ID: 1163444371

View in Genome Browser
Species Human (GRCh38)
Location 19:17338164-17338186
Sequence TGGCGTGGCGAGCAAGGGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 329}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163444371_1163444380 9 Left 1163444371 19:17338164-17338186 CCTGCCCCTTGCTCGCCACGCCA 0: 1
1: 0
2: 1
3: 27
4: 329
Right 1163444380 19:17338196-17338218 TGCTCAGCGATCCCCGCTCCGGG 0: 1
1: 0
2: 0
3: 5
4: 101
1163444371_1163444379 8 Left 1163444371 19:17338164-17338186 CCTGCCCCTTGCTCGCCACGCCA 0: 1
1: 0
2: 1
3: 27
4: 329
Right 1163444379 19:17338195-17338217 CTGCTCAGCGATCCCCGCTCCGG 0: 1
1: 0
2: 0
3: 9
4: 95
1163444371_1163444381 10 Left 1163444371 19:17338164-17338186 CCTGCCCCTTGCTCGCCACGCCA 0: 1
1: 0
2: 1
3: 27
4: 329
Right 1163444381 19:17338197-17338219 GCTCAGCGATCCCCGCTCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 70
1163444371_1163444382 19 Left 1163444371 19:17338164-17338186 CCTGCCCCTTGCTCGCCACGCCA 0: 1
1: 0
2: 1
3: 27
4: 329
Right 1163444382 19:17338206-17338228 TCCCCGCTCCGGGGAGCCTCTGG 0: 1
1: 0
2: 0
3: 30
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163444371 Original CRISPR TGGCGTGGCGAGCAAGGGGC AGG (reversed) Exonic
900088016 1:907909-907931 GGGCTTGGCGAGCAGGGGGCAGG - Intergenic
900244273 1:1630318-1630340 TGGCGCGGCGGGCCGGGGGCGGG - Exonic
900269221 1:1778577-1778599 GGGCGTGGCGGGAAAGAGGCGGG + Intronic
900611090 1:3544951-3544973 TGGGGTAGGGAGCAAAGGGCGGG - Intronic
901021371 1:6257626-6257648 TGGCTTGGGCAGCAAGGGCCTGG + Intronic
901417718 1:9129027-9129049 TGGCGTGGGGGGCCAGGAGCCGG + Exonic
901692221 1:10980904-10980926 GGGCTGGGCGAGCAAGGGGGAGG - Intronic
903003426 1:20282615-20282637 TGGCAGGGAGAGCCAGGGGCTGG - Intergenic
903788405 1:25875975-25875997 TGGCCTCGGGAGCAGGGGGCGGG - Intergenic
904322872 1:29708121-29708143 GGGGCTGGCGAGCTAGGGGCAGG - Intergenic
904875550 1:33651966-33651988 TGGAGTGGGGTGGAAGGGGCCGG + Intronic
905305335 1:37013932-37013954 GGGCTTGGGGTGCAAGGGGCTGG - Intronic
905325854 1:37151670-37151692 TGGCCTGGGGAGGAAGGGGAAGG - Intergenic
906118920 1:43374526-43374548 TGATGTGGGGGGCAAGGGGCAGG + Intergenic
906949602 1:50323552-50323574 TGCCGTAGCCAGCAAGGGGCTGG - Intergenic
907107271 1:51895110-51895132 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
908207073 1:61861485-61861507 TGGGGTGGGGAGCAAGGGGAGGG - Intronic
909297406 1:73968265-73968287 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
909861363 1:80609906-80609928 TGGGGTGGAGGGCAAGGGGAGGG - Intergenic
910741676 1:90525876-90525898 AGGTGTGGGGAGCCAGGGGCAGG + Intergenic
910827778 1:91428043-91428065 TGGGGTGGGGAGTGAGGGGCGGG - Intergenic
911400106 1:97363802-97363824 TGGGGTGGGGAGCAGGGGGAGGG + Intronic
911720835 1:101189569-101189591 TGAAGTGGCTGGCAAGGGGCTGG + Intergenic
912003587 1:104864827-104864849 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
914995984 1:152543678-152543700 TGGGGGGGCCAGCAAGGGGATGG - Intronic
919792978 1:201304214-201304236 TGGCGTGGCCAGGAAGGAGGAGG - Intronic
920513319 1:206566561-206566583 TGCAGTGGGGAGCAAGAGGCAGG + Intronic
922935939 1:229422218-229422240 TGGGGTTGGGAGCAAGGGGAGGG + Intergenic
924496644 1:244596608-244596630 TGGGGTGGGGGGCAAGGGGAGGG + Intronic
1063195238 10:3735468-3735490 AGGCAGGGCGAGCAGGGGGCGGG - Intergenic
1064279012 10:13933832-13933854 TGGCTAGGGGAGCAGGGGGCAGG + Intronic
