ID: 1163449193

View in Genome Browser
Species Human (GRCh38)
Location 19:17365639-17365661
Sequence GCATGTGGTCGCAGGCTCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 196}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163449180_1163449193 25 Left 1163449180 19:17365591-17365613 CCCGGAGGCTCCGGGCCAGCTCC 0: 1
1: 2
2: 8
3: 37
4: 384
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449181_1163449193 24 Left 1163449181 19:17365592-17365614 CCGGAGGCTCCGGGCCAGCTCCT 0: 1
1: 0
2: 3
3: 42
4: 339
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449179_1163449193 28 Left 1163449179 19:17365588-17365610 CCGCCCGGAGGCTCCGGGCCAGC 0: 1
1: 0
2: 2
3: 30
4: 265
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449185_1163449193 4 Left 1163449185 19:17365612-17365634 CCTCCACCTTGGAGCTCATGAGG 0: 1
1: 0
2: 2
3: 18
4: 153
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449187_1163449193 1 Left 1163449187 19:17365615-17365637 CCACCTTGGAGCTCATGAGGCTG 0: 1
1: 1
2: 1
3: 16
4: 171
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449190_1163449193 -2 Left 1163449190 19:17365618-17365640 CCTTGGAGCTCATGAGGCTGGGC 0: 1
1: 0
2: 1
3: 18
4: 244
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449184_1163449193 10 Left 1163449184 19:17365606-17365628 CCAGCTCCTCCACCTTGGAGCTC 0: 2
1: 0
2: 9
3: 63
4: 532
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196
1163449182_1163449193 15 Left 1163449182 19:17365601-17365623 CCGGGCCAGCTCCTCCACCTTGG 0: 1
1: 1
2: 3
3: 45
4: 510
Right 1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG 0: 1
1: 0
2: 0
3: 13
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163449193 Original CRISPR GCATGTGGTCGCAGGCTCTG CGG Exonic
900160640 1:1221832-1221854 GCCTGTGGTCCCAGCTTCTGAGG + Intronic
900517605 1:3090431-3090453 GCCTGTGTGCGCAGGCTCAGAGG - Intronic
901880109 1:12188815-12188837 GCATGTGCTCCCGGGCTCCGGGG - Exonic
902099860 1:13978001-13978023 GCCTGTGGTCCCAGGTGCTGGGG + Intergenic
903514883 1:23903447-23903469 GCCTGTGGTCCCAGGCACTTGGG + Intronic
904081338 1:27874154-27874176 GCCTGTGGTCCCAGCCTCTCAGG - Intronic
905119640 1:35671898-35671920 GCCTGTGGTCCCAGCCACTGGGG - Intergenic
908264017 1:62360992-62361014 GCCTGTGGTCCCAGCCACTGGGG + Intergenic
912069854 1:105795966-105795988 CCAGGTGGGCGCCGGCTCTGCGG + Intergenic
912788868 1:112631202-112631224 TCATTTGGTCTCAGGCACTGAGG - Intronic
914757249 1:150570356-150570378 GCCTGTGGTCCCAGCCACTGGGG - Intergenic
914888481 1:151602086-151602108 GCATGTGGTCCCAGCTACTGGGG + Intergenic
915657726 1:157375523-157375545 GCCTAGGGTCGCAGTCTCTGGGG - Intergenic
915671341 1:157491453-157491475 GCCTGGGGTCACAGTCTCTGGGG + Intergenic
918371081 1:183862235-183862257 GCCTGTGGTCCCAGCCTCTCAGG + Intronic
922111080 1:222556256-222556278 GCATGTCGTCACAGGGTCAGGGG + Intergenic
922471923 1:225882178-225882200 GCTTGGGGTCGGGGGCTCTGGGG + Intronic
1064982255 10:21176125-21176147 GCCTGTGGTCGCAGGTACTCAGG - Intergenic
