ID: 1163443564

View in Genome Browser
Species Human (GRCh38)
Location 19:17333879-17333901
Sequence GGAGTGGTGAGGAGCCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 483
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 435}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163443564_1163443568 -8 Left 1163443564 19:17333879-17333901 CCGCCAGGGCTCCTCACCACTCC 0: 1
1: 1
2: 4
3: 42
4: 435
Right 1163443568 19:17333894-17333916 ACCACTCCACCTGGCATTCAAGG 0: 1
1: 0
2: 0
3: 20
4: 214
1163443564_1163443576 13 Left 1163443564 19:17333879-17333901 CCGCCAGGGCTCCTCACCACTCC 0: 1
1: 1
2: 4
3: 42
4: 435
Right 1163443576 19:17333915-17333937 GGCCCCGGGAGCTCTGGGCTTGG 0: 1
1: 0
2: 3
3: 37
4: 395
1163443564_1163443571 -2 Left 1163443564 19:17333879-17333901 CCGCCAGGGCTCCTCACCACTCC 0: 1
1: 1
2: 4
3: 42
4: 435
Right 1163443571 19:17333900-17333922 CCACCTGGCATTCAAGGCCCCGG 0: 1
1: 0
2: 4
3: 28
4: 203
1163443564_1163443575 8 Left 1163443564 19:17333879-17333901 CCGCCAGGGCTCCTCACCACTCC 0: 1
1: 1
2: 4
3: 42
4: 435
Right 1163443575 19:17333910-17333932 TTCAAGGCCCCGGGAGCTCTGGG 0: 1
1: 0
2: 0
3: 6
4: 150
1163443564_1163443572 -1 Left 1163443564 19:17333879-17333901 CCGCCAGGGCTCCTCACCACTCC 0: 1
1: 1
2: 4
3: 42
4: 435
Right 1163443572 19:17333901-17333923 CACCTGGCATTCAAGGCCCCGGG 0: 1
1: 0
2: 6
3: 24
4: 205
1163443564_1163443574 7 Left 1163443564 19:17333879-17333901 CCGCCAGGGCTCCTCACCACTCC 0: 1
1: 1
2: 4
3: 42
4: 435
Right 1163443574 19:17333909-17333931 ATTCAAGGCCCCGGGAGCTCTGG 0: 1
1: 0
2: 0
3: 2
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163443564 Original CRISPR GGAGTGGTGAGGAGCCCTGG CGG (reversed) Intronic
900001156 1:15620-15642 GGAGGGCTGAGGACCTCTGGTGG + Intergenic
900020871 1:186141-186163 GGAGGGCTGAGGACCTCTGGTGG + Intergenic
900384934 1:2406180-2406202 AGTGTGGTGAGGACCCCGGGAGG + Intronic
900467477 1:2832896-2832918 GGGCGGGTGAGGAGCCATGGTGG - Intergenic
900474946 1:2871750-2871772 GGGGTGGTGAAGGGACCTGGGGG + Intergenic
900506998 1:3034725-3034747 GGAGTGGAGAGGGTCCCTGGAGG + Intergenic
900722248 1:4184743-4184765 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
900942015 1:5805127-5805149 GGAGTGGTGAGGAGGCCACGTGG - Intergenic
901158218 1:7154889-7154911 GGAGTGGGGAGGGGCTCTGCAGG - Intronic
901795130 1:11675470-11675492 GGGGCAGTGAGGAGCCCAGGTGG - Intronic
902051173 1:13564701-13564723 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
902286494 1:15411174-15411196 GGAGTGGGGAGGAGAGATGGGGG - Intronic
902856798 1:19212410-19212432 GTAGTGATGAGGAGGCCTGCTGG + Intergenic
902936700 1:19769737-19769759 GGGGTGGGGAGGAGCTCAGGAGG + Intronic
903660744 1:24976651-24976673 GGGGTGGGGAGAAGACCTGGGGG + Intergenic
903875186 1:26469169-26469191 GAAGGGGAGTGGAGCCCTGGAGG - Exonic
903919131 1:26787324-26787346 GGAGGTGAAAGGAGCCCTGGAGG + Intergenic
904473709 1:30751264-30751286 GGAGGGGTGAGGAGGCCGGTGGG - Intronic
904899634 1:33846809-33846831 GGAGAGGTGATGAGCCCTCCAGG + Intronic
905453631 1:38072999-38073021 GGAGAGGGGAGGAGTCCTGCTGG + Intergenic
905569173 1:38990938-38990960 GGCCTGGTGAGGGGCCATGGGGG - Intergenic
906163954 1:43671899-43671921 GGGGTGGGGAGCTGCCCTGGAGG + Intronic
906606952 1:47179513-47179535 GGAGTGGTGAAGAGCCCCGAAGG - Intergenic
909608446 1:77530167-77530189 AGAATTGTGGGGAGCCCTGGAGG + Intronic
909788006 1:79640448-79640470 TGTGTGGTGATGAGGCCTGGTGG + Intergenic
910000541 1:82336217-82336239 GTGGTGGTGAGGAGGGCTGGTGG - Intergenic
911967228 1:104384335-104384357 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
912376249 1:109212247-109212269 GCAGTGGTGAGGGGCCCTGGGGG + Intergenic
914445983 1:147751092-147751114 GGAGCTGGGAGGAGCCCTGAGGG - Intergenic
914988698 1:152480241-152480263 GGGGCGGAGAGGAGCCCTGCAGG - Intergenic
915446045 1:155975620-155975642 GCAGTGGAGAGGAGAGCTGGGGG - Intronic
916132650 1:161624755-161624777 GGAATGGTGGGGAGGTCTGGGGG + Intronic
916172208 1:162009799-162009821 GGAGAGGTGGGGAGCTCTTGAGG - Intronic
919419735 1:197355469-197355491 GGGCTGCTCAGGAGCCCTGGGGG + Intronic
920035400 1:203061870-203061892 TGGCAGGTGAGGAGCCCTGGAGG + Intronic
920244534 1:204577843-204577865 GGAGAATTGAGGAGCCCGGGAGG - Intergenic
920380621 1:205532602-205532624 CCAGTGTTGAGGAGACCTGGGGG - Intronic
920616372 1:207496403-207496425 GGCGTGGGGAGGCGCCCGGGCGG + Intronic
920661662 1:207920660-207920682 GGAGTAGAGAGGAGGCATGGGGG - Intergenic
922164596 1:223104615-223104637 GGAGGAGTGAGTAGCGCTGGAGG - Intergenic