1065280822 10:24135650-24135672 TGGCAAGGTGAGCAAGGGGTGGG + Intronic
1067286449 10:44911097-44911119 TGGCTTGGTGAGGAAGGGCCTGG + Intergenic
1069928652 10:71868522-71868544 TGGTGTGGCAAGCACAGGGCAGG + Intergenic
1070788036 10:79173501-79173523 TGGGGCGGGGAGCAGGGGGCGGG + Intronic
1072302961 10:94079449-94079471 TGGGGTGGGGAGCGAGGGGAGGG + Intronic
1072396972 10:95053765-95053787 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1072719814 10:97773349-97773371 GGGCGTGGGGAGCTGGGGGCTGG + Intergenic
1073073076 10:100807072-100807094 TGGCTTGGGGAGCAGGAGGCAGG - Intronic
1075644282 10:124087324-124087346 TGGTGTGGCCAGCAAGGGGGAGG - Intronic
1075738314 10:124677796-124677818 GGACGTGGCTAGGAAGGGGCAGG + Intronic
1076696340 10:132249147-132249169 GGGCGGGGCGTGCAGGGGGCGGG + Intronic
1076728771 10:132427322-132427344 TGGGGTGTCCAGCAAGTGGCAGG + Intergenic
1076844149 10:133060808-133060830 TGGCGTGCCTGGCAAGAGGCAGG - Intergenic
1076889786 10:133277763-133277785 GGGCAGGGCCAGCAAGGGGCTGG + Intergenic
1077865464 11:6218009-6218031 AGCCCTGGTGAGCAAGGGGCTGG + Exonic
1078461583 11:11519135-11519157 TGGCCTGGCGAGCAGGGTGTGGG - Intronic
1081068598 11:38579961-38579983 GGGAGTGGGGAGCAAGGGGAGGG - Intergenic
1081680180 11:44997026-44997048 TGGGATGGGGAGCATGGGGCAGG + Intergenic
1084411057 11:69006117-69006139 TGGCCTGGTGGGCAACGGGCTGG - Exonic
1084582941 11:70035678-70035700 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1085349131 11:75787331-75787353 GGGCTTGGCCAGCAAGTGGCAGG + Intronic
1085451614 11:76637499-76637521 AGGGCTGGAGAGCAAGGGGCTGG - Intergenic
1085864448 11:80273067-80273089 TGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1090910756 11:131117266-131117288 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1091166470 11:133480471-133480493 TCACGTGGCGAGCAAGTGGAAGG - Intronic
1091322696 11:134663236-134663258 TGGGGAGGAGAGCAAGGGCCAGG + Intergenic
1091339288 11:134797900-134797922 TGGAGAGGCGAGCGGGGGGCAGG + Intergenic
1091754795 12:3044334-3044356 TGGGGTGTGGAGCGAGGGGCTGG + Intergenic
1097324196 12:58257397-58257419 TGGGGTGGAGAGCAAGCGGAGGG - Intergenic
1098859014 12:75686701-75686723 TGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1099485710 12:83226978-83227000 GGGGGTGGAGAGCAAGGGGAGGG - Intergenic
1100065133 12:90634549-90634571 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1100764848 12:97852330-97852352 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1103958550 12:124593288-124593310 TGCCGGGGAGAGCAAGGAGCTGG - Intergenic
1105430328 13:20331248-20331270 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1106524059 13:30524188-30524210 AGGGGTGGGGAGCAAGGGGAGGG + Intronic
1106748341 13:32729087-32729109 TGGGGTGGGGGGCAAGGGGAGGG - Intronic
1108191131 13:47940142-47940164 TGGCTTGGGGGGCAGGGGGCGGG + Intronic
1108857384 13:54811404-54811426 TGGGGTGGGGTGCAAGGGGAGGG - Intergenic
1110655690 13:77996010-77996032 GGGAGTGGGGAGCAAGGGGAGGG + Intergenic
1111073184 13:83196898-83196920 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1111165046 13:84447595-84447617 TGGTGTCTCGGGCAAGGGGCGGG + Intergenic
1111779057 13:92698307-92698329 TGGGGTGGGGAGAGAGGGGCGGG - Intronic
1113566057 13:111320387-111320409 AGGCTTGGTGGGCAAGGGGCGGG + Intronic
1113597039 13:111540580-111540602 TGGAGTGGGGGGCATGGGGCCGG + Intergenic
