73894228-73894250 ATGGGGAGCTTCAGCCACCCAGG - Intergenic
1070183785 10:74039946-74039968 TCCCTGAGGTTCAGCCACTCTGG + Intronic
1070778991 10:79126740-79126762 CCTCTGAGCTTCAGGCACCTGGG + Intronic
1072167524 10:92828574-92828596 TCTGCCAGCCTCAGCCTCCCAGG + Intergenic
1073266673 10:102231798-102231820 TCTGTGACCTGCCCCCACCCTGG - Intronic
1073724398 10:106212807-106212829 TCACTGAGCTTCAACCACACTGG - Intergenic
1075477114 10:122745528-122745550 TCTGTCAGCTTCCACCACCCCGG + Intergenic
1076174319 10:128355466-128355488 TCTGTGGCTTTCAGCCACACTGG + Intergenic
1077369227 11:2173817-2173839 CCCGTGAGCTTCTGTCACCCAGG + Intergenic
1078097592 11:8310240-8310262 GTTGTGGGCTTCAGCCTCCCTGG + Intergenic
1079309459 11:19351552-19351574 TCTGAAAGCTGCAGTCACCCAGG + Intronic
1080172871 11:29327334-29327356 TCTCTGTGCTCTAGCCACCCTGG - Intergenic
1081767494 11:45621672-45621694 TCTGAGAGCCTCACCCTCCCAGG - Intergenic
1083425888 11:62585587-62585609 TCTGTCCGCCTCAGCCTCCCAGG - Intronic
1083454123 11:62766815-62766837 TCTACTAGCCTCAGCCACCCAGG + Intergenic
1083878414 11:65536789-65536811 GCTGAGAGCTGCAGGCACCCAGG + Intronic
1084657786 11:70529056-70529078 TCAGTGGGGTTCAGACACCCTGG + Intronic
1084704609 11:70808824-70808846 ACTGTGAGCGTCAGTCACACTGG + Intronic
1084853003 11:71959163-71959185 TCTGTCAGATTCTCCCACCCAGG + Intronic
1085834865 11:79942301-79942323 TCTGTGAGCTCTATCCACCTTGG - Intergenic
1088908085 11:114169910-114169932 TCTGTGAGCTAGAACCATCCAGG + Intronic
1090832131 11:130427356-130427378 TTTCTGAACTTCTGCCACCCTGG - Intronic
1090892503 11:130937540-130937562 TCTGTGAACTGCAGCCATCTTGG + Intergenic
1091290532 11:134437019-134437041 GCTGCAAGCTACAGCCACCCTGG - Intergenic
1091998865 12:5017100-5017122 TCTGTGAGCATCAACAATCCGGG + Intergenic
1092095880 12:5841599-5841621 TCTCTGAGCTGCTCCCACCCTGG + Intronic
1092644858 12:10559401-10559423 TCTGTGAGCTAAAACCACACAGG + Intergenic
1094524359 12:31221924-31221946 TCTCTGCGCTGCAGCCACACTGG + Intergenic
1094839199 12:34335894-34335916 CCTGTGAGGTCCAGCCACTCCGG - Intergenic
1095497803 12:42803585-42803607 TCTGGGAGGTACTGCCACCCAGG - Intergenic
1096409645 12:51367919-51367941 CCTTTGTGCTTCTGCCACCCTGG - Intronic
1098157744 12:67617817-67617839 TCTCTCTGCTCCAGCCACCCTGG + Intergenic
1098287168 12:68919015-68919037 TCACTGGGCTCCAGCCACCCTGG + Intronic
1102430439 12:112879105-112879127 TCTGCCCCCTTCAGCCACCCTGG + Exonic
1102444454 12:112991083-112991105 TCTCTATGCTTCAGCCACTCTGG + Intronic
1102524080 12:113498941-113498963 TCTGTGAGTAGCAGGCACCCAGG - Intergenic
1103031100 12:117613552-117613574 TCTGTGAGCTACTGCCACATGGG + Intronic
1103143720 12:118575360-118575382 CCTGTGAGCTTCAGTCAAGCTGG - Intergenic
