ID: 1163441573

View in Genome Browser
Species Human (GRCh38)
Location 19:17324716-17324738
Sequence CGGCCCGAAGAGGAAGGCTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163441573_1163441586 16 Left 1163441573 19:17324716-17324738 CCTGAGCCTTCCTCTTCGGGCCG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163441586 19:17324755-17324777 TCAGCCAGGGCCTCGTCCACCGG 0: 1
1: 0
2: 1
3: 9
4: 140
1163441573_1163441583 3 Left 1163441573 19:17324716-17324738 CCTGAGCCTTCCTCTTCGGGCCG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163441583 19:17324742-17324764 GGCTTCCAGCTCCTCAGCCAGGG 0: 1
1: 0
2: 1
3: 32
4: 283
1163441573_1163441582 2 Left 1163441573 19:17324716-17324738 CCTGAGCCTTCCTCTTCGGGCCG 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163441582 19:17324741-17324763 GGGCTTCCAGCTCCTCAGCCAGG 0: 1
1: 1
2: 2
3: 42
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163441573 Original CRISPR CGGCCCGAAGAGGAAGGCTC AGG (reversed) Exonic
902916135 1:19640821-19640843 CGGCCCCAAGAGGCTGGCCCAGG + Intronic
906034681 1:42742730-42742752 CGGGGAGAACAGGAAGGCTCAGG + Intergenic
917802583 1:178583780-178583802 TGGCCTCAAGAGGAAGGATCTGG + Intergenic
917962378 1:180155135-180155157 CGCCCCGACGTGGAAGGCGCTGG + Exonic
919939878 1:202278816-202278838 CAGCCCGATGATGAAAGCTCAGG - Intronic
919977016 1:202619353-202619375 CTGCCCGGAGAGGGAGGCTGGGG + Intronic
920264168 1:204709441-204709463 TAGCCCGAAGATGAAGGCTAAGG - Intergenic
922664385 1:227456168-227456190 TGGCCCGAAGAGGAAAACACTGG - Intergenic
924131896 1:240918500-240918522 CGGGCCAAAGAAGAAGTCTCGGG + Intronic
924527300 1:244863850-244863872 GGGGACGAAGAGGAAGGCGCGGG - Exonic
1064012083 10:11743003-11743025 AGGCCTGGAGAGGAGGGCTCTGG + Intronic
1067464839 10:46490304-46490326 TGTCCTGAAGAGAAAGGCTCAGG - Intergenic
1067622352 10:47894297-47894319 TGTCCTGAAGAGAAAGGCTCAGG + Intergenic
1073116501 10:101094560-101094582 CGGGCTGGAGAAGAAGGCTCTGG - Intronic
1073428627 10:103471593-103471615 CAGCCCGAACAGGAAGGGTTTGG - Intergenic
1074783048 10:116815920-116815942 CGGCCCTAAGAGGAAGGAGCCGG + Intergenic
1076591759 10:131588404-131588426 CGGCCCAAAGAGGACAGCTGTGG - Intergenic
1078067157 11:8086053-8086075 GGGCCTGAACAGGGAGGCTCAGG - Intronic
1081911539 11:46703102-46703124 GGGCCCTCAGAGGAAGGCTGGGG - Exonic
1083460006 11:62805104-62805126 CGGCTCGGAGCGGATGGCTCGGG - Intronic
1083475170 11:62910606-62910628 CTGCCAGAAGAGGATGGCTGGGG + Exonic
1083934205 11:65861956-65861978 CAGCCCAAAGCGGGAGGCTCTGG + Exonic
1084184576 11:67464828-67464850 CGGCACGAAGAAGATGGCGCTGG + Exonic
1091996498 12:4997927-4997949 CGCCCCGAAGCAGAAGGCTCAGG - Intergenic
1095664665 12:44783137-44783159 CAGGTCAAAGAGGAAGGCTCAGG + Intronic
1101803913 12:108046879-108046901 CGTCCAGGAGAGGACGGCTCTGG + Intergenic