1116498668 14:45593665-45593687 TGGGGTGGGGAGCAAGGAGAGGG + Intergenic
1116752961 14:48909916-48909938 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1116776198 14:49183658-49183680 GGGAGTGGGGAGCAAGGGGAGGG + Intergenic
1120410203 14:84144831-84144853 AGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1122718708 14:103710095-103710117 TGGCATGGGGAGCAGGGGGCAGG + Intronic
1123178533 14:106445012-106445034 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1123428677 15:20195068-20195090 TGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1124819535 15:33030963-33030985 TGGGGTGGGGAGCTAGGGGAGGG - Intronic
1125084547 15:35714813-35714835 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1125685690 15:41561933-41561955 TGGCCTGGCCAGCAGGGGGAGGG + Intronic
1126912490 15:53430873-53430895 TGGCCTGGCGAGGAAGGGAGAGG + Intergenic
1127225193 15:56919732-56919754 CCGCGGCGCGAGCAAGGGGCGGG - Intronic
1127694910 15:61435976-61435998 TGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1128472686 15:67968301-67968323 TGGAGTGGGGAGAAAGGGGAGGG + Intergenic
1132595163 16:745858-745880 TGGGCTGGCCCGCAAGGGGCGGG + Intronic
1132606368 16:795429-795451 TGGGGGGGCGGGCACGGGGCCGG - Intronic
1132606387 16:795476-795498 TGGGGGGGCGGGCACGGGGCCGG - Intronic
1132606406 16:795523-795545 TGGGGGGGCGGGCACGGGGCCGG - Intronic
1133317115 16:4891819-4891841 TGTCCTGGACAGCAAGGGGCAGG - Exonic
1133422333 16:5656932-5656954 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1134238542 16:12486725-12486747 TGCCGTGGAGAGCAGGGGGCGGG + Intronic
1134381951 16:13735876-13735898 AGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1134614860 16:15643202-15643224 AGGCGGGGCGAGGAAGGGGCGGG - Intergenic
1136083433 16:27867823-27867845 GGGCGTGGCCAGGAAGTGGCTGG - Intronic
1136753582 16:32664866-32664888 TGGATTGGCGAGTCAGGGGCTGG - Intergenic
1136814531 16:33205499-33205521 TGGATTGGCGAGTCAGGGGCTGG + Intronic
1136821007 16:33315579-33315601 TGGATTGGCGAGTCAGGGGCTGG + Intergenic
1136827570 16:33372118-33372140 TGGATTGGCGAGTCAGGGGCTGG + Intergenic
1136832636 16:33470889-33470911 TGGATTGGCGAGTCAGGGGCTGG + Intergenic
1137023338 16:35451634-35451656 TGGGGTGGCGAGGTTGGGGCTGG - Intergenic
1137023356 16:35451711-35451733 TGGGGTGGCGAGGTTGGGGCTGG - Intergenic
1137621037 16:49876711-49876733 CGGCGTGGCGGGCGAGGGGCGGG + Intergenic
1137716008 16:50598713-50598735 TGGCGTGGCGGGCCAGTGGCTGG + Intronic
1138932552 16:61678126-61678148 TTGGTTGGGGAGCAAGGGGCAGG - Intronic
1140357014 16:74315142-74315164 TGGCGTGACCAGCCAGGGTCTGG - Intergenic
1141162309 16:81637760-81637782 TGGCATGCTGAGCATGGGGCTGG + Intronic
1141524770 16:84604238-84604260 TGGGGTGGGGAGCAGGGGGTGGG - Intronic
1141919740 16:87127808-87127830 TGGAGTGGCAAGAAAGGGTCTGG - Intronic
1142281545 16:89150755-89150777 TGGCCTGGACAGCAAGGGCCTGG - Intronic
1142290829 16:89192995-89193017 GGGGTTGGCGAGCAGGGGGCGGG - Intronic
1202993107 16_KI270728v1_random:28473-28495 TGGATTGGCGAGTCAGGGGCTGG + Intergenic
1203055741 16_KI270728v1_random:925218-925240 TGGATTGGCGAGTCAGGGGCTGG - Intergenic
1142610441 17:1106869-1106891 AGGCGTTCAGAGCAAGGGGCAGG - Intronic
1142643842 17:1299826-1299848 TGGGGAGGCGAACAAGGGCCTGG - Exonic
1143419429 17:6777250-6777272 GGGGGTGGCGGGCAAGGGGAGGG - Intronic
1143747453 17:9004399-9004421 AGGGGTGGCGAGCAGGAGGCCGG - Intergenic