1103447151 12:121001803-121001825 CCTGTTAGCTTCGGCCTCCCTGG - Exonic
1103915740 12:124374740-124374762 AAAGTGAGCTTCAGCCACTCTGG + Intronic
1104004323 12:124881494-124881516 TCTCTGGGATGCAGCCACCCTGG + Intronic
1104156905 12:126142263-126142285 TCTGAGAGCCACAGCAACCCTGG - Intergenic
1106223008 13:27762502-27762524 TCTGTGAACTCCAGCTACCTTGG - Intergenic
1106435889 13:29722496-29722518 TCTGTGAACTCCAGGCAGCCAGG - Intergenic
1108222759 13:48254041-48254063 TCTGTGACCTTCAGCCAGAGTGG + Intronic
1108404152 13:50082666-50082688 TCTGTCAGATTCAGCAGCCCTGG + Intronic
1108596426 13:51954020-51954042 ACTCTGTGCCTCAGCCACCCTGG - Intronic
1108721882 13:53140593-53140615 TCTGTTATTTTCAGCCACCCAGG - Intergenic
1109121994 13:58469377-58469399 TCTCTGTACTTCAGCCACACTGG - Intergenic
1110355563 13:74562814-74562836 TCTGTGGCCTTCAGCCCACCTGG + Intergenic
1111798147 13:92949590-92949612 TCTCTGAGCTAGAACCACCCAGG + Intergenic
1113792445 13:113036188-113036210 TCTGTGAGCTTCTGCAACACTGG - Intronic
1115002963 14:28443441-28443463 TCTGTGAGCTGCTGCTACTCTGG - Intergenic
1115767445 14:36637945-36637967 TCTTTCAGCTCCAGCCACCATGG + Intergenic
1117272649 14:54160757-54160779 CCTGAGAACTCCAGCCACCCTGG + Intergenic
1118837391 14:69486495-69486517 TATGTGAGCTACAGCCCCCAGGG + Intronic
1119545256 14:75467361-75467383 TGTGTGACCAACAGCCACCCAGG - Intronic
1120241765 14:81958114-81958136 TCTGTAAGCTTCAGCCAACCTGG + Intergenic
1122227837 14:100290216-100290238 CCTGAGAGATTCAGCCACCCAGG + Intergenic
1122280700 14:100620618-100620640 TCTCTGTGCTCCAGACACCCTGG - Intergenic
1122929107 14:104925345-104925367 TCTCTCAGCTTGAGCCAACCTGG + Intronic
1124376334 15:29131504-29131526 TGTGGGAGCTTCAGCACCCCAGG - Intronic
1125548166 15:40524230-40524252 TCTGCAAGCTCCAGCCTCCCAGG + Intergenic
1126313679 15:47344579-47344601 CCTGAGAACTTCAGCCACCTTGG - Intronic
1127363162 15:58262753-58262775 TCTGTGATCTTCACCCACTGGGG - Intronic
1127412018 15:58718827-58718849 TCTGTGAACTCCAGCCACTTTGG + Intronic
1128328432 15:66740259-66740281 TCTTTGAGCTTCTGCAGCCCTGG + Intronic
1128837097 15:70817991-70818013 TCTTTGAGCTCCAGCCACACTGG + Intergenic
1129231686 15:74200578-74200600 TCTGTGTGAGTCAGACACCCTGG - Intronic
1132831587 16:1930747-1930769 TCCCTGAGCCTCAGCCTCCCAGG + Intergenic
1134129604 16:11640307-11640329 TCTCTGAGCTTCAGTTTCCCAGG - Intergenic
1135080249 16:19427974-19427996 CCTGTGAGCTTCACCCACCTTGG + Intronic
1135485645 16:22862505-22862527 CATGTGAGCTTCACCCGCCCTGG + Intronic
1135548462 16:23380818-23380840 TCAGTGAGTTTCAGCCGCCCGGG - Exonic
1135987324 16:27193577-27193599 TCTGGGAGCTCCATCCAACCTGG - Intergenic
