ID: 1163443563

View in Genome Browser
Species Human (GRCh38)
Location 19:17333878-17333900
Sequence GAGTGGTGAGGAGCCCTGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 326}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163443563_1163443575 9 Left 1163443563 19:17333878-17333900 CCCGCCAGGGCTCCTCACCACTC 0: 1
1: 0
2: 6
3: 35
4: 326
Right 1163443575 19:17333910-17333932 TTCAAGGCCCCGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 150
1163443563_1163443568 -7 Left 1163443563 19:17333878-17333900 CCCGCCAGGGCTCCTCACCACTC 0: 1
1: 0
2: 6
3: 35
4: 326
Right 1163443568 19:17333894-17333916 ACCACTCCACCTGGCATTCAAGG 0: 1
1: 0
2: 0
3: 20
4: 214
1163443563_1163443576 14 Left 1163443563 19:17333878-17333900 CCCGCCAGGGCTCCTCACCACTC 0: 1
1: 0
2: 6
3: 35
4: 326
Right 1163443576 19:17333915-17333937 GGCCCCGGGAGCTCTGGGCTTGG 0: 1
1: 0
2: 3
3: 37
4: 395
1163443563_1163443574 8 Left 1163443563 19:17333878-17333900 CCCGCCAGGGCTCCTCACCACTC 0: 1
1: 0
2: 6
3: 35
4: 326
Right 1163443574 19:17333909-17333931 ATTCAAGGCCCCGGGAGCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 103
1163443563_1163443571 -1 Left 1163443563 19:17333878-17333900 CCCGCCAGGGCTCCTCACCACTC 0: 1
1: 0
2: 6
3: 35
4: 326
Right 1163443571 19:17333900-17333922 CCACCTGGCATTCAAGGCCCCGG 0: 1
1: 0
2: 4
3: 28
4: 203
1163443563_1163443572 0 Left 1163443563 19:17333878-17333900 CCCGCCAGGGCTCCTCACCACTC 0: 1
1: 0
2: 6
3: 35
4: 326
Right 1163443572 19:17333901-17333923 CACCTGGCATTCAAGGCCCCGGG 0: 1
1: 0
2: 6
3: 24
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163443563 Original CRISPR GAGTGGTGAGGAGCCCTGGC GGG (reversed) Intronic
900090716 1:919281-919303 GAGGGGTGGGGTGCCGTGGCTGG - Intergenic
900506999 1:3034726-3034748 GAGTGGAGAGGGTCCCTGGAGGG + Intergenic
900871865 1:5310089-5310111 GAGTGCTGGGGAGGCCTGGAAGG - Intergenic
901196074 1:7440375-7440397 CAGTGGGAAGGAGGCCTGGCCGG + Intronic
901251448 1:7783522-7783544 GTGTGGGGAGGAGCCCAGGGTGG - Intergenic
901676627 1:10889202-10889224 GCTTGGTGAGGAGCGATGGCAGG - Intergenic
901775405 1:11557153-11557175 GAGTGGAGAAGAGCCCAGGGAGG - Intergenic
901829208 1:11881811-11881833 GTGGTTTGAGGAGCCCTGGCAGG + Intergenic
902298324 1:15483460-15483482 GTGAGGTGAGAGGCCCTGGCCGG - Intronic
902628482 1:17690484-17690506 GAGGGGCAAGGAGCCCTCGCAGG - Intronic
903050932 1:20600418-20600440 GAGTGGTGAGCAGATATGGCAGG + Intronic
903234983 1:21944361-21944383 GGGTGGTCAGGAGGCCTGGGTGG - Intergenic
904385632 1:30140346-30140368 GAGTGGTGAGGGGTGCTGGGAGG + Intergenic
904475755 1:30763750-30763772 GGGTGGTCAGGAGGCCTGGCTGG - Intergenic
904689348 1:32282200-32282222 GAGCAGTGAGGACCCCTGGCAGG - Intronic
905104998 1:35558818-35558840 GACTGGTGAGGAGAGCTGTCCGG + Intronic
905688739 1:39927362-39927384 CAGGGGTAAGGATCCCTGGCTGG - Intergenic
906199194 1:43948249-43948271 GAGTAGGGAGGAGCCCTGTAAGG - Intronic
907388542 1:54141386-54141408 GACTGGTGAGGACCCCTGACAGG + Exonic
908916228 1:69129649-69129671 GAGGGGTGAGGGGCACTGGGAGG + Intergenic
912376250 1:109212248-109212270 CAGTGGTGAGGGGCCCTGGGGGG + Intergenic
912530376 1:110316533-110316555 GTGATGTTAGGAGCCCTGGCTGG + Intergenic
913177601 1:116289077-116289099 GAGTGGAGAGCTGCCCTGGGAGG + Intergenic
916245342 1:162682099-162682121 GAGGTGGGAGGAGCCCGGGCAGG - Intronic
917046918 1:170871089-170871111 GAGCAGTGAGGAGCACTGGTTGG + Intergenic
917210745 1:172629710-172629732 CAGTGGTGAGGAGCATTGTCAGG + Intergenic