1144130447 17:12241847-12241869 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1144677473 17:17171204-17171226 TGGCCTGGCGGGCACCGGGCTGG - Intronic
1145829824 17:27906946-27906968 TGGCTTGGGGAGGGAGGGGCAGG + Intergenic
1148778236 17:50107877-50107899 TGACCTGTCCAGCAAGGGGCTGG - Intronic
1149061355 17:52426014-52426036 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1151479312 17:74361054-74361076 TGGGGTGGCCAGCAGGGGACAGG + Intronic
1151529701 17:74696440-74696462 TGATGTGGGGAGCAGGGGGCTGG - Intronic
1151979963 17:77502894-77502916 TGGCGTAGGGGGCAGGGGGCTGG - Intergenic
1153368612 18:4287683-4287705 TGGGGTGGAGGGCAAGGGGAGGG + Intronic
1155929549 18:31690989-31691011 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1157516076 18:48312345-48312367 TGGGGTGGCCAGCAAAGGCCAGG - Intronic
1157755269 18:50211951-50211973 AGGAGTGGCGAGCCAGGAGCTGG - Intergenic
1158658777 18:59365903-59365925 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1158944775 18:62438584-62438606 AGGCGTGCCGAGGAAGAGGCAGG + Intergenic
1159082296 18:63748930-63748952 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1159695953 18:71556571-71556593 TGGGGTGGCGAGGAGGGTGCTGG + Intergenic
1161237491 19:3205119-3205141 AGGCGGGGCGAGGAAGGGCCGGG - Intronic
1161269515 19:3382188-3382210 TGGCGTGGCCGTCAAGGAGCTGG + Exonic
1161315490 19:3615414-3615436 CGGCATGGGCAGCAAGGGGCAGG - Intronic
1161366257 19:3881431-3881453 TGGGGTGGGGAGGAAGGGGGTGG + Intronic
1161424953 19:4198308-4198330 TGGCGAGGAGGGCAAGGGGGAGG + Intronic
1162779207 19:12997803-12997825 TGACATGGCTAGGAAGGGGCTGG + Intronic
1163012232 19:14433430-14433452 GGGCGTGGCGGGGAGGGGGCGGG - Intronic
1163444371 19:17338164-17338186 TGGCGTGGCGAGCAAGGGGCAGG - Exonic
1163806995 19:19405658-19405680 GGGCGTGGCGACCGAGGGGCGGG - Intronic
1163830464 19:19545003-19545025 GGGCGGGGCAAGGAAGGGGCCGG - Exonic
1164163188 19:22644369-22644391 TGGAGTGGGGGGCAAGGGGAGGG - Intronic
1164734461 19:30530677-30530699 TGGAGTGGCTAGGAAAGGGCTGG + Intronic
1165116671 19:33533065-33533087 TGGGGTGGGAAGCAAGGGGCAGG - Intergenic
1165863240 19:38920057-38920079 GGGCGTGGGGAGCCAGGGGAGGG + Intronic
1167008239 19:46788798-46788820 GGGCGGGGCCAGGAAGGGGCGGG + Intergenic
1167251339 19:48399881-48399903 GGGCGGGGCCAGCGAGGGGCGGG + Intronic
1168401596 19:56088532-56088554 TGGCGTGGCGGCCAAGGTGCTGG - Exonic
925252203 2:2449229-2449251 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
925540732 2:4964826-4964848 AGGCGTGGCGAGCAAGCTCCGGG - Intergenic
926841735 2:17088694-17088716 TGGAGAGGTGGGCAAGGGGCAGG + Intergenic
928103495 2:28452917-28452939 TGACGTGCTTAGCAAGGGGCTGG + Intergenic
928869043 2:35952913-35952935 TGGGGTGGAGGGCAAGGGGAGGG - Intergenic
928917339 2:36486606-36486628 TGAAGTGGCGTGCAAGGGGGTGG + Intronic
929064193 2:37956797-37956819 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
932632261 2:73355104-73355126 TGGCATGGCCAGGAAGGGCCTGG - Intergenic
934027943 2:88016787-88016809 AGGCGTGGCCACCAAGGGGCCGG + Intergenic
934698334 2:96416801-96416823 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
935074705 2:99729761-99729783 TGGTGGGGCGGGCAGGGGGCGGG - Intronic
936059175 2:109283326-109283348 TGGGGTGGCAAGGAAGGAGCAGG - Intronic
937883808 2:126886779-126886801 TGGCGTGGGGAGGGAGGGACGGG - Intergenic
938305113 2:130248015-130248037 TGGGGTGTCGGGCAAGTGGCAGG + Intergenic