1067077500 10:43196567-43196589 GCATGGGGACACAGGCTCTGAGG - Intronic
1067745555 10:48933121-48933143 CCATGTGGATCCAGGCTCTGTGG + Intronic
1067790711 10:49285476-49285498 GAATGTGGTTGCAGGGCCTGGGG + Intergenic
1067907186 10:50304897-50304919 GCCTGTGGTCCCAGCCTCTCAGG - Intergenic
1069822670 10:71237142-71237164 GCCTCTGCTCACAGGCTCTGTGG - Intronic
1070797493 10:79225163-79225185 GCATCTTGTTGCAGGCACTGTGG - Intronic
1071296367 10:84223132-84223154 GCATGTGGCTCCAGGCTCTGAGG - Intronic
1073158303 10:101367193-101367215 GCATGTAGTCCCAGCCACTGGGG - Intronic
1076882979 10:133248475-133248497 CCACGTGCTCGCGGGCTCTGTGG - Intergenic
1077443920 11:2581441-2581463 GCATGTGGGTGCAGGCCCTCTGG + Intronic
1078500341 11:11867944-11867966 GCATGTGGTTGCACGTTCTTAGG + Intronic
1078862719 11:15266013-15266035 GCATGTGGTCTCAGGCTCAATGG - Intergenic
1079301783 11:19285042-19285064 GAATGTAGAGGCAGGCTCTGGGG - Intergenic
1079588858 11:22158001-22158023 GTATGTGGTTGCTGGGTCTGTGG - Intergenic
1080246934 11:30189689-30189711 CCATGTGGTCACAGGCAGTGTGG - Intergenic
1081569345 11:44279824-44279846 GCATGAGGTCCCAGCCCCTGGGG - Intronic
1083291897 11:61695176-61695198 GCATCTGCCCACAGGCTCTGGGG + Intronic
1083743004 11:64721068-64721090 GCATGAGGTGGCAGCCTCTCTGG + Intronic
1090391048 11:126387550-126387572 GCGTGTGGTCGCAGCCACTGGGG + Intronic
1092326762 12:7540527-7540549 GCATGTAGTCTCAGCTTCTGAGG - Intergenic
1095817165 12:46436880-46436902 GGATGTGGTAGCAGCCTCTGAGG + Intergenic
1096401997 12:51314976-51314998 GCATGTGGTCCCAGCTACTGGGG - Intronic
1096561610 12:52439612-52439634 GCCTGTGGGTGCAGGCTCAGGGG + Intergenic
1097248386 12:57619314-57619336 GGATCTGATCGCTGGCTCTGGGG - Intronic
1098881957 12:75926343-75926365 GGCTGTGGTCTCAGGCTCCGTGG + Intergenic
1099627424 12:85092225-85092247 GCATTTGGTGGCAGGCTTTATGG + Intronic
1100335089 12:93621599-93621621 GCTTGTGGTCCCAGGTACTGGGG - Intergenic
1100347166 12:93743454-93743476 GCCTGTGGTCCCAGGTGCTGGGG - Intronic
1101712308 12:107279621-107279643 GCAGGTGGTCTCAGGAGCTGAGG + Intergenic
1102045309 12:109826146-109826168 GCCTGTGGTCCCAGCTTCTGGGG - Intronic
1102220018 12:111187928-111187950 GCCTGTGATCGATGGCTCTGGGG - Intronic
1103691922 12:122782073-122782095 GCCTGTAGTCCCAGCCTCTGGGG + Intronic
1104006405 12:124895873-124895895 GCTTGTGGTCCCAGCCACTGGGG + Intergenic
1104649430 12:130521051-130521073 GCATGTGTTTGCAGGCCTTGGGG + Intronic
1104997314 12:132666455-132666477 GCCTGTGGTCCCAGGAACTGGGG + Intronic
1105481803 13:20784990-20785012 GCCTGTAGTCCCAGGCTCTTAGG - Intronic
1106163354 13:27219819-27219841 CCAGGTGGGCGCAGGCTCGGAGG + Intergenic
1106344363 13:28861334-28861356 GCATGTAGTTGAAGGCTGTGGGG + Intronic
1106945061 13:34818363-34818385 GCATGTGGTCCCAGCTACTGAGG - Intergenic
1109373609 13:61458502-61458524 GCCTGTGGTCCCAGGCACTTGGG + Intergenic
1109494796 13:63155648-63155670 GAATGTGTTTGCAGTCTCTGTGG + Intergenic
1110417263 13:75267201-75267223 GCCTGTGGTCCCAGGCACTCGGG - Intergenic