918289623 1:183094151-183094173 GAGTGGTGAGGAGGCCAGTGCGG - Intronic
922317811 1:224458076-224458098 GAGAGGGTAGGAGCCCTGGAAGG - Intronic
922616726 1:226965214-226965236 CAGAGGGGAGGAGGCCTGGCCGG - Exonic
922757113 1:228102732-228102754 GAGTGGTGAGGACCTGTGGTGGG - Intronic
923517603 1:234710407-234710429 CAGTTTTGAGGAGCCCTGGGTGG + Intergenic
924269919 1:242321637-242321659 GAGAGAAGAGGAGGCCTGGCTGG - Intronic
924386653 1:243505112-243505134 GAGGGGTGAGGACCCTTGGCTGG + Exonic
1067980910 10:51083258-51083280 AAGTGGCCAGGAACCCTGGCTGG - Intronic
1069622714 10:69847707-69847729 GAGGGATTAGGAGCCCTGGGAGG + Intronic
1070626573 10:78055137-78055159 GAGAGATGTGGAGCCCTGGAGGG - Exonic
1070731476 10:78831540-78831562 GATAGGTGGGGAGCCCTGCCTGG - Intergenic
1073250501 10:102118043-102118065 GAGGGCTGAGGCGCCCTGGCAGG - Intronic
1074419934 10:113299785-113299807 AAGTGGTGAGCAGCCCCTGCTGG + Intergenic
1076514628 10:131036973-131036995 GAGTGGTGAGCAGCCCAGGTAGG - Intergenic
1076673051 10:132133649-132133671 GGGTGGGGAGGTGCCCAGGCAGG - Intronic
1076865805 10:133165779-133165801 GAGTCCTGAGGAGTCCTGGGCGG + Intronic
1076931023 10:133531779-133531801 GCGGTGTGGGGAGCCCTGGCTGG + Intronic
1077372988 11:2192385-2192407 GGGAGGTCGGGAGCCCTGGCTGG - Intergenic
1077496906 11:2890916-2890938 GGGGAGTGAGGACCCCTGGCCGG - Intronic
1078297220 11:10084927-10084949 GACAGGTGAGGAGCTATGGCGGG + Intronic
1079468894 11:20759569-20759591 GAGTGGTGAGATGCCCTAGAAGG - Intronic
1081669064 11:44933296-44933318 CAGGGGTGAGGACCCCTGGCAGG + Exonic
1082783596 11:57304403-57304425 GAATTGGGAGCAGCCCTGGCTGG + Intronic
1082806611 11:57455731-57455753 GAGAGCTGAGGAGCCCAGGGTGG + Intergenic
1082938643 11:58680426-58680448 GGGAGGTGTGGAGCCCTTGCTGG - Intronic
1083596405 11:63919972-63919994 GAGGGGTGAGGAGCCTTTTCTGG - Intergenic
1083897821 11:65628994-65629016 GAGAGGTTTGGAGCCCAGGCTGG + Intronic
1084456291 11:69269943-69269965 GTGGTGTGAGGAGCCCTGGGTGG + Intergenic
1084730704 11:71071741-71071763 GGCTGGTGAGGAGCCATGGAAGG + Intronic
1086841817 11:91695020-91695042 GAGTGCTAGGGAGCCCTGTCTGG + Intergenic
1088819951 11:113448438-113448460 GAGTGGGGAGCAGCTCTGACAGG - Intronic
1088872687 11:113904845-113904867 GAGTGGAGAGGAACCCTGTTAGG + Exonic
1090649464 11:128793597-128793619 GAGTGGTCAGGAGCAGTGCCTGG - Intronic
1091401228 12:182002-182024 GAGTAGTGAGGAGTCCTGGCAGG - Intergenic
1093005306 12:14044790-14044812 AAGTGGGGAGGAGCCATTGCAGG - Intergenic
1095958236 12:47818823-47818845 GAGTGAGGAGCAGCCGTGGCTGG + Intronic
1096103864 12:48985594-48985616 GAGTGGTGGGCAGCCCTGCATGG - Intergenic
1096980971 12:55728251-55728273 GAGTGGCGAGGGGTCCTGGGGGG - Intronic
1097675112 12:62592025-62592047 GAGTGGGGAGGAACCATGTCTGG - Intronic
1098449321 12:70601539-70601561 GAGTGGTGAGGAGACTTGATTGG + Intronic
1099006440 12:77240040-77240062 CAGTGGTGAAGAGCTCAGGCTGG + Intergenic
1101767385 12:107714592-107714614 GAGTGTTGAGTTGCCCAGGCTGG + Intergenic
1101824618 12:108210393-108210415 GAGTGATGGGGAGCCATGGAGGG - Intronic
1102042973 12:109812309-109812331 GACTGGAGAGAAGCCCTGGATGG - Intronic
1103891231 12:124240587-124240609 GAGTGGGGAGGAGCCCAGGAAGG - Intronic
1104146273 12:126036925-126036947 GAGTGGTGAAAAGCACTAGCTGG - Intergenic
1104820491 12:131674607-131674629 GGGTGCCGAGGAGGCCTGGCAGG - Intergenic
1105061108 12:133151849-133151871 GAAGGGAGAAGAGCCCTGGCTGG + Exonic