938462966 2:131509832-131509854 TGGCGTGGCCTGGCAGGGGCAGG + Intergenic
939548843 2:143588476-143588498 AGGGGTGGGGAGCAAGGGGAGGG - Intronic
939808288 2:146802229-146802251 GGTCATGGAGAGCAAGGGGCTGG + Intergenic
940259573 2:151766011-151766033 GGGCGTGGAGAGCGATGGGCAGG - Intergenic
941029197 2:160493017-160493039 TGGCCGGGCCAGGAAGGGGCTGG + Intronic
941905508 2:170714390-170714412 TGGCCTGGGGAGAAGGGGGCGGG + Exonic
942401095 2:175604246-175604268 AGGGGTGGGGAGCAAGGGGAGGG + Intergenic
942671932 2:178385085-178385107 GGGGGTGGCGAGCAAGAGGAGGG + Intronic
943616317 2:190096544-190096566 TGGCCTGGAGAGCATGGTGCTGG + Intronic
943987798 2:194644750-194644772 TGGGGTGGGGAGCTAGGGGAGGG + Intergenic
946012665 2:216578806-216578828 TGGTGTGGGAAGCAAGGGGAAGG - Intronic
946052654 2:216876986-216877008 TAGGGTGGGGAGCAAGGGGAGGG + Intergenic
946124544 2:217550910-217550932 TGGCCTTGGGAGCAGGGGGCTGG + Intronic
947399135 2:229714609-229714631 GGGCGGGGCGAGCGGGGGGCGGG + Intergenic
947541741 2:230984734-230984756 TTGCGTGGCTAGGAAGGGGTTGG - Intergenic
948080626 2:235202633-235202655 TGGGGTGGAGAGAAAGGCGCAGG - Intergenic
948765398 2:240216695-240216717 TGGGGTGGAGAGAAAGGGGGTGG + Intergenic
1169188235 20:3638274-3638296 AGGGGTGGGGAGCAAGGGGAGGG - Intronic
1172255010 20:33509961-33509983 TGGGGTGGGGGGCAGGGGGCAGG - Intronic
1173737435 20:45372259-45372281 TGGCCAGGGCAGCAAGGGGCAGG - Intronic
1173836369 20:46128718-46128740 TGGTGTGGCCAGCAGGGGGCAGG + Intronic
1174406901 20:50308817-50308839 TGGCGGGGGGAGGAGGGGGCAGG - Intergenic
1174567392 20:51475401-51475423 TGGAGAAGCGAGCAGGGGGCAGG - Intronic
1174736004 20:52966537-52966559 TGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1175581332 20:60102120-60102142 TGGCCTGGTGAGCAAGTGGGAGG + Intergenic
1176223562 20:63981325-63981347 TGGGGCGGCGCGCGAGGGGCGGG + Intronic
1177188288 21:17821561-17821583 GGGAGTGGAGAGCAAGGGGTTGG - Intergenic
1179556354 21:42180005-42180027 GGGCGTGGGGGGCAAGGGGAGGG - Intergenic
1180012224 21:45058655-45058677 TGGTGTGGAGAGTGAGGGGCAGG + Intergenic
1180192417 21:46172304-46172326 TGGGGTGGAGAGCAAGAGGCAGG + Intronic
1181000895 22:19987287-19987309 GGGCGTGGCGGGCGGGGGGCGGG + Intronic
1181282193 22:21728000-21728022 GGGCGTGGCGATGAAGGGGCTGG + Intronic
1183948019 22:41337818-41337840 TGTGGTGCCCAGCAAGGGGCTGG - Intronic
1183952600 22:41359886-41359908 TGGCATGGCAAGCATGGGGGCGG + Exonic
1184799567 22:46751463-46751485 TGGCGTGGGAAGCAGGGAGCAGG - Intergenic
950530484 3:13549788-13549810 TGGCGGGGTGAGCATGGGGCTGG - Intronic
951320857 3:21243731-21243753 TGGGGTGGCGAGCTAGGGGAGGG - Intergenic
953000511 3:38928371-38928393 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
953092038 3:39738139-39738161 TGGGGTGGGGGGCAAGGGGAAGG - Intergenic
953410422 3:42687796-42687818 TGGGGTGGAGAGGAGGGGGCAGG + Intronic
953789749 3:45938227-45938249 TGTCGGGGCCAGCAAGGGTCTGG - Intronic
954371114 3:50169992-50170014 TGGAGTGGGGAGCAGGGGACAGG + Intronic
954613519 3:51958269-51958291 AGGGGTGGCGAGAAGGGGGCAGG + Exonic
954947252 3:54436778-54436800 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
956400172 3:68870728-68870750 TCGGGTGGGGAGCAAGGGGAGGG - Intronic
959506480 3:107162255-107162277 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
959693151 3:109220830-109220852 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