1137763309 16:50958088-50958110 TCTGTGACCTGCACCCCCCCGGG - Intergenic
1137816557 16:51403617-51403639 TCTCTGTGCTCCAGCCACACTGG + Intergenic
1137996511 16:53220746-53220768 TCTGTGATCTTCACCCATTCTGG + Intronic
1139928155 16:70503481-70503503 TCTTTGAACTTCAGCTACACTGG + Intronic
1140650651 16:77084390-77084412 GCTTTCTGCTTCAGCCACCCTGG - Intergenic
1141899043 16:86978494-86978516 GCTGTTTGCTTAAGCCACCCAGG - Intergenic
1142221774 16:88858521-88858543 GCCGTGACCTGCAGCCACCCGGG - Intronic
1142242182 16:88952600-88952622 TCTCTGAGCTCCAGCCTCACAGG + Intronic
1142483892 17:234652-234674 TCTGCAAGCTCCAGCCCCCCCGG + Intronic
1142596039 17:1030504-1030526 TGTGTCACCTTCAGCCTCCCTGG - Intronic
1142815109 17:2419296-2419318 TCTGTGTGCCTCAGTCACACCGG + Exonic
1143554589 17:7652244-7652266 TTTGTGTGCATCAGCCAGCCAGG + Intronic
1146577358 17:34006336-34006358 ACTCTGGGCTGCAGCCACCCTGG - Intronic
1147978634 17:44261700-44261722 ACTGTGAGCCTCAGAGACCCAGG + Intronic
1150686183 17:67322718-67322740 TCTGCCAGCCTCAGCCTCCCAGG + Intergenic
1151147355 17:72053555-72053577 CCTATGAGCTCCAGCCACCGGGG + Intergenic
1151662067 17:75524541-75524563 TCTGTGAGTATCAGACACCCAGG - Exonic
1153061610 18:1000881-1000903 TCTTGGAGCTCCAGCCACACTGG - Intergenic
1153466455 18:5393656-5393678 TCCATGAGCTTCAGCCACTTGGG - Intronic
1155142962 18:23059833-23059855 TCTGTGAGCAAAAGCCACCTAGG + Intergenic
1155527915 18:26736020-26736042 TCTGTGCACTCCAGCCACACTGG + Intergenic
1157133764 18:45034128-45034150 TCTGTGACCTTGAGCAACCTGGG + Intronic
1160449311 18:78951438-78951460 TCTGTCGGCCTCGGCCACCCTGG - Intergenic
1160705656 19:529015-529037 GCTGTGAGCCTGAGCCTCCCTGG + Intergenic
1161675125 19:5642418-5642440 TCTGTCAGACTCTGCCACCCAGG - Intronic
1161726003 19:5929419-5929441 TCTGTGGGCTCCACCCACCCGGG - Intronic
1162372790 19:10289264-10289286 TGTGTGAGCTCGAGCCACCCTGG - Intergenic
1163160068 19:15458898-15458920 TTTCTGAGCTCCAGCCTCCCTGG + Intronic
1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG + Intronic
1163792958 19:19318973-19318995 TCTGCCTGCTTCAGCCTCCCAGG - Intronic
1165378417 19:35460318-35460340 TCACTAAGCTGCAGCCACCCTGG - Intergenic
1165402452 19:35610459-35610481 ACTGTGAGGTTCAGGCACCTGGG + Intergenic
1166225026 19:41389729-41389751 CCTCTGCCCTTCAGCCACCCTGG + Intronic
1167272542 19:48513947-48513969 TCTGTGCCCTTCAGCCACCCGGG - Intergenic
1167586479 19:50378342-50378364 TCTGGCAGGTTCCGCCACCCCGG - Exonic
925187474 2:1859051-1859073 TCACTAAGCTTCAGCCACTCTGG + Intronic
925406231 2:3606847-3606869 TCTTTGACCTCCAGCGACCCTGG - Intronic
926624619 2:15080808-15080830 TCTGAGAGCTCCATCCCCCCAGG - Intergenic