1105886653 13:24648618-24648640 GAATGGGGAGGGGCCCTGACTGG - Intergenic
1110168701 13:72474415-72474437 GAGTACTGATGATCCCTGGCAGG + Intergenic
1110223146 13:73093904-73093926 GTGTGGTGAGAGGCCCAGGCTGG + Intergenic
1113598883 13:111554447-111554469 GGGAGGAGAGGAGGCCTGGCTGG - Intergenic
1114593008 14:23885882-23885904 TACTGGTGAGCAGCCCAGGCTGG + Intergenic
1118731604 14:68670668-68670690 ATGTGGAGAGCAGCCCTGGCAGG + Intronic
1119148539 14:72337550-72337572 GAGCAGTGAGGTGACCTGGCCGG + Intronic
1119415652 14:74467696-74467718 GATTGGGGGGAAGCCCTGGCAGG + Intergenic
1119740813 14:77012683-77012705 GAGTGGGGAGGAGGCGAGGCAGG - Intergenic
1120740753 14:88106292-88106314 AAGGGGTGGGGAGCACTGGCAGG - Intergenic
1121334585 14:93069567-93069589 GAGTGGTGAGGACGCAAGGCTGG - Intronic
1121463920 14:94102179-94102201 GAGAGGGGAGGAGACCTGCCTGG - Intronic
1122081093 14:99268515-99268537 GGGTGCTTTGGAGCCCTGGCTGG - Intronic
1122093103 14:99352916-99352938 CAGTGGGGAGGAGGCCTGGGAGG + Intergenic
1122227986 14:100290825-100290847 CTGTGGTGAGGGGCACTGGCGGG - Intergenic
1122372251 14:101235311-101235333 GGGTGGTGAGGGGCCCTGGCAGG - Intergenic
1122455263 14:101845437-101845459 GAGTGGAGAGGCGCCCCGGATGG - Intronic
1122783381 14:104153177-104153199 GACTGGTGAGGTGGCCTGTCTGG + Intronic
1122835589 14:104429330-104429352 CAGTGGTGAGGTGCCCTGGGCGG + Intergenic
1123403037 15:20004987-20005009 GAGGGGACAGGAGCCCTGGAGGG - Intergenic
1123512377 15:21011641-21011663 GAGGGGACAGGAGCCCTGGAGGG - Intergenic
1124011905 15:25845641-25845663 GAGAGGTGTCGGGCCCTGGCTGG - Intronic
1124653276 15:31488135-31488157 AGGTGGTGATGAGCCCTGGAAGG + Intronic
1125909405 15:43422578-43422600 GAGTGGTCAGGAGCCCTTCTAGG + Intronic
1126905292 15:53358659-53358681 CAGTGGTGAGTAGCCCGGCCTGG - Intergenic
1128234568 15:66058963-66058985 GAGTGGTTGGGAGTCCTGGATGG - Intronic
1128764161 15:70240892-70240914 GAGTAGTAAGGAGGCCTGCCTGG + Intergenic
1129739316 15:77982388-77982410 GTGTGGTGAGGGGCCTGGGCTGG - Intergenic
1129744302 15:78007514-78007536 GAGATGTGAGGAGCACAGGCGGG + Intronic
1130602234 15:85284003-85284025 GAGAACAGAGGAGCCCTGGCAGG - Intergenic
1131440320 15:92454759-92454781 GGGTGGCACGGAGCCCTGGCTGG + Intronic
1132336609 15:101052071-101052093 GATTGGTGGGAAGCCATGGCCGG - Intronic
1132392377 15:101448486-101448508 TAATAGTGAGGATCCCTGGCTGG - Intronic
1132656886 16:1045146-1045168 AGGTGGTGAGGAGCCTTGGGAGG - Intergenic
1132722689 16:1324536-1324558 GCGTGGTGGGGAGCCCATGCTGG - Intronic
1132739443 16:1404154-1404176 CAATGGTGTCGAGCCCTGGCTGG + Intronic
1132912775 16:2323941-2323963 GAGTGTTCAGGATCCCTGGAGGG + Intronic
1133014457 16:2933074-2933096 GGGTGGAGAGGAGCCCAGGAGGG - Intronic
1134561994 16:15218959-15218981 GGTTGGAGAGGAGGCCTGGCTGG - Intergenic
1134563371 16:15230041-15230063 GAGTGGTTAGTTGCCCTGGTTGG - Intergenic
1134743673 16:16570831-16570853 GAGTGGTTAGTTGCCCTGGTTGG + Intergenic
1134922532 16:18130585-18130607 GGTTGGAGAGGAGGCCTGGCTGG - Intergenic
1134923896 16:18141667-18141689 GAGTGGTTAGTTGCCCTGGTTGG - Intergenic
1135752766 16:25070161-25070183 GAGTGGGGAGGATCCCTTGAAGG + Intergenic
1136553539 16:30994740-30994762 GGGTAGTGGGGAGCCATGGCAGG - Intronic
1137631996 16:49953251-49953273 TGGTGGTGAAGAGCCCAGGCAGG + Intergenic
1138606651 16:58094180-58094202 GAGTGATGAGGATGCTTGGCTGG - Intergenic
1139334802 16:66224252-66224274 GAGAGGTGAGGCACCCAGGCTGG + Intergenic
1140780214 16:78289082-78289104 GAGTGGAAGGCAGCCCTGGCTGG + Intronic