960404636 3:117244951-117244973 AGGGGTGGGGAGCAAGGGGAGGG - Intergenic
960747660 3:120908127-120908149 GGGCGGGGCAAGCTAGGGGCCGG + Exonic
963870150 3:150408156-150408178 TGGGGTGGGGGGCAATGGGCGGG - Intergenic
964008883 3:151865831-151865853 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
964010625 3:151887422-151887444 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
965231445 3:166058386-166058408 TTGGGTGGGGAGCAAGGGGAGGG + Intergenic
965678035 3:171220242-171220264 TGGGGTGGCGGGCAAGGGGAGGG + Intronic
968559420 4:1270657-1270679 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
968850394 4:3074277-3074299 GGGCGTGGCGAGGCCGGGGCGGG - Intergenic
968919400 4:3514958-3514980 TGGCGTGGCGAGCACGGGAAGGG - Intronic
969388852 4:6875616-6875638 TGGGGTGTTGTGCAAGGGGCAGG + Intronic
969530370 4:7727017-7727039 TGGGGTGGGGAGGGAGGGGCTGG + Intronic
969850204 4:9950026-9950048 TGGGGTGGGGAGCATGTGGCTGG + Intronic
969873186 4:10117005-10117027 GGGCGGGGCGAGCAAGGCGGAGG - Intergenic
970411568 4:15813587-15813609 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
970496880 4:16635141-16635163 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
970878240 4:20897500-20897522 TGGCGGGGGGAGGGAGGGGCAGG - Intronic
972382448 4:38532002-38532024 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
972446533 4:39149554-39149576 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
973256084 4:48115191-48115213 TGGGGTGGAGGGCAAGGGGAGGG - Intronic
975218175 4:71781235-71781257 TGGGGTGGGGAGCAGGGGGAGGG + Intronic
975949349 4:79749108-79749130 TGCTGTGGCCAGCAAGGGGTTGG - Intergenic
977888433 4:102278996-102279018 TGGGGTGGGGGGCAAGGGGAGGG + Intronic
978517061 4:109580020-109580042 TGGGGTGGGGGGCAAGGGGAGGG - Intronic
978774987 4:112496834-112496856 TGGGGTGGGGAGCAAGGGGAGGG - Intergenic
979311975 4:119213242-119213264 TGGCTTGGACAGCCAGGGGCAGG - Intronic
979697750 4:123633411-123633433 TGGGGTGGGGTGCAAGGGGAAGG - Intergenic
980168324 4:129255095-129255117 TGGAGTGGGGGGCAAGGGGAAGG - Intergenic
981553180 4:145962552-145962574 GGGCTTGGGGAGCAAGGGGAGGG - Intergenic
981672110 4:147298461-147298483 TGGGGTGGGGAGCTAGGGGAGGG + Intergenic
982528829 4:156511873-156511895 GGGTGTGGCGGGCAAGGGGAGGG + Intergenic
983402572 4:167284108-167284130 GGGGGTGGAGAGCCAGGGGCAGG - Intergenic
983543940 4:168942233-168942255 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
985872246 5:2566075-2566097 TGGCGTGGGGGGCAAGGGGAGGG + Intergenic
987322447 5:16783122-16783144 TGGCCTGACGATGAAGGGGCAGG + Intronic
989625451 5:43425387-43425409 TGGCGTGGACAGCAGGGAGCAGG + Intergenic
991018586 5:61957589-61957611 TGGGGTGGGGAGCTAGGGGAGGG + Intergenic
991199452 5:63975057-63975079 TGGGGTGGTGAGCAGGGGGAGGG - Intergenic
994255900 5:97595733-97595755 TGGGGTGCAGAGCAAGGGGAGGG - Intergenic
995959610 5:117823870-117823892 GGGGTTGGCGAGCAAGGGGAGGG - Intergenic
996117117 5:119631297-119631319 AGGCATGGAGAGCAGGGGGCTGG + Intronic
996269107 5:121580543-121580565 TGTCCTGGAGAGCGAGGGGCAGG + Intergenic
996786848 5:127246454-127246476 CGGGGTGGGGAGCAAGGGGAGGG + Intergenic
997486935 5:134239100-134239122 TGGGGTGGGGAGCAAGGAGATGG - Intergenic
998485735 5:142500305-142500327 TGCTGTGTCTAGCAAGGGGCGGG + Intergenic
998972161 5:147604966-147604988 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1001942475 5:175750524-175750546 TCGCTTGGCTAGGAAGGGGCAGG + Intergenic