1103722697 12:122983048-122983070 TGACCTGAAGAGGAAGGCACAGG - Intergenic
1105813775 13:24015705-24015727 CGCCCCAAAGGGGAAGGATCAGG - Intronic
1106575550 13:30971033-30971055 AGCCCCAAAGAGGAAAGCTCTGG - Intronic
1113742480 13:112721120-112721142 CGGTCAGAAGTGGAAGGGTCTGG + Intronic
1114493707 14:23118785-23118807 CGGCCCAGACAGGAAGGCGCTGG - Exonic
1119444731 14:74653802-74653824 GGGGAAGAAGAGGAAGGCTCTGG - Intronic
1120652321 14:87149704-87149726 TTGCCCCAAGAGCAAGGCTCTGG - Intergenic
1121106580 14:91283721-91283743 AGGCCCCATGAGGATGGCTCTGG + Intronic
1122658047 14:103274663-103274685 CCACCCGAAGAGGGAGGCGCTGG - Intergenic
1125507168 15:40273595-40273617 CGTCCCTAAGAGGAAGTCCCTGG + Exonic
1126876324 15:53045559-53045581 CGGTGGGAAGAGGAAGGCTGGGG - Intergenic
1127502630 15:59569111-59569133 CACCCCCAAGAGGAAGGATCTGG - Intergenic
1127838503 15:62809965-62809987 CGTCCCGAAACGCAAGGCTCTGG - Exonic
1129716183 15:77852457-77852479 CTGCCCAAAGCGGAAGCCTCAGG + Intergenic
1130040052 15:80398952-80398974 CGGCCCCAGGAGGAAGGCATGGG - Intronic
1136028037 16:27482436-27482458 CTCCCGGAAGAGGAAGGCACAGG - Intronic
1136419775 16:30124375-30124397 GGGCCAGATTAGGAAGGCTCTGG + Intergenic
1139967606 16:70754429-70754451 GTCCCCGAGGAGGAAGGCTCAGG + Intronic
1140197283 16:72865659-72865681 CTGGCCAAAGAGGAAGGCTGTGG + Intronic
1142130767 16:88430575-88430597 CCCCAGGAAGAGGAAGGCTCGGG + Exonic
1142211452 16:88810525-88810547 GGGGCCAAAGAGGAAGCCTCGGG + Exonic
1143475915 17:7203898-7203920 CAGCCAGAGGAGGAAGGCACAGG + Intronic
1143543013 17:7580685-7580707 TGGGGCGAAGAGGAAGGCGCAGG - Intronic
1144945390 17:18967077-18967099 CGGCCCACAGAGGAGTGCTCGGG + Intronic
1148712357 17:49691092-49691114 ATGCAAGAAGAGGAAGGCTCTGG - Intergenic
1150747051 17:67825140-67825162 CGGCTCGGAGAGGAAGGCAAGGG - Intergenic
1150791732 17:68205175-68205197 CGGCTCGGAGAGGAAGGCAGGGG - Intergenic
1152086535 17:78222942-78222964 GGACATGAAGAGGAAGGCTCTGG + Intronic
1152130558 17:78473703-78473725 CAGCCCCAACAGGAAGGATCAGG + Intronic
1152288267 17:79424706-79424728 CGGCCCGAGGGGGAAGACTATGG - Intronic
1152388208 17:79987685-79987707 CTGCCCGCAGAGGGAGGCTGTGG - Intronic
1156144478 18:34159308-34159330 CGGCCGGAGGAGGAAGGCCAAGG + Intronic
1161950453 19:7464893-7464915 GGTCCCCAAGAGGAAGGCTGGGG + Intronic
1163441573 19:17324716-17324738 CGGCCCGAAGAGGAAGGCTCAGG - Exonic
928184770 2:29100656-29100678 CTGAGCAAAGAGGAAGGCTCTGG + Intronic
938051917 2:128181563-128181585 CGGGCTGAAGTGGAAGGCTGTGG - Intronic
943703827 2:191014278-191014300 CGGCCCGCAGAGGGAGGCGGTGG - Intronic
948547918 2:238745803-238745825 CGTCCCGAGGAGGAAGGGACTGG + Intergenic
1173498214 20:43534165-43534187 CTGCCCAAAGGGGAAGGCTAGGG - Intronic