1110430454 13:75417164-75417186 GCATGTGGGCCCTGGCTCTTGGG - Intronic
1116902903 14:50378656-50378678 GCCTGTGGTCCCAGCCACTGGGG - Intronic
1117696595 14:58370747-58370769 GGGTGTGGTGGCAGGCACTGTGG - Intronic
1117913578 14:60655891-60655913 GCTTCTGGTCTCAGGGTCTGGGG - Intronic
1120856802 14:89219543-89219565 GCATGTGGTGCCATGCTCTCGGG - Intronic
1121010383 14:90516914-90516936 GCTTGTGGTCTTTGGCTCTGGGG - Intergenic
1121601009 14:95202957-95202979 GCACCTGGTCGCTGGCACTGGGG + Exonic
1123809353 15:23907674-23907696 CCATGTCGTGGCAGGCTTTGTGG - Intergenic
1126833139 15:52630332-52630354 GCATGTCTTCTCAGTCTCTGTGG - Intronic
1127080687 15:55375817-55375839 GCATGTGGTCCCAGCCACTTGGG - Intronic
1129701947 15:77773253-77773275 GCATGTTGCAGCAGGCTGTGGGG + Intronic
1130520731 15:84658736-84658758 GCCTGTGGTCCCAGCTTCTGGGG - Intergenic
1131514292 15:93066798-93066820 CCATGTGGTGCCAGGCTCGGTGG - Intronic
1131559212 15:93424690-93424712 GCATGTAATCGCAGCCACTGTGG + Intergenic
1132903018 16:2268520-2268542 GGAGGGGTTCGCAGGCTCTGCGG + Intergenic
1135904430 16:26498181-26498203 GCAAGTAGTCCCAGTCTCTGTGG - Intergenic
1136020481 16:27436947-27436969 GCATGTAGTCCCAGGTACTGAGG + Intronic
1136549662 16:30976258-30976280 GCCTGTGGTCCCAGCTTCTGGGG + Intronic
1137434239 16:48442633-48442655 GCATGTAGTCTCAGCCTCTTGGG - Intronic
1137698192 16:50476807-50476829 GCATGGGGTCCCAGGCCCTGGGG - Intergenic
1138733189 16:59219137-59219159 GGGTTTGGTCACAGGCTCTGTGG - Intergenic
1141898475 16:86974109-86974131 GCAGGAGGCTGCAGGCTCTGAGG + Intergenic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1144712636 17:17412307-17412329 GCATGTGGTCACAGCAACTGAGG - Intergenic
1144749684 17:17639803-17639825 GCCTGTGGTCCCAGCCACTGGGG + Intergenic
1144770963 17:17759203-17759225 GCATGCTGTCCCAGGGTCTGAGG - Intronic
1146001961 17:29136102-29136124 GCCTGTGGTCCCAGGTACTGGGG + Intronic
1146582241 17:34049165-34049187 GCCTGTGGTCCCAGGTGCTGAGG + Intronic
1146759900 17:35468032-35468054 GCCTGTGGTCGCAGCTTCTCAGG - Intronic
1147923827 17:43934690-43934712 GCCTGTGGTCCCAGGTACTGGGG - Intergenic
1150387117 17:64770936-64770958 GCCTGTGGTCCCAGGTTCTCGGG + Intergenic
1151472737 17:74327973-74327995 GAATGTGGTCACAGGCTGTTGGG + Intronic
1151621053 17:75245228-75245250 GCCTGTGGTCCCTGGCACTGCGG + Intronic
1152630032 17:81406757-81406779 GGATGTGGTGGCAGGCGCTGGGG + Intronic
1152645722 17:81467720-81467742 GCATGTGGCAGCAGGATCAGCGG + Intergenic
1153328132 18:3842743-3842765 ACATGGGGTAGCAGGCTCTTGGG + Intronic
1153743963 18:8157989-8158011 GCAGGAGGTCGAAGGCCCTGTGG + Intronic
1156230701 18:35151788-35151810 GGCTGTGGTCGCAGGTTCAGTGG - Intergenic
1160140116 18:76313649-76313671 ACCTGTGGTCCCAGGCACTGGGG + Intergenic
1160933922 19:1584339-1584361 GCCTGTGGTCCCAGCTTCTGGGG - Intronic
1162983857 19:14256669-14256691 GCCTGTAGTCTCAGGCACTGGGG - Intergenic
1163449193 19:17365639-17365661 GCATGTGGTCGCAGGCTCTGCGG + Exonic
1164037557 19:21467808-21467830 GCATTTGGACTCAGGCTGTGTGG + Intronic