922757114 1:228102733-228102755 GGAGTGGTGAGGACCTGTGGTGG - Intronic
923304417 1:232675072-232675094 GTAGAGCTGAGCAGCCCTGGAGG - Intergenic
923585689 1:235268061-235268083 GCAGTGAAGAGGAGGCCTGGGGG + Intronic
923977550 1:239280999-239281021 GCAGAGGTTAGGAGCACTGGAGG + Intergenic
924214867 1:241810614-241810636 GAAGTGGAGAAGTGCCCTGGGGG - Intergenic
1062804317 10:405817-405839 GGCTGTGTGAGGAGCCCTGGAGG - Intronic
1062896384 10:1106343-1106365 GGGGTGGAGAGCAGCACTGGTGG - Intronic
1064464399 10:15564864-15564886 GAAGTGGAGACAAGCCCTGGGGG + Intronic
1064961308 10:20967695-20967717 GGAGTGGTGACAAGACCTGCTGG + Intronic
1065498507 10:26354847-26354869 GGAGGGGTCAGCATCCCTGGAGG - Intergenic
1065928099 10:30454091-30454113 GTAGTGGTGAGGGGCCAAGGAGG - Intronic
1065957348 10:30705352-30705374 GAAGGGGTGAGGAGCGCTGTGGG - Intergenic
1066055832 10:31679099-31679121 GAAGAGGTGGGGAGCGCTGGGGG + Intergenic
1066436882 10:35403848-35403870 TGAGTGGTGATTAGGCCTGGTGG + Intronic
1069662318 10:70131994-70132016 GGAGTGGTGAGGTCTCTTGGGGG - Intronic
1069895643 10:71678669-71678691 GGAGTGGTGGGGACCACTGGAGG + Intronic
1070626574 10:78055138-78055160 AGAGAGATGTGGAGCCCTGGAGG - Exonic
1070729294 10:78814158-78814180 GGAGAGGTGGTGAGCACTGGAGG + Intergenic
1070952748 10:80444150-80444172 GGGGTGGGGCAGAGCCCTGGTGG + Intergenic
1071566794 10:86675236-86675258 GGGGAAGTGAGGAGACCTGGTGG + Intronic
1072294802 10:93998680-93998702 GAAGACTTGAGGAGCCCTGGGGG - Intronic
1072729689 10:97837383-97837405 GAAGTGGTGAGAAGGGCTGGGGG + Intergenic
1073265864 10:102228136-102228158 GGAGGGGTTAGGAGCCTGGGAGG - Intronic
1073473109 10:103736010-103736032 TGGTGGGTGAGGAGCCCTGGAGG + Intronic
1074823456 10:117198267-117198289 GGTGTTGTGAGAAGACCTGGGGG + Intronic
1074826576 10:117219208-117219230 GAAGTGGTGTTGTGCCCTGGTGG + Intergenic
1075404324 10:122184307-122184329 GGGGTGGGGGGGTGCCCTGGTGG + Intronic
1075633585 10:124015912-124015934 GGAGTGGTGACGAGCCCTGGTGG + Intronic
1076055185 10:127367061-127367083 GGAGTAGAGAGGAGACCTGCTGG + Intronic
1076116367 10:127904546-127904568 GGAGTGGTGAGGTGTTCAGGAGG + Intergenic
1076527802 10:131123392-131123414 GAAGAGGTGAGGAGCCCTGGGGG + Intronic
1077544245 11:3162243-3162265 GGAGTGGAGGCCAGCCCTGGAGG + Intronic
1079165219 11:18034539-18034561 GGCATGGTGAGGAGCCCTCAAGG + Intronic
1081865154 11:46355669-46355691 AGAGTGGGGTGGGGCCCTGGGGG + Intronic
1081989867 11:47332055-47332077 TGCGAGGTGAGGAGCCCTCGGGG - Exonic
1082836875 11:57657540-57657562 GGAGGGGTGAGGAGGCGTGGCGG - Exonic
1082997740 11:59266686-59266708 GGAGTGGTAAGGTGAGCTGGAGG - Intergenic
1083302228 11:61745256-61745278 TGGGTGGTGAGGATCCTTGGGGG - Exonic
1083333108 11:61908197-61908219 GGAGTCCCCAGGAGCCCTGGTGG - Exonic
1083476465 11:62918795-62918817 GGAGTGGAGAGAACCACTGGGGG + Intronic
1084004468 11:66315702-66315724 GGAGTGGTAGGGGACCCTGGGGG + Exonic
1084354518 11:68628510-68628532 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1084709443 11:70834997-70835019 GCAGCGGGGAGGAGCTCTGGAGG + Intronic
1084944864 11:72633018-72633040 GGAGGGGTGAGCTGGCCTGGGGG - Intronic
1085308112 11:75499944-75499966 GGTGTGGGGAGGATCCCAGGAGG - Intronic
1087873438 11:103326829-103326851 AGGGTGATGAGGACCCCTGGGGG + Intronic
1088400860 11:109422043-109422065 GGGGTGGCTTGGAGCCCTGGCGG + Intergenic
1088630621 11:111770821-111770843 GAAGTGGAGAGGAGACCTGAGGG - Intergenic
1089195539 11:116692263-116692285 GGAGTGGGGGAGAGCCTTGGAGG - Intergenic
1089281170 11:117375633-117375655 GGGGTAGTGAAGAGGCCTGGTGG + Intronic
1090245755 11:125214823-125214845 GGAGTGGACAGAAGCCTTGGAGG - Intronic
1090526512 11:127544244-127544266 TGTGTGGTGATGAGGCCTGGTGG + Intergenic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1090976904 11:131686944-131686966 GGAGTGAAGCGGCGCCCTGGTGG + Intronic
1091129048 11:133128563-133128585 CCAGTGGAGAGGACCCCTGGAGG + Intronic
1091282159 11:134387910-134387932 GCAGGGGTCAGGAACCCTGGGGG + Exonic
1091374245 12:15737-15759 GGAGGGCTGAGGACCTCTGGTGG + Intergenic
1093228344 12:16513387-16513409 GGAGCGCAGAGGAGCCATGGTGG - Intronic
1093953754 12:25193790-25193812 GGAGTGGAGAGCATTCCTGGCGG - Intronic
1094230156 12:28093381-28093403 GGCGTGGTGAGGAGCCATCCAGG + Intergenic
1096241585 12:49962683-49962705 GGAGAGGTGAGGGGCCCAGGAGG - Intronic
1096513507 12:52144585-52144607 GGTGTGGTGAGGATCTGTGGGGG + Intergenic
1096980972 12:55728252-55728274 TGAGTGGCGAGGGGTCCTGGGGG - Intronic