1179888929 21:44326199-44326221 CGGCCTGAAGAAGAAGGCGGTGG + Exonic
1180929172 22:19577273-19577295 CGGCCCCAGGAGTAGGGCTCAGG - Intergenic
1181627596 22:24132257-24132279 GGGCTCCAAGAGGAAGACTCAGG - Intronic
1183296569 22:37033232-37033254 AGGCCCCAACAGGAAGGCTCTGG - Intergenic
1183773469 22:39946957-39946979 CAGGCCGGAGAGCAAGGCTCAGG - Intronic
1185007797 22:48294007-48294029 TGGGTCAAAGAGGAAGGCTCAGG + Intergenic
950466708 3:13159974-13159996 CTCCACTAAGAGGAAGGCTCTGG - Intergenic
955391387 3:58524753-58524775 CGGCCCGAGGGGGAACCCTCAGG - Intronic
961550765 3:127669485-127669507 GGGCCCAGAGAGGAAGGGTCTGG + Intronic
962932751 3:140052852-140052874 CTGCCAGAGAAGGAAGGCTCAGG - Intronic
963081133 3:141394621-141394643 AGGAAGGAAGAGGAAGGCTCTGG - Intronic
963160821 3:142149389-142149411 CTGCCCAAAGATGAAGGGTCAGG + Exonic
972479295 4:39482774-39482796 CGACCAGATGAGGAAGGCTTGGG + Intergenic
990529332 5:56658191-56658213 AGGGCTGAAGAGGAAGTCTCAGG + Intergenic
1000552640 5:162685662-162685684 TGGCCTGTAGAGGAAGGCTCAGG + Intergenic
1001175720 5:169467220-169467242 TGGCTCTAAGAGGAAGGCTGGGG + Intergenic
1001292259 5:170472032-170472054 GGGCCGGCAGAGGAAGGGTCAGG - Intronic
1003111296 6:3253802-3253824 CTCCCCGCAGAGCAAGGCTCGGG + Intronic
1006145883 6:31959316-31959338 CGGCCCGAAGGGGTAGGTCCAGG - Exonic
1006388497 6:33745431-33745453 AGGCCCCGAGAGGCAGGCTCAGG - Intronic
1013482985 6:110568143-110568165 CTGCCTGAAGAGTGAGGCTCAGG + Intergenic
1019500179 7:1360751-1360773 CGGCCCGGTGAGGGTGGCTCTGG - Intergenic
1026920789 7:74153877-74153899 CAGGCCGGAGAGGAAGCCTCAGG - Intergenic
1028129459 7:87152742-87152764 CGGCCCTAAGAGGGAGGCCCTGG - Exonic
1034621348 7:152459659-152459681 TGGCCCTAAGGGGAAGCCTCAGG + Intergenic
1035913948 8:3598537-3598559 CAGAGCGTAGAGGAAGGCTCAGG - Intronic
1038761218 8:30385067-30385089 CGGCCCGGCGAGGAAGGACCGGG + Exonic
1039542249 8:38382026-38382048 CTGCGGGAAGAGGAAGGCTCGGG + Exonic
1043640188 8:82441647-82441669 CGGCTCGGAGGGGGAGGCTCAGG - Intergenic
1048583120 8:135747013-135747035 CGGCCAGATCAGCAAGGCTCTGG + Intergenic
1048661904 8:136614126-136614148 TGGCCCCAAGATGAAGGCTGTGG - Intergenic
1048995319 8:139790481-139790503 CTGCCCTGAGAGGCAGGCTCTGG + Intronic
1049146033 8:141001516-141001538 CGGCCGGACGAGGAAAGCCCTGG + Intronic
1053279475 9:36808519-36808541 CCTCCTGAAGAGGAAGGCACAGG + Intergenic
1057789961 9:98118363-98118385 AGGCCACAAGAGGAAGGCTCTGG - Intronic
1058618763 9:106862393-106862415 TGGCCCGCAGAGGAAGCCCCCGG - Intergenic
1189294187 X:39907328-39907350 AGGCCCCAGGAGGCAGGCTCTGG + Intergenic
1195536579 X:106014447-106014469 AGGCCCCAAGTGGAATGCTCAGG + Intergenic
1195746199 X:108121241-108121263 CAGCCAGAAGACCAAGGCTCTGG - Intronic
1195894561 X:109732866-109732888 CGGCAGGAAGAGGCAGGCTGGGG + Intronic