1002371420 5:178758016-178758038 TGGCGTGACTAGCAGGAGGCAGG - Intergenic
1002633408 5:180595544-180595566 TGGCCTGGCCTTCAAGGGGCAGG - Intergenic
1002670290 5:180861163-180861185 GGGCGTGGCAGGCAAGGGCCGGG + Intronic
1002861181 6:1080675-1080697 TGGGGTGGCCAGGCAGGGGCTGG - Intergenic
1003109497 6:3241732-3241754 TGGGGTGGGGGGCAAGGGGAGGG - Intronic
1005267947 6:24132835-24132857 GGGGGTGGGGAGCAAGGGGATGG - Intronic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006282241 6:33063600-33063622 GGGCATGGGGAGCAAGGGGAGGG - Intergenic
1006436709 6:34029485-34029507 TGGAGCGGCGTGCAAGGGACAGG - Intronic
1006583736 6:35091916-35091938 TGGCAGGGAGAGGAAGGGGCAGG + Intergenic
1007046958 6:38785623-38785645 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1008104277 6:47425743-47425765 GGGGGTGGGGGGCAAGGGGCGGG - Intergenic
1008450162 6:51641895-51641917 GGGAGTGGGGAGCAAGGGGAGGG + Intronic
1009330965 6:62419133-62419155 TGGGGTGGGGAGCAGGGGGGAGG + Intergenic
1010593727 6:77739571-77739593 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1011201121 6:84837473-84837495 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1011984014 6:93419558-93419580 TGGAGTGTGGAGCAAGCGGCCGG - Intergenic
1012953031 6:105539137-105539159 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1013418769 6:109947661-109947683 TGGCATGGAGGGCAGGGGGCAGG - Intergenic
1016242416 6:141946123-141946145 GGGCCTGGGGAGCAAGGGGAGGG + Intergenic
1017571851 6:155753513-155753535 TGGGGTGGGGAGCTAGGGGAGGG + Intergenic
1019314787 7:379433-379455 TGGCGGTGCCAGCATGGGGCAGG - Intergenic
1019343481 7:519122-519144 TGGCGCGGGGAGCACGGAGCTGG + Exonic
1019926494 7:4196527-4196549 CGGCGTGGAGAGCAAGGGGCAGG - Intronic
1021079951 7:16352265-16352287 AGGGGTGGGGAGCAAGGGGAGGG + Intronic
1021716772 7:23468999-23469021 GGGAGTGGCGAGAAAGGGTCGGG + Intronic
1021768972 7:23979277-23979299 TGGGGTGGGGATCAAGGGGAGGG - Intergenic
1021894350 7:25220191-25220213 TGGGGTGGAAAGCAAGGGGAAGG - Intergenic
1023684526 7:42720977-42720999 TGGCATGACAAGCAAGGGGCTGG + Intergenic
1024742296 7:52367563-52367585 GGGCATGGGGAGCAAGGGGAGGG - Intergenic
1027055454 7:75046497-75046519 TGGCCTGGGCAGCAAGGGCCCGG + Intronic
1028254990 7:88584596-88584618 TGGGGTGGGGAGCTAGGGGAAGG - Intergenic
1028916013 7:96260054-96260076 GGGGGTGGGGAGCAAGGGGAGGG + Intronic
1029373127 7:100161965-100161987 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1030998934 7:116392222-116392244 GGGGGTGGCGGGCAAGGGGAGGG + Intronic
1031104027 7:117517198-117517220 GGGGGTGGGGAGCAAGGGGAGGG - Intronic
1032095238 7:128935005-128935027 TGGGGTGGGGAGCAGGGGGGAGG - Intergenic
1032639255 7:133747783-133747805 TGGCGTGGGGATGAAGGAGCGGG - Intronic
1033420525 7:141200922-141200944 TGGCTTGGCGAGGATGGGGATGG + Intronic
1033998499 7:147383618-147383640 CGGGGTGGGGAGCAAGGGGAGGG + Intronic
1035236458 7:157500710-157500732 TGGCGGGGAGAACAAGGGGAGGG - Intergenic
1036168842 8:6463639-6463661 TGGCCAGGCCAGCTAGGGGCAGG + Intronic
1037414591 8:18635888-18635910 TGGGGTGGAGGGCAAGGGGAGGG + Intronic
1037567463 8:20129913-20129935 TGGCCTGGTGAGCAAGGGTTGGG + Intergenic
1038883473 8:31639535-31639557 TGGGGCTGCGAGCAAGCGGCTGG - Intronic
1040865831 8:52048141-52048163 GGGGGTGGGGAGCAAGGGGAAGG + Intergenic
1040980125 8:53238477-53238499 TGGAATGGGAAGCAAGGGGCAGG + Intronic
