ID: 1163446397

View in Genome Browser
Species Human (GRCh38)
Location 19:17348983-17349005
Sequence GCGTGGCGCTGCCAGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163446392_1163446397 -4 Left 1163446392 19:17348964-17348986 CCAGACTAGCCTGCCCTAAGCGT No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data
1163446386_1163446397 28 Left 1163446386 19:17348932-17348954 CCGTATCCCGGAAATATCGTTCC No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data
1163446390_1163446397 0 Left 1163446390 19:17348960-17348982 CCCTCCAGACTAGCCTGCCCTAA No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data
1163446389_1163446397 7 Left 1163446389 19:17348953-17348975 CCTTTGTCCCTCCAGACTAGCCT No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data
1163446387_1163446397 22 Left 1163446387 19:17348938-17348960 CCCGGAAATATCGTTCCTTTGTC No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data
1163446388_1163446397 21 Left 1163446388 19:17348939-17348961 CCGGAAATATCGTTCCTTTGTCC No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data
1163446391_1163446397 -1 Left 1163446391 19:17348961-17348983 CCTCCAGACTAGCCTGCCCTAAG No data
Right 1163446397 19:17348983-17349005 GCGTGGCGCTGCCAGCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163446397 Original CRISPR GCGTGGCGCTGCCAGCTCCC AGG Intergenic
No off target data available for this crispr