1140818475 16:78641761-78641783 GAGTGGAGGGGAGCTCTGTCAGG - Intronic
1141412222 16:83843380-83843402 GGGAGGTGAGGAGCACTGGGAGG + Intergenic
1141662309 16:85448050-85448072 GAGGGCTGATGAGCCCTCGCTGG - Intergenic
1141688285 16:85582527-85582549 GCGAGGGGAGGAGCCCTGCCTGG + Intergenic
1142242580 16:88954340-88954362 GTGAGGTCAGGAGCCTTGGCTGG - Intronic
1142242620 16:88954473-88954495 GCGGGGTCAGGAGCCTTGGCTGG - Intronic
1142242765 16:88954967-88954989 GCGGGGTCAGGAGCCTTGGCTGG - Intronic
1142242867 16:88955309-88955331 GCGGGGTCAGGAGCCTTGGCTGG - Intronic
1142242924 16:88955499-88955521 GTGGGGTCAGGAGCCTTGGCTGG - Intronic
1142242944 16:88955556-88955578 GTGGGGTCAGGAGCCTTGGCTGG - Intronic
1142243061 16:88955917-88955939 GCGGGGTCAGGAGCCTTGGCTGG - Intronic
1142243074 16:88955955-88955977 GCGGGGTCAGGAGCCTTGGCTGG - Intronic
1142243087 16:88955993-88956015 GTGGGGTCAGGAGCCTTGGCTGG - Intronic
1142860606 17:2758568-2758590 GAGTGGTTAGGCAGCCTGGCAGG + Intergenic
1144561797 17:16326706-16326728 AAGTGGTGAAGAGCACAGGCTGG + Intronic
1145252901 17:21306020-21306042 ATGTGGTGAGAAGCGCTGGCGGG + Intronic
1145283561 17:21486872-21486894 GAGGGAGGAGGAGGCCTGGCTGG - Intergenic
1145323675 17:21781896-21781918 ATGTGGTGAGAAGCGCTGGCGGG - Intergenic
1146473415 17:33142521-33142543 CATTGCTGAGGACCCCTGGCTGG - Intronic
1146548058 17:33756170-33756192 CTGTGGTCAGGTGCCCTGGCTGG - Intronic
1147218613 17:38915142-38915164 GCGGGGTGAGTAACCCTGGCCGG + Exonic
1147335604 17:39725428-39725450 GGTGGGTGAGGAGCCATGGCTGG + Intronic
1147648404 17:42048164-42048186 GAGTGGTGTGGTGCCCAGGCTGG - Intronic
1148225645 17:45896367-45896389 GATGGGTGGGGAGCCCTGGCGGG + Intronic
1148329754 17:46806777-46806799 GAGTTGTGAGGACACCTTGCTGG + Intronic
1148484842 17:47984039-47984061 GAGTGGGGCTGAGCCATGGCTGG - Intergenic
1151465867 17:74284920-74284942 GGATGCTGAGGCGCCCTGGCCGG - Intronic
1151722375 17:75864759-75864781 CAGTACTGAGGAGCCTTGGCTGG + Intergenic
1151974215 17:77475389-77475411 GAGGAGGGAGCAGCCCTGGCCGG + Intronic
1152091468 17:78249915-78249937 GAGGGATCAGGAGACCTGGCTGG + Intergenic
1152091935 17:78252000-78252022 GGTTGGTGGGGAGCCCTGGAAGG - Intergenic
1152437527 17:80285455-80285477 GTGTGCTGAGGAGACCTGGCAGG - Intronic
1152667157 17:81577803-81577825 GAGAGGTTTGGAGGCCTGGCAGG - Intronic
1155591908 18:27436856-27436878 CAATGGTGAAGAGCCCTGGAGGG - Intergenic
1156526569 18:37773682-37773704 GAAGGGTGAGGAGCCCCAGCAGG + Intergenic
1157546556 18:48550572-48550594 GAGTGGAGAGGAGCCCAGAGGGG - Intronic
1158608743 18:58919542-58919564 GACTGGAGAGGCGCCCTGGGGGG - Exonic
1160251527 18:77207541-77207563 GAGAGGTGAAAAGCCCTGGGTGG + Intergenic
1161051350 19:2165348-2165370 GAGCGCTGGGGAGCCCGGGCTGG + Intronic
1161273770 19:3404424-3404446 GAGGCGTGGGGAGCCCTGGGTGG + Intronic
1161572136 19:5036455-5036477 GAGGTGAGAGGAGCCCTGGAAGG + Intronic
1161939550 19:7394408-7394430 CAGTGGTGGGGAGTCCTAGCGGG - Intronic
1162770742 19:12948184-12948206 GGGTGCTGAGGTACCCTGGCCGG - Exonic
1162796906 19:13091793-13091815 GAGCTGTGAGCAGCCCAGGCAGG - Intronic
1163149111 19:15400776-15400798 GAGTGGTAAGTGGCTCTGGCTGG - Exonic
1163443563 19:17333878-17333900 GAGTGGTGAGGAGCCCTGGCGGG - Intronic
1164671677 19:30076136-30076158 GAGTGGTGAGCGGGGCTGGCGGG + Intergenic
1165002687 19:32778225-32778247 GTGGGGTAAGAAGCCCTGGCAGG - Intronic
1165874120 19:38993632-38993654 GAGTGGTGAGGAGAAATGGCAGG - Intronic