1101824619 12:108210394-108210416 GGAGTGATGGGGAGCCATGGAGG - Intronic
1102447527 12:113015103-113015125 GGAGTGTTGTGTAGACCTGGAGG + Intergenic
1103568650 12:121830007-121830029 GCAGTGGTGGGGGACCCTGGGGG + Intronic
1103965611 12:124637631-124637653 GGGGTGGTGAGGAGGTCAGGTGG - Intergenic
1104408490 12:128538490-128538512 GGAGGTGGGAGGATCCCTGGAGG - Intronic
1104727165 12:131085199-131085221 GGAGTGGTGAGGAGACAGCGGGG + Intronic
1104904539 12:132206165-132206187 GCAGGCGTCAGGAGCCCTGGGGG - Intronic
1106027812 13:25971915-25971937 GGGATGCTGAGGACCCCTGGGGG - Intronic
1106753197 13:32796005-32796027 GCAGTGGTGTGGCTCCCTGGAGG + Intergenic
1107004952 13:35599164-35599186 GGGGTGGTGAGGAGCCTGGTGGG - Intronic
1107655838 13:42591434-42591456 GGAGAGGACAGGAGCACTGGGGG - Intronic
1108579552 13:51817118-51817140 GGCGTGGTGGGGAGCCAGGGTGG + Intergenic
1108588262 13:51890047-51890069 GGAGTGCTGAGCAACACTGGTGG + Intergenic
1110100732 13:71598027-71598049 GGAGTGGAGAGGAGCCCTCTGGG - Intronic
1112285826 13:98103597-98103619 GGAGGGTAGAGGAGCCCTGAAGG - Intergenic
1112361542 13:98723559-98723581 GGAGTCCTGAGGACACCTGGCGG + Intronic
1112695097 13:101938961-101938983 GGAGTGGGGATGAGCACTGATGG + Intronic
1114266249 14:21074355-21074377 GGAGGGCTGGGAAGCCCTGGAGG - Exonic
1115292751 14:31791136-31791158 GGAGTGGTGACGTGCACTTGTGG + Intronic
1116490321 14:45497097-45497119 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1116963090 14:50986841-50986863 GCAGTGGTGAGGTGCATTGGTGG + Intronic
1117255557 14:53973647-53973669 CCAGTGGTGGGCAGCCCTGGAGG + Intergenic
1117770991 14:59134589-59134611 GGAGTGGTCAGAGGCTCTGGAGG - Intergenic
1117981929 14:61350187-61350209 GGAGAGGGGAGGAGACGTGGAGG - Intronic
1118004676 14:61554616-61554638 AGAGTAGTGGGCAGCCCTGGGGG + Intronic
1118589600 14:67391581-67391603 GGAGTGGTGCCGAGCCGTGTAGG + Intronic
1118745250 14:68768580-68768602 GGAGTAGTGAGCAGCCCTTGAGG - Intergenic
1119163708 14:72474973-72474995 GGACAGTTGAGGAGCCCAGGAGG + Intronic
1119182616 14:72614881-72614903 GGAGGGGTGAGGATCTCTGGTGG - Intergenic
1119348467 14:73944941-73944963 GGACTGGGGAGGAGGTCTGGAGG - Intronic
1119404457 14:74388913-74388935 GGGCTGGGGAGGAGCCCTGTGGG - Intergenic
1119544348 14:75460744-75460766 GGAGAGCTGAGGGACCCTGGGGG + Intronic
1119715198 14:76854099-76854121 GGAGTGGAGAGAAGACCAGGGGG - Intronic
1120203450 14:81562987-81563009 GGAGGAGTGATGAGCCCTGCTGG + Intergenic
1121980340 14:98448990-98449012 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1122062312 14:99144153-99144175 GGTGTGGCGATGAGGCCTGGGGG - Intergenic
1122278358 14:100606983-100607005 GGAGTGGTGAGGAGACCTAAGGG - Intergenic
1122355932 14:101122821-101122843 TGACAGGTGAGCAGCCCTGGAGG - Intergenic
1123113850 14:105885062-105885084 GGAGGGGACAGGAGCCCGGGAGG - Intergenic
1123116077 14:105894697-105894719 GGAGGGGACAGGAGCCCGGGAGG - Intergenic
1123218176 14:106831534-106831556 GGGGTGGTGAGGACACCAGGGGG - Intergenic
1123403038 15:20004988-20005010 GGAGGGGACAGGAGCCCTGGAGG - Intergenic
1123512378 15:21011642-21011664 GGAGGGGACAGGAGCCCTGGAGG - Intergenic
1124070469 15:26388308-26388330 GCAGTGGGGAGGAGAGCTGGAGG - Intergenic
1124706620 15:31972017-31972039 GGGGAGGTGGGGAGCTCTGGAGG - Intergenic
1127783819 15:62338981-62339003 GGAGTGGTGAGGCACCCCGGGGG + Intergenic
1127793919 15:62422561-62422583 AGAGTTGAGAGGAGCCCCGGAGG + Intronic
1128080304 15:64853235-64853257 TGAGTGGGGATGAGGCCTGGGGG + Intronic
1128304548 15:66589324-66589346 GAAGTGTTGAGGGGACCTGGAGG + Intronic
1128581194 15:68811345-68811367 GGAGTGGCTAGGTGCCCAGGAGG + Intronic
1128678064 15:69626313-69626335 GGTTGGGTGAGGAGCCCTGGAGG - Intergenic
1129016807 15:72475201-72475223 GGTGTGGGGAGGTGCGCTGGGGG + Intronic
1129228665 15:74184467-74184489 TGAGTGGTGAGGAGCACTGAAGG - Intronic
1129785684 15:78308659-78308681 GGAGTCTGGAGGAGCCCAGGAGG - Intergenic
1129881105 15:79006492-79006514 GCAGTGATGAGCAGGCCTGGTGG - Intronic
1130014807 15:80178334-80178356 GGAGTGATGAAGTGACCTGGAGG - Intronic
1130760686 15:86816331-86816353 AGAATAGTGAGGAGGCCTGGAGG + Intronic
1131119785 15:89814949-89814971 GGACGGGGGAGGAGCCCGGGCGG - Intronic
1131731629 15:95287677-95287699 GGAGAGGGGAGGAGGCCTGGGGG + Intergenic
1132156212 15:99496982-99497004 GGATTGTTGACGAGGCCTGGTGG + Intergenic
1132454542 16:15304-15326 GGAGGGCTGAGGACCTCTGGTGG + Intronic
1132463448 16:66838-66860 GCATGGGTGAGGGGCCCTGGAGG - Intronic