928884054 2:36128567-36128589 TCATTGAGTTTCAGCCACCAGGG + Intergenic
930711414 2:54554334-54554356 TCTGTGAACCTCAGCTACCTTGG + Intronic
931012590 2:57934577-57934599 TCTTTGAGCTTCATGCACCTAGG + Intronic
934584935 2:95483583-95483605 TCTGCCAGCCTCAGCCACCTCGG - Intergenic
936636447 2:114264213-114264235 TTTCTGTGCCTCAGCCACCCCGG - Intergenic
936841091 2:116770195-116770217 GCTGTTAGCTTCAGCCATCTAGG - Intergenic
937012142 2:118572288-118572310 GCTGTGGGCCTCAGCCTCCCTGG + Intergenic
937142138 2:119611075-119611097 CCTGTCAGCTTCCACCACCCAGG + Intronic
940908223 2:159187603-159187625 TCTGTGTGCTTCAGATTCCCAGG - Intronic
940913782 2:159232056-159232078 TCTGTAAGCTTCATCCATGCTGG + Exonic
941175302 2:162191112-162191134 TCTGTGTGCTTGATCCACACAGG - Intronic
942427538 2:175875968-175875990 TCACTGAGCTTCAACCTCCCAGG + Intergenic
943704515 2:191020872-191020894 GCTGTGACCCTCAGCCAGCCTGG + Intronic
944150783 2:196555899-196555921 TCTCTGTGCTTCAGCCACAGTGG + Intronic
944973062 2:205016357-205016379 TCTTCGTGCTCCAGCCACCCTGG + Intronic
946676318 2:222163424-222163446 TCTATGAACTTGAGCCAGCCTGG - Intergenic
947880105 2:233501260-233501282 TCACTGTGCTTCAGCCACACTGG - Intronic
948309770 2:236976464-236976486 TGTGTGAACTTGAGCAACCCAGG - Intergenic
948386185 2:237582375-237582397 TTGGTGACCTTAAGCCACCCAGG + Intronic
948828561 2:240586415-240586437 TCTGGGAGCTTCAGGGACCAGGG - Intergenic
1169130431 20:3163998-3164020 TCTGTCAGTTTCAGCAAACCTGG + Exonic
1169849584 20:10035003-10035025 ATTGTGAGCTTCCGCCACGCAGG - Intronic
1170957432 20:20993984-20994006 TTTATAAGCTCCAGCCACCCTGG - Intergenic
1174398888 20:50265106-50265128 CCTGTGGGCTGCAGCCACACAGG + Intergenic
1174879342 20:54261383-54261405 CCTCTGAGCTTTAGCCACCTTGG + Intergenic
1175084429 20:56446719-56446741 TCTGAGAGCTTTAGCCATCCTGG + Intronic
1175762199 20:61568821-61568843 TGCGTGAGCTGCAGCCTCCCAGG - Intronic
1176053181 20:63131257-63131279 TCCCTGAGCTGCACCCACCCTGG - Intergenic
1178242721 21:30921311-30921333 TGCTTGAGCTTCAGCCACCAAGG - Intergenic
1179163744 21:38918816-38918838 TCTGTGATCACCAGCCACCCTGG - Intergenic
1179500131 21:41803489-41803511 TCTGTGAGCCTGAGCGAGCCTGG - Intronic
1180149957 21:45942372-45942394 TCTGTGCTCTCCAGCCACCCTGG - Exonic
1181051008 22:20238264-20238286 GCTGTGAGCTGCAGGCAGCCCGG + Intergenic
1181142372 22:20815831-20815853 TCTGTGGGGTTCAGCCACACAGG - Intronic
1182757626 22:32692533-32692555 ACTGTGGGCTCCAACCACCCTGG + Intronic
1183354336 22:37350424-37350446 TCAGTGAGCTCTGGCCACCCAGG + Intergenic
1183939249 22:41283702-41283724 TCTCTGTGCTTCAGCCCCACTGG - Intronic
1184498329 22:44856755-44856777 TCGGTGATCTTCAGCCTCCCAGG - Intronic