1166322091 19:42024819-42024841 AAGGTGTGAGGAGCCCTGGAGGG - Intronic
1166667471 19:44689621-44689643 GAGTGGGGAGGAGTCCAGGCGGG - Intergenic
1167071344 19:47223763-47223785 GAGTGTTGAGGAGGCTGGGCTGG - Intronic
1167455498 19:49595337-49595359 GGGTGGTGGGGAGCCCTCCCCGG + Exonic
1167721583 19:51183673-51183695 GAGTGGTGGGGGACCCTGGGAGG - Intergenic
925920181 2:8632853-8632875 GAGTCCCGAGGAGCCCAGGCCGG + Intergenic
929401079 2:41582435-41582457 GGGTGGCCAGAAGCCCTGGCTGG - Intergenic
929602939 2:43216072-43216094 GTGTGTTGAGGAGCACGGGCTGG - Intergenic
929681241 2:43995655-43995677 GCGTGGTGCGGAGCCCGGGGAGG + Intronic
930013756 2:46957021-46957043 CAGTGGAGGGGAGCCCAGGCTGG - Intronic
931282570 2:60807172-60807194 AACTGCTGAGAAGCCCTGGCAGG - Intergenic
932050031 2:68389106-68389128 GAGTGCTGAGGAGCTCTAGTCGG + Intronic
932494317 2:72138951-72138973 GAGGGGTGAGGAGGCCTGGTTGG - Intronic
932625257 2:73292050-73292072 GAGGGGTCAGGAGCCCAGGGAGG + Exonic
933796613 2:85925009-85925031 GAGTGAACAGGAGACCTGGCTGG - Intergenic
933897340 2:86823912-86823934 GACTGAGGAGGAGCCCTGGGGGG + Intronic
934156160 2:89203062-89203084 AAATGGTGAGGAGCCCTTGAAGG - Intergenic
934211157 2:89979701-89979723 AAATGGTGAGGAGCCCTTGAAGG + Intergenic
934662950 2:96152875-96152897 CAGGGAGGAGGAGCCCTGGCAGG - Intergenic
934737632 2:96698009-96698031 GAGGTGTGTGGAACCCTGGCTGG - Intergenic
934937575 2:98476565-98476587 GTGTGGGGAGGAGCCCTGCTTGG + Intronic
934975750 2:98800983-98801005 GAGTGGGTGGGTGCCCTGGCTGG + Intronic
935693894 2:105754035-105754057 GAGTGTTGAGCAGCCCTCCCTGG + Intronic
936149635 2:110008155-110008177 GACTGGAGAGGCACCCTGGCGGG - Intergenic
936195043 2:110363214-110363236 GACTGGAGAGGCACCCTGGCGGG + Intergenic
936398430 2:112148001-112148023 CAGTGGGGAGGAGAGCTGGCGGG - Intronic
937414079 2:121700314-121700336 GAGTGGAGAGGAGGCAAGGCTGG + Intergenic
939391079 2:141570536-141570558 GAGGGGTGACCAGCACTGGCTGG + Intronic
939983532 2:148808746-148808768 GACTGTTGAGGAGCTCTGGAGGG + Intergenic
940170766 2:150827746-150827768 TAGTGCTGAAGGGCCCTGGCAGG - Intergenic
941857751 2:170247909-170247931 GAATGGTGAGGAGCACTGTGTGG + Intronic
942300051 2:174552451-174552473 GAGTGCTGATGCTCCCTGGCCGG + Intergenic
944908489 2:204286250-204286272 GAGTGGCCAGCAGTCCTGGCAGG - Intergenic
946168772 2:217881284-217881306 AAGCGGGGAGGACCCCTGGCTGG + Intronic
946181256 2:217950520-217950542 GGGAGGTGAGGAGGTCTGGCTGG + Intronic
946388898 2:219403908-219403930 GAGTGGTTTGGAGCCCAGACTGG - Intergenic
947799539 2:232920184-232920206 GGGGGGTGAGGTTCCCTGGCTGG - Intronic
948406320 2:237722755-237722777 GAGTGGTGAAGAGGCCTGCGTGG + Intronic
948517185 2:238511307-238511329 GAGTGGCCAGGACCCCTGCCCGG + Intergenic
1169268598 20:4182364-4182386 GGGTGGAGAGGAGCCCCGGGGGG + Exonic
1169392586 20:5202534-5202556 AAGTGGGGAGGAGCACTGGCAGG + Intergenic
1171065038 20:22007209-22007231 GAGTGGTGACCACCCCTGGTAGG + Intergenic
1172025084 20:31943059-31943081 GAGTGGGGGGGAGGCCTGGGTGG - Exonic
1172098011 20:32470040-32470062 GAGTCGTGTGGAGCCCTGGCTGG - Intronic
1172888925 20:38249871-38249893 GAGTGGGGAGGGCACCTGGCAGG - Intronic
1173202048 20:40961450-40961472 GAGGGCTGGGGAGCCCTGTCTGG - Intergenic
1174393629 20:50233214-50233236 GTGTGGAGAGGAGGACTGGCAGG + Intergenic
1175358027 20:58384480-58384502 GTGTGGTGAGGAGGTCTGGGAGG + Intergenic
1175831288 20:61966473-61966495 GGGCGGGGAGGGGCCCTGGCAGG + Intronic