1165414045 19:35680383-35680405 GCCTGTGGTCCCAGACACTGGGG + Intergenic
1167044202 19:47040438-47040460 CCATGTGGTCGCTGACTCTGGGG - Exonic
925348429 2:3185945-3185967 CCTTGTGGTCACAGGCCCTGGGG + Intergenic
928029259 2:27764982-27765004 GCCTGTGGTCCCAGGCACTCAGG + Intergenic
935644090 2:105318779-105318801 GCATGTGGTAGATGGCTCAGGGG + Intronic
936092003 2:109507469-109507491 GCCTGTGGTCCCAGCATCTGAGG + Intergenic
937018032 2:118624105-118624127 GCATCTGGTGGCAGGCTTTATGG + Intergenic
937277249 2:120692884-120692906 GCATCTCGCCACAGGCTCTGTGG + Intergenic
937871133 2:126787177-126787199 GCATGTGTGTGCAGGCCCTGTGG + Intergenic
939874559 2:147562676-147562698 GTGTGTGGTCCCAGGCTTTGAGG - Intergenic
940069248 2:149666426-149666448 ACTTGTGTTAGCAGGCTCTGAGG - Intergenic
941579077 2:167272725-167272747 GTAGGTGGTTGCAGGCCCTGAGG - Intergenic
944153857 2:196591242-196591264 CCATTTGGCCGCAGACTCTGAGG - Intronic
944597323 2:201273007-201273029 GCATGTGGTAGAAGGCTGTGGGG - Intronic
946252760 2:218423661-218423683 CCAGGAGGTCGCAGGCTCAGGGG - Intronic
948176583 2:235948305-235948327 GCCTGTGGTCCCAGGTTCTCCGG - Intronic
948788125 2:240363607-240363629 GCTCGTGCTCCCAGGCTCTGTGG - Intergenic
1171060753 20:21956959-21956981 GCATGTGGGCACTGGCTATGGGG + Intergenic
1173855195 20:46245931-46245953 GAATGTGGTGTCAGGCTTTGGGG - Intronic
1174417177 20:50375149-50375171 GCAGGTGGCCCCAGGCCCTGGGG - Intergenic
1175065204 20:56278360-56278382 GCATGTGGTGGCTGGCTATGTGG - Intergenic
1175861247 20:62151500-62151522 CCCTGTGGTCTCAGGCTCTGAGG - Intronic
1176025273 20:62982390-62982412 CCCTGTGCTCACAGGCTCTGGGG + Intergenic
1179304916 21:40145032-40145054 GAATGAGAGCGCAGGCTCTGGGG - Intronic
1179823352 21:43950066-43950088 TCATCTGGGCCCAGGCTCTGGGG - Intronic
1180988235 22:19918032-19918054 GCATGCTCTGGCAGGCTCTGGGG - Intronic
1181063134 22:20291441-20291463 GCAGGGGGTCTGAGGCTCTGAGG + Intergenic
1182129019 22:27837104-27837126 GCCTGTGGTCCCAGGCACTTGGG + Intergenic
1182161677 22:28128661-28128683 GCTTGTGGTCCCAGCCACTGGGG - Intronic
1183426070 22:37740100-37740122 GAATGTGGTAGCAGGGTCGGGGG + Intronic
950118052 3:10464020-10464042 GCATGGGGTTCCAGGGTCTGGGG - Intronic
950825509 3:15815419-15815441 GCCTGTGGTCGCAGCTACTGAGG - Intronic
952490730 3:33870175-33870197 GCCTGTGGTCTGAGGCTCGGTGG - Intergenic
955184612 3:56703064-56703086 GCCTGTAGTCCCAGGCACTGGGG + Intergenic
957785558 3:84877783-84877805 GCATGTGGTCCCAGGTACTGAGG + Intergenic
961412591 3:126733439-126733461 GCATGTTTTTGCAGTCTCTGTGG + Intronic
962754174 3:138455677-138455699 GCGTGTGTTCACCGGCTCTGAGG - Intronic
964442884 3:156729961-156729983 GCATGTTGCAGCAGGTTCTGAGG - Intergenic
966301390 3:178483326-178483348 GGCTATGGTCGCAGGCTCAGGGG - Intronic
966367167 3:179202187-179202209 GCATGTGGTCCCAGCCACTTAGG - Intronic
968966203 4:3770173-3770195 TCCTGTGGTCCCAGGCTCAGGGG - Intergenic
974043314 4:56876619-56876641 GCCTGTGGTCCCAGGCACTCGGG + Intergenic
974187994 4:58465179-58465201 CCAGGTGGGCGCAGGCTCGGCGG + Intergenic