1185293311 22:50039777-50039799 TCTGTGAGATCCATCCACACTGG - Intronic
949316709 3:2764467-2764489 TCTGTGCCCTCCAGCCACACAGG - Intronic
952235231 3:31472505-31472527 TCACTCAGCTTCAGCCACCATGG + Intergenic
954278529 3:49558682-49558704 TCTGTGAGATCCAGCCACTGGGG - Intronic
954364725 3:50139745-50139767 GCTGAGGGCTTCAGCCTCCCAGG - Intergenic
956661456 3:71602359-71602381 CCTGTGAGTTTCAGCCACCTTGG - Intergenic
957418698 3:79939731-79939753 TCTAAGAGCTGCAGCCACCAAGG - Intergenic
958802880 3:98777012-98777034 TCTGTGAGCATCAGGGACCAAGG + Intronic
958988163 3:100807743-100807765 TGTCTGAGGTTCACCCACCCAGG - Intronic
959407400 3:105977168-105977190 TCTCTGAGCTCTAGCCACCTTGG - Intergenic
959702730 3:109313309-109313331 TTTCTGAGCTCCAGCCACACTGG + Intronic
960658162 3:120028904-120028926 TCTTTGAGGTTCAGCCTTCCTGG - Intronic
961474091 3:127136205-127136227 TCTGCCAACTTCAGGCACCCAGG - Intergenic
962114035 3:132483023-132483045 CCTCTGATCTTCAGCCTCCCAGG + Intronic
962465380 3:135652610-135652632 TCAGTTAACATCAGCCACCCAGG - Intergenic
963929092 3:150983271-150983293 TCTCTGAACTTCAGTCTCCCAGG + Intergenic
966370285 3:179244547-179244569 TTTGTGAACCTCAGCCATCCAGG - Exonic
966809436 3:183830280-183830302 TCTCTGTGCGTCAGCCTCCCAGG - Intronic
968406000 4:339244-339266 TCTGTTTTCTTCACCCACCCAGG + Intronic
968712306 4:2127674-2127696 TCTGTGAGTGTAAGCCACTCAGG + Intronic
969040194 4:4289986-4290008 TCTCTGAGCCCCAGCCTCCCAGG + Intronic
969275915 4:6135717-6135739 TCTGAGAGCCACAGCCAGCCTGG + Intronic
969374636 4:6755236-6755258 TCTGTGAGCTCCACCCACCCTGG + Intergenic
969653194 4:8479955-8479977 ACAGTGAGCCTCAGCCTCCCGGG + Intronic
970614460 4:17754966-17754988 TGGGTTAGCTTCAGCCTCCCTGG + Intronic
972314644 4:37914739-37914761 TCTCTGGACTCCAGCCACCCTGG + Intronic
974039728 4:56847021-56847043 TCTGCAAGCTTCTGCCTCCCAGG - Intergenic
975448027 4:74490483-74490505 TCACTGCGCTTCAGCCACACTGG + Intergenic
978571686 4:110144961-110144983 TCTGTGAGCTTAAGCCAAAAAGG - Intronic
978779199 4:112532250-112532272 TCTGTGTCCTCCAGCCTCCCAGG - Intergenic
980274830 4:130636312-130636334 TGTGTAAGCTACAGCCACCTAGG - Intergenic
981297525 4:143149170-143149192 TCTGTGTACTTCAGCCACACTGG - Intergenic
982122779 4:152158475-152158497 GCTCTGGGCTGCAGCCACCCTGG - Intergenic
982589869 4:157294678-157294700 TCTTTGATGTTCAGCCACACAGG + Intronic
984887000 4:184457976-184457998 TCTGTTTGTTCCAGCCACCCTGG + Intronic
985083918 4:186293740-186293762 TCTGGGCTATTCAGCCACCCTGG - Intergenic
985433075 4:189900268-189900290 TTTGTGATCTTCAGCCAGCACGG + Intergenic
985489287 5:169829-169851 TCTGTGAGCCTCCGCCTCCAGGG - Intronic
985689690 5:1300239-1300261 GCTGTCAGCCTCAGCCTCCCAGG + Intergenic