1132615745 16:840425-840447 GTCGGGCTGAGGAGCCCTGGGGG + Intergenic
1132912774 16:2323940-2323962 CGAGTGTTCAGGATCCCTGGAGG + Intronic
1133014458 16:2933075-2933097 GGGGTGGAGAGGAGCCCAGGAGG - Intronic
1133390236 16:5404142-5404164 GGAGGGGTGAGGAGATATGGGGG + Intergenic
1134036096 16:11032589-11032611 GGAGTGATGAGGAAGCCTAGTGG + Intronic
1135025147 16:18993933-18993955 TGAGTGGTGATTAGGCCTGGTGG + Intronic
1135114264 16:19712191-19712213 GGAGTTGGGAGGAACCCTAGAGG - Intronic
1135473271 16:22751252-22751274 GAAGTGGAGAGGAGATCTGGTGG + Intergenic
1136004369 16:27318640-27318662 GAAGAGGTGAGGAGGCCTGTGGG - Intronic
1136402138 16:30024796-30024818 CGGGTGATGGGGAGCCCTGGGGG + Exonic
1138195326 16:55047739-55047761 GGAGATGTGAGGGGCACTGGTGG - Intergenic
1138276217 16:55736826-55736848 GGGGTGGTGAGGAGATCAGGAGG - Intergenic
1138405854 16:56793374-56793396 GTAGTGATGGGGAGCTCTGGGGG + Intronic
1139209898 16:65067032-65067054 GGTGTGGTGGGGAGAGCTGGAGG + Intronic
1139997619 16:70995737-70995759 GGAGGGGTGGGCAGCCCTGCAGG + Intronic
1141792963 16:86249111-86249133 GGAGTTGAGGGGAGCCCCGGAGG + Intergenic
1141878384 16:86841916-86841938 AGAGTGGAGAGGAGACTTGGGGG - Intergenic
1141887323 16:86901492-86901514 GGAGTGCTGGGGAGCCTTGGAGG + Intergenic
1141990036 16:87604019-87604041 GGAGTGATGGGGAGCGCTAGGGG + Intronic
1142168485 16:88606842-88606864 GGAGAGTTGAGGAGGCCTCGAGG + Intronic
1142356244 16:89603514-89603536 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356279 16:89603596-89603618 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356297 16:89603637-89603659 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356351 16:89603758-89603780 GGGCTGGAGGGGAGCCCTGGAGG + Intergenic
1142356484 16:89604119-89604141 GGGCTGGAGGGGAGCCCTGGGGG + Intergenic
1142356627 16:89604506-89604528 GGACTGGAGGGGAGCACTGGGGG + Intergenic
1142375235 16:89703155-89703177 GGACTGGTGTGGACCCATGGTGG - Intergenic
1142740754 17:1930620-1930642 GTGGTGGTGAGGGGCCTTGGCGG + Intergenic
1142977889 17:3656251-3656273 GCAGGGGTGAGGACCCCAGGGGG - Intronic
1144453869 17:15403361-15403383 GGAGTGAAGAGAGGCCCTGGTGG - Intergenic
1144657102 17:17043539-17043561 CGAGGGGTGAGGAGACCTGTGGG + Intronic
1144940185 17:18933382-18933404 GGTGTGGTGGGGAGTGCTGGGGG + Intergenic
1145006765 17:19342795-19342817 GGAATGGTGAGGTACCCCGGGGG - Intronic
1145080413 17:19890334-19890356 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1145252900 17:21306019-21306041 GATGTGGTGAGAAGCGCTGGCGG + Intronic
1145323676 17:21781897-21781919 GATGTGGTGAGAAGCGCTGGCGG - Intergenic
1146454606 17:32999083-32999105 AGAGTGGTGAAGAACCCTGCTGG + Intergenic
1146940434 17:36840347-36840369 GGAGTGGGGTGGAACACTGGTGG - Intergenic
1147157130 17:38549637-38549659 GGAGGGGCCAGGATCCCTGGAGG - Intronic
1147371827 17:39997736-39997758 CGGCTGGGGAGGAGCCCTGGGGG - Exonic
1147690691 17:42312809-42312831 GGGGTGGGGAGAAGCCCTGTGGG + Intergenic
1148219744 17:45853042-45853064 AGAAGGGTGAGGTGCCCTGGAGG + Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148351218 17:46943355-46943377 GGGGTGGTGGGGAGGGCTGGGGG - Intronic
1148800046 17:50219082-50219104 GGGGTGGTGAGGAGCTGAGGTGG + Intergenic
1149220808 17:54413717-54413739 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1151413658 17:73947630-73947652 GGAGTGGGGAGGAGCCTCGTGGG + Intergenic
1151423735 17:74016188-74016210 GGAGTGGAGAGGGAGCCTGGGGG - Intergenic
1151503038 17:74504562-74504584 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1152148069 17:78581123-78581145 GGAGAGCTGAGGAGCCCAGCGGG - Intergenic
1152215953 17:79032565-79032587 GGAGAGGAGAGGAGACCTGCAGG + Intronic
1152637308 17:81435410-81435432 AGCGTGGGGAAGAGCCCTGGGGG - Intronic
1152749232 17:82055003-82055025 GCAGTGGTCAGGAATCCTGGGGG - Intronic
1153805641 18:8706456-8706478 GGCGCGGCGAGGAGCGCTGGGGG - Intronic
1154163851 18:11999538-11999560 GGAGTGGTGATGTCCCCTGGTGG + Intronic
1155508256 18:26551046-26551068 GCAGAGGTGGGGAGACCTGGGGG - Intronic
1155591909 18:27436857-27436879 TCAATGGTGAAGAGCCCTGGAGG - Intergenic
1155892504 18:31286453-31286475 TGAGTGGCGATGAGGCCTGGTGG + Intergenic
1156402591 18:36753258-36753280 GTAGTGTGCAGGAGCCCTGGAGG - Intronic
1156505554 18:37588552-37588574 GGAGTGGTCAGCTGCACTGGTGG + Intergenic
1157166797 18:45365093-45365115 GGAGTGGTGAGGGGAGATGGAGG - Intronic
1157546557 18:48550573-48550595 AGAGTGGAGAGGAGCCCAGAGGG - Intronic
1157572704 18:48723575-48723597 GGAGTGGTGGGCAGCTCAGGGGG + Intronic