1175859926 20:62144359-62144381 TAGTGGTGAGGGGCCCGGGTCGG + Intronic
1176081207 20:63273953-63273975 GTGGGGAGAGGTGCCCTGGCGGG - Intronic
1176093795 20:63330371-63330393 GAGGGCTGAGGAGCACAGGCAGG + Intronic
1176376008 21:6087190-6087212 GAGCGGGGAGGGGCGCTGGCGGG + Intergenic
1177446400 21:21202110-21202132 GAGTCGTGAGGAGCCAAGGCTGG + Intronic
1177738203 21:25119419-25119441 TAGAGGTGAGAAGCACTGGCTGG - Intergenic
1177744017 21:25188649-25188671 GAGGGGTGTCGAGCTCTGGCTGG - Intergenic
1178920658 21:36736156-36736178 GAGTCCTGAGGGGCCCGGGCGGG - Intronic
1179408474 21:41144079-41144101 GAGAGTTGGGGAGCCCTGGGAGG - Intergenic
1179575288 21:42304782-42304804 GAGTGGCCAGGAGCCCTGCCTGG - Intergenic
1179747467 21:43451054-43451076 GAGCGGGGAGGGGCGCTGGCGGG - Intergenic
1180758167 22:18177709-18177731 GGGTGGTGAGGGGCCCTTGAAGG + Intergenic
1180768454 22:18361501-18361523 GGGTGGTGAGGAGCCCTTGAAGG + Intergenic
1180777856 22:18500890-18500912 GGGTGGTGAGGAGCCCTTGAAGG - Intergenic
1180810582 22:18758201-18758223 GGGTGGTGAGGAGCCCTTGAAGG - Intergenic
1180826331 22:18864725-18864747 GGGTGGTGAGGAGCCCTTGAAGG + Intergenic
1181196725 22:21192456-21192478 GGGTGGTGAGGGGCCCTTGAAGG - Intergenic
1181212800 22:21300668-21300690 GGGTGGTGAGGAGCCCTTGAAGG + Intergenic
1182279031 22:29207581-29207603 GGGAGGTGAGGAGCCCAGGCTGG - Intronic
1182465935 22:30516204-30516226 CAGTGGTGGGGAGCCATGGAAGG + Intergenic
1183076299 22:35429497-35429519 GAGGGGTGAGGAGGAATGGCAGG - Intergenic
1183450607 22:37892776-37892798 GGGGGGTAAGGAGCCCTGGCTGG - Intergenic
1183705450 22:39472675-39472697 GAGAGGTGAGGTGACCTAGCTGG + Intronic
1184388399 22:44189077-44189099 GGGTGGTGAGGACCCCTGGCCGG - Intronic
1184640586 22:45867991-45868013 GAGTGGTGGGGGGCCCGGGGGGG - Intergenic
1184643769 22:45885468-45885490 CAGAGGTGGGGAGCCCTGCCAGG + Intergenic
1184870067 22:47232234-47232256 TAGGGGAGAAGAGCCCTGGCTGG - Intergenic
1185089148 22:48756234-48756256 GGGTGGTGAGGTGGCCAGGCCGG + Intronic
1185275562 22:49948973-49948995 GCTGGGTGAGGAGCCCTAGCAGG + Intergenic
1203230072 22_KI270731v1_random:102389-102411 GGGTGGTGAGGAGCCCTTGAAGG + Intergenic
1203276472 22_KI270734v1_random:90631-90653 GGGTGGTGAGGAGCCCTTGAAGG + Intergenic
950315310 3:11996770-11996792 GAGTGCTGAAGATACCTGGCTGG - Intergenic
950494301 3:13324456-13324478 GGGAGGTGAGGAGCCTGGGCCGG - Intronic
950723862 3:14903037-14903059 GATTGGGGAGGAGCTCTGCCTGG + Intronic
953046059 3:39294941-39294963 GAGAGGTCAGAGGCCCTGGCTGG + Intergenic
954667640 3:52265916-52265938 GATTGGTATGGAGCCCTGACAGG - Intronic
954971165 3:54652760-54652782 GGTTGGTGAGGAGCCATGGGAGG + Intronic
955421241 3:58740108-58740130 GAGTGGTTGGGTGCTCTGGCAGG + Intronic
957561209 3:81823279-81823301 GAGTGGCGAAAGGCCCTGGCAGG + Intergenic
959454491 3:106541793-106541815 GAGAGGCCAGAAGCCCTGGCTGG - Intergenic
962929824 3:140026028-140026050 GAGTGATGGGGAGCATTGGCAGG + Intronic
964379502 3:156083695-156083717 GAGTGGTGAGAAGCTGTGGAAGG - Intronic
967915143 3:194573010-194573032 GCATGGTGAGGAACCCTGGGCGG - Intergenic
967920136 3:194608348-194608370 CAGTGGTGAGGGCCCCTGCCAGG - Intronic
967963287 3:194941954-194941976 GGGTGGAGAGGAGGCCTGGAGGG - Intergenic
968150686 3:196335167-196335189 GAGGGGAGAGGTGCCCTGGGAGG + Intronic
968566569 4:1316594-1316616 GTGGGCTGAGGAGCCGTGGCAGG - Intronic
969492228 4:7505980-7506002 TCATTGTGAGGAGCCCTGGCAGG + Intronic
970446279 4:16125753-16125775 CAGAGGTGAGAGGCCCTGGCCGG - Intergenic