993145475 5:84087979-84088001 TCTGTGAGTTCCAGCCACATGGG - Intronic
995060434 5:107807176-107807198 TCCCTGAGATCCAGCCACCCTGG - Intergenic
995784804 5:115816655-115816677 TCTGTGGGGTTCATCCTCCCGGG + Exonic
995910936 5:117185501-117185523 TCTGTGATCTTCATCCCCCATGG + Intergenic
995943093 5:117608646-117608668 TCTCTGAGCAGCAGCCACCCTGG + Intergenic
997334274 5:133093966-133093988 GCTGGTAGCTCCAGCCACCCAGG + Intronic
997711440 5:136008220-136008242 TCTGTGCTCTTCAGCCACTCTGG - Intergenic
998218760 5:140258030-140258052 TCTCTGTGCTTCAGTCTCCCTGG - Intronic
999176032 5:149632300-149632322 TGAGTGTGCTTCACCCACCCTGG - Exonic
999239796 5:150120795-150120817 CCTATGAGCTGCAGCCACACTGG + Intronic
1000018494 5:157299330-157299352 TCGCTCCGCTTCAGCCACCCTGG + Intronic
1000350166 5:160346775-160346797 ACTGTGGGCTTCAGCAACCAGGG - Intergenic
1000442695 5:161282219-161282241 ACTCTGAGCTCCAGCCACCCTGG - Intergenic
1002380494 5:178824766-178824788 CCTCTGGCCTTCAGCCACCCAGG - Intergenic
1004774393 6:18826599-18826621 TCAATCAGCTTCAGCTACCCGGG + Intergenic
1005187961 6:23183879-23183901 TCTATGTGCTTCAGCCATCTAGG - Intergenic
1005954536 6:30654754-30654776 TCTTTGAGCAACAGCCACGCTGG - Exonic
1005996410 6:30934090-30934112 TCTGTCAGCTGCAGCCATCTAGG + Intergenic
1006440380 6:34050107-34050129 TCTCTCTGCTTCAGCCACACTGG + Intronic
1006753318 6:36393294-36393316 TCACTCAGCTTCAGCCACACTGG + Intronic
1007238982 6:40411581-40411603 ACTCTGTGCTTCAGCCACCCTGG + Intronic
1007359391 6:41344150-41344172 TCTGTGCATTTCTGCCACCCAGG + Intronic
1011457084 6:87562642-87562664 TCTGTCTGCTTCAGCCACAGTGG - Intronic
1011836623 6:91439199-91439221 TGTGTGACCTTCAGGCACTCTGG - Intergenic
1012417733 6:99027773-99027795 TCACTCAGCTGCAGCCACCCTGG - Intergenic
1013521403 6:110937032-110937054 TTTTTGAGCCTCAGCCTCCCGGG - Intergenic
1014124103 6:117758125-117758147 TCTATGAGCCTTAGACACCCAGG + Intergenic
1015903376 6:138090474-138090496 TCTGGCAGGTTCAGACACCCGGG - Exonic
1016193595 6:141303005-141303027 TCTGTGATCATGAGCAACCCTGG - Intergenic
1017542065 6:155413298-155413320 TCTCTGGGCTCCAGCCACACAGG - Intronic
1019397810 7:832044-832066 TGTGAGAGCTTCAGCCATCTAGG + Intronic
1020223450 7:6260424-6260446 TCACTGAGCTCCAGCCACTCAGG + Intronic
1022494560 7:30844731-30844753 TTTGTGCCCCTCAGCCACCCTGG + Intronic
1025624373 7:63206798-63206820 TCTGTGTTCTTTAGCCACACTGG + Intergenic
1026911242 7:74093113-74093135 CCTGTGCGCTGCAGCCACGCTGG + Intronic
1027371710 7:77513003-77513025 TGTCTGAGTTTAAGCCACCCAGG + Intergenic
1032499943 7:132392756-132392778 CCTGTGAGCCACAGCCATCCTGG + Intronic
1034899537 7:154899155-154899177 TCTGTGACCTTCAACCAGGCAGG - Intergenic