1158608744 18:58919543-58919565 AGACTGGAGAGGCGCCCTGGGGG - Exonic
1160015747 18:75139329-75139351 GGAGAGGAGAGGAGCCCCGTAGG + Intergenic
1160909834 19:1469361-1469383 GGCGGGGCGAGGCGCCCTGGGGG - Exonic
1161014703 19:1977969-1977991 GGAGGAGTGTGGAGCCCTTGGGG + Intronic
1161253781 19:3295184-3295206 GGAGTGGCGAGGGGCCTTTGGGG + Intronic
1161725090 19:5924012-5924034 GGAGTGGGCAGGAGTGCTGGGGG - Intronic
1161800323 19:6413982-6414004 GGAGTACTGGGGAGCCCTCGCGG - Exonic
1161952344 19:7474865-7474887 GGAGTGCTGAGGAAGGCTGGGGG - Intergenic
1163022262 19:14488837-14488859 GGAACAGTGAGGAGGCCTGGGGG + Intronic
1163094608 19:15047591-15047613 CGAGTGGGGAGGATCCCTTGAGG + Intergenic
1163156119 19:15440666-15440688 GGGGTGGTGGGGAGCCCGGCCGG + Intronic
1163288888 19:16365725-16365747 AGAGTGGTGAGGGACCCTGGGGG - Intronic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1163582282 19:18145887-18145909 GGGGTGCTGGGGAGCCCTGAGGG - Intronic
1163772350 19:19198731-19198753 GGAGTCGGGAGTGGCCCTGGGGG + Intronic
1163866330 19:19776425-19776447 GGGGTGGTGCGTAACCCTGGAGG - Intergenic
1163899889 19:20091960-20091982 TGAGTGGTGATTAGGCCTGGTGG + Intronic
1164220325 19:23187461-23187483 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1164671676 19:30076135-30076157 GGAGTGGTGAGCGGGGCTGGCGG + Intergenic
1165068925 19:33244065-33244087 GAAGGGGTGAGGAGCTCTGAGGG - Intergenic
1165258262 19:34592902-34592924 CGAGTCCTGGGGAGCCCTGGAGG + Intergenic
1166198161 19:41219857-41219879 GGAGGGCTCTGGAGCCCTGGGGG + Intronic
1166322092 19:42024820-42024842 GAAGGTGTGAGGAGCCCTGGAGG - Intronic
1166589555 19:43984732-43984754 GAAGTGGTCAGGTGCCCGGGTGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1167284564 19:48591763-48591785 GGGGTGGGGAGGAGCCCCAGAGG + Intronic
1168279346 19:55296136-55296158 GGAGTGGGGAGGAGGAGTGGGGG - Intronic
1168322414 19:55518124-55518146 GGTGGGGTGAGGAGTCGTGGTGG - Exonic
1168522130 19:57060842-57060864 GCCGAGGTGAGGAGCCATGGGGG - Intergenic
1168565257 19:57416981-57417003 GGTGTGGTGAGGAGCACTGAAGG + Intronic
925125560 2:1453415-1453437 GGAGTGGGAAGGAACCCTGCAGG + Intronic
925561106 2:5196613-5196635 TGAGTGGTGAGCTGCTCTGGTGG + Intergenic
925942020 2:8829979-8830001 GGAGTGTGGAGCAGCACTGGGGG - Intronic
928213005 2:29337706-29337728 GGGGTGGTGAGAAGTGCTGGAGG - Intronic
928460329 2:31466508-31466530 GGGGTGGTGAGGAAGGCTGGGGG - Intergenic
928656720 2:33459656-33459678 GGAGTGGTGAGGGGACAAGGAGG + Intronic
929779738 2:44949873-44949895 GGAGCGGTGGGAAGCCGTGGGGG - Intergenic
933199817 2:79436018-79436040 GGAGTGGTCAGGAACCCGTGTGG - Intronic
933744077 2:85557985-85558007 GCAATGCTGAGCAGCCCTGGTGG + Intronic
933849908 2:86357736-86357758 TGACCGCTGAGGAGCCCTGGAGG + Intergenic
933897339 2:86823911-86823933 AGACTGAGGAGGAGCCCTGGGGG + Intronic
934612551 2:95751950-95751972 GGAGAAGTGAGGAGGGCTGGTGG + Intergenic
934648363 2:96072473-96072495 GGAGAAGTGAGGAGGGCTGGTGG - Intergenic
935924241 2:108050196-108050218 GGAGTGGGGAGGAACACTTGGGG + Intergenic
936568567 2:113597792-113597814 GGAGGGCTGAGGACCTCTGGTGG - Intergenic
938397724 2:130963482-130963504 GCGGTGGTGAGGAGGGCTGGTGG - Intronic
938902819 2:135812471-135812493 GGATTCGTGTGGTGCCCTGGGGG - Exonic
939983531 2:148808745-148808767 AGACTGTTGAGGAGCTCTGGAGG + Intergenic
941308361 2:163898227-163898249 GGAGTGCTCAGGTGCCCAGGTGG - Intergenic
942813604 2:180025132-180025154 AGAGTGGTCATGAGCCCTGGTGG - Intergenic
945173772 2:207021613-207021635 TGTGTGGTGAGTAGGCCTGGTGG - Intergenic
945653430 2:212593208-212593230 GGAGGTGGGAGGATCCCTGGAGG - Intergenic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
947643582 2:231721695-231721717 GGAGTGGTGAGTAAGACTGGTGG - Intergenic
1169252757 20:4072895-4072917 TGAGTCCTGAGGATCCCTGGAGG + Intronic
1169268597 20:4182363-4182385 AGGGTGGAGAGGAGCCCCGGGGG + Exonic
1169328776 20:4699578-4699600 GCAGTGGTGGGGGGCCTTGGCGG + Exonic
1172745243 20:37202542-37202564 GGAGAGGAGAGGCCCCCTGGTGG - Intronic
1172937241 20:38629137-38629159 GCAGTAGGGAGGAGCCCTGAGGG + Intronic
1173681349 20:44884828-44884850 GGAGGGGAGGGGAGCCATGGAGG + Intergenic
1173860207 20:46278152-46278174 GGAGTGCCTAGGAGCCCAGGGGG - Intronic
1174285974 20:49473847-49473869 AGAGAGGTGAGGCGCCTTGGGGG + Intronic
1174299082 20:49568752-49568774 GGGGTGAGGAGGAGCCTTGGGGG - Intergenic
1175903759 20:62370013-62370035 GGTCTGCTGCGGAGCCCTGGGGG + Intergenic