972305820 4:37828498-37828520 GACTGGCAAGGCGCCCTGGCAGG + Intronic
973582709 4:52359872-52359894 GACTGGTGAGTAGCCCTGTTGGG - Intergenic
976596244 4:86897797-86897819 GAGTAGTGGGAATCCCTGGCTGG + Intronic
977084413 4:92575890-92575912 GGGTGGCCAGAAGCCCTGGCTGG + Intronic
978623856 4:110662378-110662400 GAGGGGTGAGGAGCTCTGGGTGG + Intergenic
980333589 4:131440708-131440730 GAGTGGCCAGATGCCCTGGCTGG + Intergenic
982214336 4:153067319-153067341 GTGTGGGGAGGAGTTCTGGCTGG - Intergenic
985480566 5:107762-107784 GTGTGGCCAGGAGCTCTGGCTGG + Intergenic
985648486 5:1096488-1096510 GAGTGGGGAAGGGCCCTGGATGG - Intronic
987372284 5:17204192-17204214 GAGTGGTGTGTGGCGCTGGCTGG - Intronic
989163557 5:38413706-38413728 GAGTAGAGAGGAGCCCAGGCAGG - Intronic
990070873 5:51781495-51781517 GAAAGGTGAGGAGCTCAGGCAGG + Intergenic
991702874 5:69332615-69332637 GAGTGGGGAGGACCCAGGGCAGG - Intronic
993379783 5:87193293-87193315 AAGTGGCGAGGAGACCAGGCAGG - Intergenic
993903332 5:93598605-93598627 GGGTTGTGAGTAGTCCTGGCCGG + Intergenic
994171322 5:96662357-96662379 GAGTGGCGGGGAGGCCTGGCGGG - Exonic
994324659 5:98435396-98435418 GGGTGGTGAGGAGCCAAAGCAGG - Intergenic
995523451 5:113031896-113031918 GAGTGGGGAGTAGCCATTGCTGG + Intronic
997237295 5:132280226-132280248 GAGTGGACAGGAACACTGGCTGG - Intronic
1001241987 5:170078119-170078141 GCTTGGTGAGGAGCTCTGCCTGG - Intronic
1001645509 5:173278805-173278827 GAGTGGTGAGGGGGCCTGGGTGG + Intergenic
1003175510 6:3750665-3750687 GAATGGGGACCAGCCCTGGCGGG + Intronic
1003221331 6:4163550-4163572 GAGGTGGGAGGAGCCCAGGCTGG + Intergenic
1003516977 6:6825805-6825827 GATTGCTGAGAAGCTCTGGCTGG - Intergenic
1004662795 6:17725255-17725277 GGGTGGAGAGCAGTCCTGGCTGG + Intergenic
1005991895 6:30908399-30908421 GAGTGGTGAGGGGACCTAGGAGG + Exonic
1006047848 6:31313018-31313040 GAGTGATGAGGAGCACTGGTTGG - Intronic
1006392659 6:33767801-33767823 GAGGGTGGATGAGCCCTGGCTGG - Intergenic
1006415661 6:33902391-33902413 GAGTGGTGGGAAGCCAAGGCGGG + Intergenic
1006802615 6:36768825-36768847 GTGGGGTGAGCAGCCCTGGCTGG + Intronic
1006865793 6:37208121-37208143 GTGTGGTGGGGAGCCCTGGCAGG + Intergenic
1007098635 6:39229544-39229566 GACCGGGGAGGAGCCCAGGCGGG + Intergenic
1007321835 6:41033341-41033363 GAATGGGGAGGAGAGCTGGCAGG + Intronic
1007416321 6:41693587-41693609 GTGGTGGGAGGAGCCCTGGCTGG - Intronic
1008001969 6:46370249-46370271 GGGTGTTAAGGAGGCCTGGCAGG - Intronic
1011254379 6:85405834-85405856 GAGGGGAGAGGAGCCCTACCTGG - Intergenic
1012542282 6:100375195-100375217 GGGTGGTCAGGAGCACTGGGAGG - Intergenic
1013483056 6:110568624-110568646 GAGAGGTGAGAAGCACTGGGCGG - Intergenic
1014717074 6:124879316-124879338 GAGTGGTGCAGAGCCAAGGCAGG + Intergenic
1017715510 6:157208546-157208568 GAGTGGTGAGGAGCAGTTTCCGG - Exonic
1018710866 6:166497502-166497524 GAGAGGTGAGCAGCCCGTGCGGG + Intronic
1019737218 7:2656530-2656552 AAGAGGTGAGGGGCCCTGGGGGG + Exonic
1020248559 7:6449335-6449357 GTGGGGTGATGAGCCCAGGCAGG - Intronic
1022629604 7:32072178-32072200 GAGTGATGAGGATGCTTGGCTGG + Intronic
1023615669 7:42017037-42017059 GAGATGTGCAGAGCCCTGGCAGG - Intronic
1025639581 7:63354005-63354027 GAGCGGTGCGGATCCCTGGAGGG - Intergenic
1025643118 7:63394087-63394109 GAGCGGTGCGGATCCCTGGAGGG + Intergenic
1026201053 7:68214894-68214916 ACGTGCTGAGGAGCCCTGCCTGG + Intergenic
1026980874 7:74526015-74526037 GAGGAGTGAGGAGGCGTGGCTGG - Intronic