1034966308 7:155393341-155393363 TCTGTGACTTTCAGCCACCATGG + Intronic
1035291222 7:157840584-157840606 TCTGTGGGCTTCAGCCGGCTCGG - Intronic
1036411105 8:8502516-8502538 TCTCTGGGCTTCAGTCACCTAGG - Intergenic
1037322444 8:17656730-17656752 TGTGTGAGCTTCTACCACACTGG - Intronic
1037858049 8:22385595-22385617 TCACTGGGCTCCAGCCACCCAGG - Intronic
1038576891 8:28712261-28712283 TCTCTCAGCTTCAGCCACACTGG - Intronic
1039812063 8:41057938-41057960 CCTGGGACCTTGAGCCACCCAGG - Intergenic
1040881208 8:52206570-52206592 TCTGTAGGGTTCAGCCACCCCGG - Intronic
1041144342 8:54857661-54857683 TGTGTGATCTCCAGACACCCTGG + Intergenic
1042242037 8:66673784-66673806 CTTGTGTGCTTCAGCCACACTGG + Intronic
1042568331 8:70135096-70135118 CCTGTGAGCTCCAGCTACCACGG + Intronic
1043375651 8:79646622-79646644 GCTCTCAGCTTCAGCCACGCTGG - Intronic
1044438863 8:92199429-92199451 TCTGTTGTCTTAAGCCACCCAGG - Intergenic
1044496151 8:92886026-92886048 TCTTTGAGCTTCTGTCATCCAGG + Exonic
1046560217 8:115827086-115827108 TCTGCCAGCCTCAGCCACCCAGG + Intergenic
1048292478 8:133191378-133191400 CCTGCCAGCTTCAGCCAACCTGG - Intronic
1049000918 8:139825274-139825296 TCTGGGACCTGCAGCCACACTGG + Intronic
1049815813 8:144599096-144599118 TCTGTGAGCAGCACCAACCCCGG - Intronic
1056796364 9:89661556-89661578 TCTGTGAGCATCTGCCACTCTGG + Intergenic
1056973938 9:91233365-91233387 GCTGTGCACTTCAGCCACACTGG - Intronic
1059941362 9:119363015-119363037 TTTGAAAGCTTCAGCCACACTGG + Intronic
1060024587 9:120160529-120160551 TCTGTGTGATTCAGTGACCCAGG + Intergenic
1060484629 9:124039446-124039468 TCTGAGAGCTCCGGCCACACTGG - Intergenic
1061253956 9:129442879-129442901 TTTCTGTGTTTCAGCCACCCAGG + Intergenic
1061972035 9:134050172-134050194 TGTGTGACCTTCAGCTCCCCAGG + Intronic
1062024621 9:134334633-134334655 TCTGTGGGCTTCAGTTTCCCTGG + Intronic
1062434393 9:136540317-136540339 TCTGTGAACTGGAGCCACCCTGG + Intronic
1062470461 9:136701312-136701334 CCTGTGTGCTTCAGCCCACCTGG + Intergenic
1186163593 X:6803769-6803791 TCCGTGAGTTTCACACACCCTGG - Intergenic
1189221093 X:39372680-39372702 TCTGTAAGTTTCAGCCACTCTGG - Intergenic
1190894927 X:54607953-54607975 TCTCTGAGCTTCATCCACGTTGG - Intergenic
1191093888 X:56654742-56654764 TGTGGGGGCTTCAGCCACTCTGG - Intergenic
1192079405 X:68032745-68032767 GCTGTCTGCTGCAGCCACCCTGG - Intergenic
1194564486 X:95467861-95467883 CCTGTGAGTTTTAGCCACCTTGG + Intergenic
1194640599 X:96399434-96399456 TCTGTAAGCTCCAGTCACCTTGG + Intergenic
1195093496 X:101485560-101485582 TCAGTGAGCTTCTGCCGGCCTGG - Intronic
1195111730 X:101657085-101657107 TCTGGGAGCTTCTGCCACTTTGG + Exonic
1196116315 X:112003450-112003472 TCTGTGTACTCCAGCCACCCTGG - Intronic