1175939466 20:62531380-62531402 GGGGTGGCGGGGAGCCATGGGGG - Intergenic
1176047709 20:63101293-63101315 GGAGTGTTGAGGGGGCCTGAAGG + Intergenic
1177039799 21:16094440-16094462 TGGGTGGTGGGGAGCCCTGCTGG + Intergenic
1177840452 21:26229528-26229550 GGTGTGGTGATTAGGCCTGGTGG + Intergenic
1178379482 21:32095960-32095982 GGAGTTGTAAGAAGCCCTGTAGG + Intergenic
1178639903 21:34337376-34337398 GAAGTGGTGAGGGGGCCTGGGGG + Intergenic
1178920659 21:36736157-36736179 GGAGTCCTGAGGGGCCCGGGCGG - Intronic
1179197039 21:39173960-39173982 GGAGTGGGGAGCTGCTCTGGGGG - Intergenic
1179713118 21:43274380-43274402 GGAGGGGAGGGGAGCCCGGGAGG - Intergenic
1179793444 21:43768683-43768705 GGAGCGGTGCGGAGCTGTGGTGG - Intergenic
1180068358 21:45424038-45424060 GCAGTGCTGCGGGGCCCTGGTGG + Intronic
1181475882 22:23167489-23167511 GGAGTGGAGAGGAGGCCAGCAGG + Intergenic
1181521796 22:23452528-23452550 GGAGAGGAAAGGAGCCCTTGGGG - Intergenic
1181711402 22:24694179-24694201 GGACTGGTGTGTACCCCTGGGGG + Intergenic
1183211341 22:36453294-36453316 GCAGTGGTGAGCAGCCCAGCAGG - Intergenic
1183239500 22:36646741-36646763 GGGGTTGTGGGGAGCCCAGGGGG - Intronic
1183334904 22:37241016-37241038 GGAGTGATGGGGACCCCTGAGGG + Intronic
1183565566 22:38612006-38612028 GGAGTGGGGAGGAGAAGTGGGGG - Intronic
1183697713 22:39432593-39432615 GGAGTGTTCAGGGGCCATGGTGG - Intronic
1183961386 22:41413777-41413799 GGTGTGGAGAGGAGCCGGGGTGG - Intergenic
1184422271 22:44389178-44389200 GGAGTGCTGAGGAAGCCTGCTGG + Intergenic
1184557552 22:45241213-45241235 GGAGGGGAGAGGTGCCCTGAAGG - Intergenic
1184640587 22:45867992-45868014 GGAGTGGTGGGGGGCCCGGGGGG - Intergenic
1184687775 22:46104287-46104309 GGAGTGGTGATGGGGCCGGGAGG - Intronic
949481769 3:4500991-4501013 GGAGTGGTGGGGCACGCTGGTGG - Intronic
949862200 3:8515916-8515938 GGAGTGGGGAGGAGACTTCGTGG + Intronic
950212985 3:11137449-11137471 GGAGGGGTGACGGGCTCTGGGGG + Intronic
950499665 3:13355604-13355626 GGAGTTGGGAGGAGCCCTCATGG - Intronic
950552557 3:13675492-13675514 GGTGGGGTGAGGAACACTGGAGG - Intergenic
950650489 3:14403849-14403871 GGACTGGAGAGGAGACCTGTGGG + Intronic
950672810 3:14537345-14537367 GGAGTGGAGAGGAGGTGTGGAGG - Intronic
950702337 3:14759113-14759135 GGAGTGGGCAGCAGGCCTGGAGG + Intronic
950702804 3:14761728-14761750 GGAGTGGGGAGGGGGGCTGGAGG + Intronic
953822694 3:46222032-46222054 GGACTGGGCAGGAGCCCTGAAGG + Intronic
954072187 3:48151065-48151087 GGAATAGTGAGGAGTCCTTGGGG + Intergenic
954315942 3:49801925-49801947 GGTGTGATGAGGAGCAATGGGGG - Intergenic
955404703 3:58618752-58618774 GGAGTGAAGAAGGGCCCTGGTGG + Intronic
961382999 3:126508191-126508213 GGAGTGGAATGGAGACCTGGGGG - Intronic
961434132 3:126904909-126904931 GGAAGGGTGGGGTGCCCTGGTGG + Intronic
961779944 3:129315506-129315528 GGAGCGGCGCGGAGCCCCGGCGG - Exonic
964450209 3:156805151-156805173 TGTGTTGTAAGGAGCCCTGGAGG - Intergenic
964714634 3:159708881-159708903 GGAGTGGGGAGGTGCACAGGGGG + Intronic
964940659 3:162155644-162155666 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
965477878 3:169179899-169179921 GGACTGATGGGGAGTCCTGGGGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967963288 3:194941955-194941977 AGGGTGGAGAGGAGGCCTGGAGG - Intergenic
968235752 3:197029371-197029393 GGCGTGGTGGGGAGGCCTCGGGG - Intronic
968439282 4:613393-613415 CGAGTGGTGGGGATGCCTGGAGG - Intergenic
968600986 4:1509214-1509236 GGAGTGCAGAGGAGGCCCGGAGG - Intergenic
968962672 4:3753312-3753334 GGCGTCCTGAGGAGCCCAGGGGG + Intergenic
969818718 4:9705022-9705044 GGGGTGGGTGGGAGCCCTGGTGG - Intergenic
969839292 4:9868857-9868879 GCAGTGGTGAGGTTCCCAGGGGG + Intronic
971756684 4:30717309-30717331 GGAGGTGAGAGGAGCCCTCGGGG - Intergenic
971858335 4:32071976-32071998 AGGGAGATGAGGAGCCCTGGAGG + Intergenic
972596616 4:40535216-40535238 GGAGTTGTAAGGAACCCTAGAGG - Intronic
973582710 4:52359873-52359895 TGACTGGTGAGTAGCCCTGTTGG - Intergenic
973792878 4:54394702-54394724 GAAGTGGTGAGCAGCACTGAAGG - Intergenic
977145401 4:93433614-93433636 GGAGTGGGGATGAGCACAGGAGG - Intronic
977464933 4:97372009-97372031 GGTTTCATGAGGAGCCCTGGTGG + Intronic
978041307 4:104066494-104066516 GGATTGGTAAGGTGCCCTAGAGG + Intergenic
978203126 4:106046586-106046608 GGGATGGTGAGGAGGCCTGTTGG + Exonic
978869712 4:113560814-113560836 GCAGTGGTGTGGAGCCCTCTAGG - Intronic
982721370 4:158863467-158863489 GTAGTGCTGAGCAGCCATGGAGG - Intronic
983528310 4:168783475-168783497 GGAGAGGTGATGAGACCAGGAGG + Intronic
983883464 4:172957878-172957900 TGAGTGGTGATTAGGCCTGGTGG + Intronic