1043178200 8:77048135-77048157 TGGGGTGGGGAGAAAGGGGAGGG + Intergenic
1043225378 8:77721439-77721461 TGGGGTAGCGGGCAAGGGGTGGG - Intergenic
1043361120 8:79473544-79473566 TGGCTTGGCGAGTTAGGGACAGG - Intergenic
1043899391 8:85764315-85764337 TGGGGTGGCTGGCAAGCGGCAGG + Intergenic
1043906185 8:85816167-85816189 TGGGGTGGCTGGCAAGCGGCAGG + Intergenic
1045871091 8:106927860-106927882 TGGGGTGGGGGGCAAGGGGAGGG - Intergenic
1046410086 8:113830734-113830756 AGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1047163347 8:122407080-122407102 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1047932092 8:129738655-129738677 TGGGGTGGGGAGCAGGGGGAGGG + Intergenic
1048183861 8:132220957-132220979 TGGGGTGGAGAGCAGGGGGAGGG - Intronic
1048541086 8:135342773-135342795 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1049444492 8:142623792-142623814 TGGAGTGGGGAGCAGAGGGCAGG - Intergenic
1049624166 8:143612689-143612711 TGGTGTGGGGAGCAAAGCGCCGG + Exonic
1051496430 9:17728617-17728639 TGGGGTCGGGAGCAAGGGGAGGG - Intronic
1051985487 9:23081434-23081456 TGGAGTGAGGAGCAAGGAGCTGG + Intergenic
1053353829 9:37430423-37430445 GGGAGTCGGGAGCAAGGGGCTGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057450912 9:95159173-95159195 TGGAGTGGGGGGCAAGGGGAGGG - Intronic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1058135871 9:101307007-101307029 TGGTGTGGCCTGCATGGGGCAGG + Intronic
1059498452 9:114729939-114729961 TGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1059869616 9:118557434-118557456 GGGGGTGGGGAGCAAGGGGGAGG + Intergenic
1060316228 9:122513683-122513705 GGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1061061026 9:128250632-128250654 GGGCGTGGCCAGCACTGGGCTGG + Intronic
1061572490 9:131486307-131486329 TGCCGTGGCGGGCCAGGTGCTGG - Intronic
1062730308 9:138104785-138104807 GAGCGTGGGGAGCAAGGAGCTGG - Intronic
1203346172 Un_KI270442v1:36082-36104 TGGAGTGGAGAGGAAAGGGCTGG + Intergenic
1187172976 X:16869926-16869948 TGGCGTGCGGAGCAGGGGGCGGG - Intronic
1187686437 X:21820172-21820194 CGGGGTGGGGAGCAAGGGGAGGG - Intergenic
1187868228 X:23743097-23743119 TGGCGGGGCGTGGAAGGGGCTGG - Intronic
1188671598 X:32888295-32888317 GGGCGTAGGGAGCAAGGGGAGGG - Intronic
1189859167 X:45254475-45254497 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1190920808 X:54850677-54850699 GGGGGTGGGGAGCAAGGGGAGGG + Intergenic
1191111463 X:56805961-56805983 TGGGGTGGGGAGCTAGGGGAGGG - Intergenic
1192667490 X:73102603-73102625 TGGGGTGGGGAGGAAGGGGAGGG + Intergenic
1192883033 X:75307989-75308011 GGGCATGGGGAGCAAGGGGAAGG - Intergenic
1192894002 X:75420804-75420826 TGGGGTGGGGAGCTAGGGGAGGG + Intronic
1195247306 X:103006038-103006060 TGGTGTGGCGAGCAGGGGAGAGG - Intergenic
1197479114 X:126960766-126960788 TGGGGTGGGGGGCAAGGGGAGGG + Intergenic
1198205338 X:134460128-134460150 TGGCGGGGCGGGCAGAGGGCGGG + Intergenic
1198215916 X:134554629-134554651 TAGGGTGGAGAGCAAGGGCCAGG + Intergenic
1198388043 X:136147400-136147422 GGGCGCGGCTAGCCAGGGGCGGG - Exonic
1198620979 X:138509240-138509262 GGGGGTGGGGGGCAAGGGGCGGG + Intergenic
1198717360 X:139572690-139572712 GGGGGTGGGGAGCTAGGGGCGGG - Intergenic
1199088132 X:143652872-143652894 GGGGGTGGCGGGCAAGGGGAGGG + Intergenic
1199330800 X:146555923-146555945 GGGGGTGGGGAGCAAGGGGAAGG + Intergenic
1200036299 X:153334048-153334070 GGGCGTGGCGGGAAGGGGGCGGG - Intergenic