1030223692 7:107125694-107125716 GAGTGCTGAGGAGTAATGGCAGG + Intronic
1031923776 7:127619825-127619847 AAGTGGTAAAGGGCCCTGGCAGG + Intergenic
1033416429 7:141165718-141165740 GAGTGGTGAAGAGCTTTGACTGG + Intronic
1034374047 7:150627790-150627812 GCCTGGTGAGGAGTCTTGGCTGG - Exonic
1034634453 7:152556059-152556081 CTGGTGTGAGGAGCCCTGGCGGG + Intergenic
1034850161 7:154486098-154486120 GGGTGGTGAGGAGACCGGGGAGG - Intronic
1035564979 8:635392-635414 TAGTGGTGATGAGCCCTGCGGGG - Intronic
1039585436 8:38703315-38703337 GAGATGTGAGGTTCCCTGGCTGG + Intergenic
1043441806 8:80282962-80282984 GAGTGTGGAGCGGCCCTGGCGGG + Intergenic
1045331216 8:101157374-101157396 GGGTGATGGGGAGCCTTGGCAGG + Intergenic
1045491907 8:102676473-102676495 GGGTGGACAGGAGCCCAGGCAGG + Intergenic
1046246519 8:111570209-111570231 GAGTCGTGATCATCCCTGGCTGG - Intergenic
1046254486 8:111678694-111678716 TAGTGGTGAGGAGGGATGGCAGG - Intergenic
1048294333 8:133203226-133203248 GAGGAGTGAGGAGCCCTTGTGGG - Intronic
1048468738 8:134688622-134688644 GAGCTGTCAGGAGCCCTGGGAGG + Intronic
1048999569 8:139816164-139816186 GGGTGGTGTGGAGGCCTGGAAGG + Intronic
1049154602 8:141059143-141059165 GGGTGGTGAGGGGCCCCTGCGGG + Intergenic
1049798473 8:144507038-144507060 GTGTGCTCAGGAGCCCTGGGAGG + Exonic
1052071589 9:24088574-24088596 GGGTGCAGAGGAGCCATGGCAGG + Intergenic
1052609840 9:30758553-30758575 CAGAGGAGAGGAGACCTGGCAGG + Intergenic
1055552037 9:77440324-77440346 GTGTGGTGAGGCCCTCTGGCTGG + Intronic
1056520419 9:87395985-87396007 GAGTCCTGATGTGCCCTGGCAGG + Intergenic
1056546208 9:87616089-87616111 GAAAGGTGAGGGGCCCTGGGAGG - Intronic
1057790021 9:98118718-98118740 GAGAGGTTGGGAGCCCAGGCTGG - Intronic
1057967214 9:99515974-99515996 GAGCTGTGAGAAGCCCAGGCAGG + Intergenic
1058467759 9:105245352-105245374 GAGAGGTGAAGAGCTCTTGCTGG - Intronic
1059246511 9:112854281-112854303 GTGAGGCCAGGAGCCCTGGCAGG - Intronic
1059403902 9:114088055-114088077 GAGTGGGGAGGAGCCCAGGCAGG + Intronic
1060105050 9:120868529-120868551 GAGTGGTTAAGAGCCTGGGCCGG - Intronic
1060771349 9:126334431-126334453 GAGGGGTGTGGTGGCCTGGCTGG + Intronic
1061052817 9:128206095-128206117 GAGAGGTCAGGAGCCCTTGAGGG - Intronic
1061329898 9:129885856-129885878 AGGTGGTGGGGACCCCTGGCGGG - Intergenic
1061921933 9:133787342-133787364 GAGGCGCCAGGAGCCCTGGCAGG + Intronic
1061954626 9:133955381-133955403 GAGTGGGGAGGAGCGTGGGCGGG - Intronic
1061954733 9:133955675-133955697 GAGTGGGGAGGAGCTTTGGGGGG - Intronic
1062020571 9:134317597-134317619 GAGCGGAGAGGACCCGTGGCTGG + Intronic
1062255504 9:135618980-135619002 GAGGGGTGAGGGGCCCAGGCAGG - Intergenic
1062452043 9:136619909-136619931 GAGTGGAGAGGAAGCCGGGCCGG + Intergenic
1185626589 X:1487012-1487034 GAGGGATGAGGAGGCCAGGCTGG - Intronic
1186853633 X:13604547-13604569 GAGTGCTGAGGAGCTATGGATGG + Intronic
1189529009 X:41858627-41858649 GAGTGGTTAGGAGCCCATTCTGG - Intronic
1190761360 X:53440768-53440790 GGGTGGTGAGGAGTCCGGGAAGG - Intergenic
1192118437 X:68433180-68433202 GACTCCTGAGGAGCGCTGGCTGG + Exonic
1194774441 X:97944821-97944843 GGGTGGTGTGGAGCGCTGGGAGG - Intergenic
1197757379 X:130005313-130005335 GAGAGGTGAGGAGGCCAGGAAGG + Exonic
1197771519 X:130092383-130092405 GAGTGGGGAGGATCCCTCACAGG + Intronic
1199643070 X:149881894-149881916 GGGTGGTGAACAGCCCTGCCAGG + Intronic
1200138816 X:153887221-153887243 AAGTGGTGTGGGGCCCTGGAGGG + Intronic
1201146878 Y:11069645-11069667 CTGTGATCAGGAGCCCTGGCCGG - Intergenic