985078735 4:186243870-186243892 TGAGTGGTGATTAGGCCTGGTGG + Intronic
985539534 5:481725-481747 GGCGTGGTGAGGGGGGCTGGTGG - Intronic
985631851 5:1017989-1018011 TGTGTGGTGAGGAGGCATGGAGG + Intronic
986368655 5:7059653-7059675 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
987118096 5:14742318-14742340 AGAGAGGAGAGGAGCCCTGGAGG - Intronic
987547634 5:19333395-19333417 GGAGTGGTGGGGTGCACAGGGGG + Intergenic
988870639 5:35385313-35385335 GGAGCGGTGAGGGGCCCTTTTGG - Intergenic
990488083 5:56278678-56278700 GCTGTGGTGAGTGGCCCTGGAGG + Intergenic
992955254 5:81901669-81901691 GGAGACCTGAGAAGCCCTGGTGG + Intergenic
993330665 5:86596208-86596230 CAAGTGGTCAGGTGCCCTGGTGG + Intergenic
994046753 5:95318818-95318840 GGAGTTGGAAGGAGCCCTAGAGG + Intergenic
994053127 5:95384454-95384476 GGAAAGGTGAGGAGCCCTAAGGG + Intergenic
994171323 5:96662358-96662380 AGAGTGGCGGGGAGGCCTGGCGG - Exonic
994295401 5:98083062-98083084 TGAGTGGTGATTAGGCCTGGCGG - Intergenic
999523351 5:152375877-152375899 ACAGTAGTGAAGAGCCCTGGGGG + Intergenic
1001279791 5:170378630-170378652 CAAGTGGGGAGCAGCCCTGGGGG + Exonic
1001476369 5:172054010-172054032 GGAGAGGTGGGGAGGCATGGAGG - Intronic
1001546737 5:172575083-172575105 GGGGTGGGGTGGTGCCCTGGGGG - Intergenic
1002098569 5:176846228-176846250 AGAGGAGGGAGGAGCCCTGGAGG + Intronic
1002567713 5:180120988-180121010 GGAGTTGGGAGGAGCCCACGGGG - Intronic
1002633626 5:180596553-180596575 GGACCGGTGGGCAGCCCTGGTGG + Intergenic
1006184410 6:32172622-32172644 GGAGTGGTTAGGAACACAGGCGG - Intronic
1006193339 6:32222681-32222703 GGAGAGCTGGGGAGCCCTAGGGG + Exonic
1006415660 6:33902390-33902412 GGAGTGGTGGGAAGCCAAGGCGG + Intergenic
1007300666 6:40865613-40865635 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1009464641 6:63954248-63954270 TGAGTGGTGATTAGGCCTGGTGG - Intronic
1010586431 6:77662269-77662291 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1011281600 6:85683564-85683586 GAAGTGGAGTGGAGCCCAGGTGG + Intergenic
1013319616 6:108974579-108974601 GGAGTGGGGAGGATCCCATGAGG + Intergenic
1014783670 6:125593199-125593221 GGACTGCTGAGGAGTCCTTGAGG - Intergenic
1016778860 6:147936429-147936451 GGAGTGGCGAGGGGCAGTGGTGG + Intergenic
1017669854 6:156760540-156760562 AGAGAGGTTAGGAGGCCTGGAGG - Intergenic
1017764574 6:157596072-157596094 GGTGTTTTGAGGAGCCCTGTGGG - Intronic
1018710865 6:166497501-166497523 GGAGAGGTGAGCAGCCCGTGCGG + Intronic
1018937472 6:168283246-168283268 GAAGGGGTGAGGAGCCCTCTGGG + Intergenic
1019589542 7:1823953-1823975 GGAGAGGAAAGGAGCCCTCGGGG + Intronic
1019599303 7:1873455-1873477 GGGCAGGTGGGGAGCCCTGGTGG + Intronic
1019705611 7:2495923-2495945 GGGGTGGTCAGGGGCCCTGGTGG - Intergenic
1019724621 7:2594609-2594631 GGAGAGGTGCTGGGCCCTGGGGG + Intronic
1019737217 7:2656529-2656551 AAAGAGGTGAGGGGCCCTGGGGG + Exonic
1019881259 7:3863245-3863267 GGAGAGGTAAGGAACCCAGGAGG - Intronic
1021172977 7:17418080-17418102 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1022506945 7:30913386-30913408 GGACAGGTGAGCAGGCCTGGGGG + Intronic
1023054962 7:36283845-36283867 AGAGTGGTGATGAGCACTGCTGG + Intronic
1025250178 7:57346638-57346660 AGAGGGGTGAGAAGCCCTGGAGG + Intergenic
1025639524 7:63353737-63353759 GGGGTGGTGAGCAGTCCCGGAGG - Intergenic
1025639582 7:63354006-63354028 TGAGCGGTGCGGATCCCTGGAGG - Intergenic
1025643117 7:63394086-63394108 TGAGCGGTGCGGATCCCTGGAGG + Intergenic
1025643175 7:63394355-63394377 GGGGTGGTGAGCAGTCCCGGAGG + Intergenic
1025712537 7:63926199-63926221 GGAGTGGTACAGATCCCTGGAGG + Intergenic
1025712566 7:63926335-63926357 GGGTTGGTGAGGACACCTGGGGG + Intergenic
1026734622 7:72941923-72941945 GGGCTGGGGAGCAGCCCTGGCGG - Exonic
1026784957 7:73296835-73296857 GGGCTGGGGAGCAGCCCTGGCGG - Intergenic
1026936603 7:74260111-74260133 GGAGTGGTGAGAAGCGCTGGAGG + Intergenic
1027109120 7:75423095-75423117 GGGCTGGGGAGCAGCCCTGGCGG + Exonic
1029317488 7:99727636-99727658 TGAGTGGTGATTAGGCCTGGTGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1030181962 7:106719336-106719358 GGAGTGGTGAGATGCGGTGGAGG - Intergenic
1032785942 7:135199474-135199496 GGAGTGGGGAGGTGGCCTGTTGG + Intronic
1035099031 7:156381461-156381483 GGAGTGGGAAGGAGCCGTGAGGG - Intergenic
1035564980 8:635393-635415 TTAGTGGTGATGAGCCCTGCGGG - Intronic
1036149384 8:6283706-6283728 GGAAGGGTGAAGAGCCCTGCAGG - Intergenic
1037549631 8:19957575-19957597 GGAGTGGTGAGGTGCCCCTAGGG - Intronic
1038132625 8:24750046-24750068 GCATTGGTGATGAGGCCTGGTGG - Intergenic
1038372352 8:27006833-27006855 GGGGTGGGGAGGAGGCCTGGAGG + Intergenic
1038641694 8:29334076-29334098 TGTGTGTTGAGGAGCCCTGGGGG - Exonic
1041279891 8:56198773-56198795 TCAGAGGTGAGGAGTCCTGGGGG - Intronic
1044519904 8:93187335-93187357 GAAGTGGTGGGGGGTCCTGGGGG + Intergenic
1046438692 8:114230469-114230491 GGGGTGGGGAGGAGCCTGGGTGG - Intergenic
1048020823 8:130537453-130537475 GGAGTGGTAAGGAGACCCGAGGG - Intergenic
1048294334 8:133203227-133203249 AGAGGAGTGAGGAGCCCTTGTGG - Intronic
1049165291 8:141121974-141121996 GGGGTGTGGAGGAGCCCCGGGGG - Intronic
1049367574 8:142248054-142248076 CGAGAGGTGATGAGGCCTGGCGG + Intronic
1049417676 8:142502946-142502968 GTAGTGGTGGTGAGACCTGGTGG + Intronic
1049471620 8:142777383-142777405 GGCTTGGTGAGTAGCCCAGGAGG - Intronic
1049883960 9:15733-15755 GGAGGGCTGAGGACCTCTGGTGG + Intergenic
1051478295 9:17532607-17532629 GGAGAGGTGAAGAGACCTGGAGG + Intergenic
1052348784 9:27436991-27437013 GGAGTGGGGGGAAGACCTGGGGG + Intronic
1052572338 9:30242477-30242499 GTACTAGTGAGGAGCCTTGGGGG + Intergenic
1052745012 9:32432149-32432171 GCTGTGGCGAGGACCCCTGGTGG + Intronic
1052952303 9:34222706-34222728 GGAGTAGTGCTGAGCCCGGGAGG + Intronic
1053287544 9:36859589-36859611 GGAAGGGTGAGGAGCCGGGGAGG - Intronic
1053287811 9:36861142-36861164 GATGTCCTGAGGAGCCCTGGTGG + Intronic
1053605914 9:39658444-39658466 AGGGAGGTGGGGAGCCCTGGGGG + Intergenic
1053863832 9:42415068-42415090 AGGGAGGTGGGGAGCCCTGGGGG + Intergenic
1054247632 9:62683972-62683994 AGGGAGGTGGGGAGCCCTGGGGG - Intergenic
1054561747 9:66718497-66718519 AGGGAGGTGGGGAGCCCTGGGGG - Intergenic
1056722229 9:89082143-89082165 GGGGTTGGGTGGAGCCCTGGAGG - Intronic
1057318622 9:93991077-93991099 GGAGTGGTGGGGTGCCACGGAGG - Intergenic
1058816235 9:108685005-108685027 GGAGTGGGGAGGAGCTCTCTGGG - Intergenic
1059332631 9:113545470-113545492 GGAATGGGGAGGAGAGCTGGTGG - Intronic
1059485254 9:114622045-114622067 GGAGAGGTGAGGATGCCAGGAGG + Intronic
1059747126 9:117214121-117214143 GGAGTTGTGAGGAGCCTCAGAGG - Intronic
1059985311 9:119815233-119815255 GGAGAGGTGAGGAACCCTCCTGG + Intergenic
1060152871 9:121299857-121299879 GGGGCGGTGCGGAGCCATGGTGG - Exonic
1060402152 9:123355505-123355527 GCAGGGGTGAGGTGCCCTGCAGG + Intergenic
1060816571 9:126638343-126638365 GGAGTCCTGGGGAGCCCTGGAGG - Intronic
1061052818 9:128206096-128206118 GGAGAGGTCAGGAGCCCTTGAGG - Intronic
1061087317 9:128406734-128406756 GGTGTGATGAGGGGGCCTGGTGG - Intergenic
1061194102 9:129098203-129098225 GGAGGAGGGAGGAGACCTGGGGG - Intronic
1061329899 9:129885857-129885879 GAGGTGGTGGGGACCCCTGGCGG - Intergenic
1061609306 9:131735725-131735747 GGAGTGGTGAGGGGCTCTGTGGG + Intronic
1061661209 9:132131470-132131492 GCAGTGGTGGGGAGCATTGGTGG + Intergenic
1061953459 9:133949319-133949341 GGAGTGGCCAGGAGACCTTGTGG - Intronic
1061954627 9:133955382-133955404 GGAGTGGGGAGGAGCGTGGGCGG - Intronic
1061954734 9:133955676-133955698 GGAGTGGGGAGGAGCTTTGGGGG - Intronic
1062401920 9:136376550-136376572 GGAGTGAGGAGGGGCCCTGTGGG + Intronic
1062432584 9:136532678-136532700 GGGGCTGTCAGGAGCCCTGGGGG + Intronic
1062556015 9:137113788-137113810 GGAGTGGGGAGAAGGGCTGGGGG + Intronic
1062641225 9:137519615-137519637 GGACACGTGAGGAGACCTGGGGG + Intronic
1186445194 X:9621168-9621190 GGATAGGTGAGGAGCTATGGAGG + Intronic
1186598057 X:11006166-11006188 GGAGAGGTAAGGGGACCTGGTGG - Intergenic
1186626691 X:11301906-11301928 GGAGTGGTGAGGAAAGCTGTTGG - Intronic
1195572818 X:106415483-106415505 GGATTGCTGAGGACCCCTGGTGG - Intergenic
1195682729 X:107560939-107560961 GCAGTGGTGAGGATCCCTAGAGG - Intronic
1196220721 X:113110436-113110458 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1196892542 X:120305498-120305520 GAAGCAGTGAGGAGCCCTGATGG + Intronic
1197881363 X:131170284-131170306 GAAATGGTGAGGAGCCTTTGTGG + Intergenic
1198383460 X:136105463-136105485 GAAGGGAGGAGGAGCCCTGGAGG + Intergenic
1199377637 X:147132643-147132665 TGAGTGGTGATTAGGCCTGGTGG + Intergenic
1199862815 X:151817062-151817084 GGAGTCATGAGCAACCCTGGGGG - Intergenic
1200090962 X:153635740-153635762 GGGGATGGGAGGAGCCCTGGGGG + Intergenic
1200138815 X:153887220-153887242 CAAGTGGTGTGGGGCCCTGGAGG + Intronic
1200813132 Y:7504938-7504960 TGAGTGGTGATTAGGCCTGGTGG - Intergenic
1201106393 Y:10766560-10766582 GGAGTGGAGTGGAGTGCTGGGGG - Intergenic
1202062285 Y:20900076-20900098 TGAGTGGTGATTAGGCCTGGTGG - Intergenic