978809402 4:112833626-112833648 GCCTGTGGTCCCAGGTACTGGGG - Intronic
980595455 4:134948453-134948475 CCAGGTGGGCGCAGGTTCTGCGG - Intergenic
981114075 4:140969462-140969484 GCATGTGGTCTGAGGTTGTGTGG + Intronic
983824656 4:172243539-172243561 GCATGTTGTGGCAGGTTCTCAGG - Intronic
983834262 4:172369773-172369795 CCAGGTGGGCGCAGGCTCGGTGG - Intronic
984320036 4:178183959-178183981 GCATGTAATGGGAGGCTCTGAGG + Intergenic
986044110 5:4021218-4021240 GAAAGTGGTTGCAGGCACTGAGG - Intergenic
986488335 5:8263435-8263457 GCATATGGTTATAGGCTCTGAGG + Intergenic
986687190 5:10285126-10285148 GCCTGTGGTCCCAGCCTCTCAGG - Intronic
987443983 5:17993345-17993367 GCATGTGGTAGCAAGTGCTGTGG - Intergenic
996499556 5:124202214-124202236 GCATGTGGTTCCAGGGTGTGGGG + Intergenic
997897180 5:137729551-137729573 GAATGTGGTTGCAGGCCCTCAGG + Intronic
1001676240 5:173519023-173519045 GCATGTGGGAACAGGCTGTGTGG - Intergenic
1002314890 5:178337208-178337230 GCAAGTGCACGCAGGCTGTGGGG - Intronic
1003907994 6:10720210-10720232 CCAGGTGGGCGCAGGCTCGGTGG - Intergenic
1004811807 6:19270834-19270856 CCAGGTGGGCGCAGGCTCAGTGG + Intergenic
1005813887 6:29535069-29535091 GTATCTGGACCCAGGCTCTGTGG + Intergenic
1006480882 6:34293185-34293207 GCCTGTGGTCGCAGCTTCTCAGG - Intronic
1007536907 6:42599773-42599795 GCCTGTGGTCGCAGCTACTGGGG - Intronic
1010213544 6:73382170-73382192 GCCTGTGGTCGCAGGTACTAGGG - Intronic
1017013307 6:150079760-150079782 GGCTCTGGTCGCTGGCTCTGAGG - Intergenic
1017239039 6:152147089-152147111 GCAGGTGGTCCTAGGCCCTGAGG - Intronic
1017876502 6:158529283-158529305 GCATGTGGTCCCAGCTCCTGGGG - Intergenic
1019276494 7:178576-178598 GCAAGAGGTGGCGGGCTCTGGGG + Intergenic
1019613695 7:1949288-1949310 GCACATGGTCTCAGGCTCTAAGG + Intronic
1023827922 7:44021935-44021957 GCCTGTGGTCCCAGGTACTGGGG - Intergenic
1025232817 7:57214097-57214119 GCCTGTGGTCTCAGCCACTGGGG + Intergenic
1025767740 7:64472489-64472511 GCCTGTAATCCCAGGCTCTGGGG + Intergenic
1025914263 7:65853103-65853125 GCTTGTGGTCCCAGGTTCTCAGG - Intergenic
1026554164 7:71391605-71391627 GCCTGTGGTCCCAGCCTCTCAGG - Intronic
1026970935 7:74467071-74467093 GCATGTGGTCCCAGCTACTGGGG - Intronic
1029756225 7:102575380-102575402 GCCTGTGGTCCCAGGTACTGGGG - Intronic
1029774165 7:102674453-102674475 GCCTGTGGTCCCAGGTACTGGGG - Intergenic
1033707429 7:143902697-143902719 ACTTGTGGTCCCAGCCTCTGAGG - Intergenic
1033911546 7:146269213-146269235 GCCTGTGGTCCCAGGCACTTGGG + Intronic
1034047725 7:147947501-147947523 GCCTGTGGTCCCAGGTTCTCAGG + Intronic
1035920797 8:3673991-3674013 GCCTGTGGTCCCAGCCACTGTGG + Intronic
1036794564 8:11746144-11746166 GCCTGTGGTCCCAGGTTCTAAGG + Intronic
1037297190 8:17413485-17413507 GCAGGTGGGCGCAGGCGCGGAGG - Intronic
1037799338 8:22024068-22024090 GCAGCTGGTCCCAGGCTCAGTGG - Intergenic
1039016661 8:33157005-33157027 GCCTGTGGTCACAGGTTCTTGGG + Intergenic
1040311316 8:46238266-46238288 GGATGTTGTGGCAGGCTCAGGGG + Intergenic
1040590620 8:48789175-48789197 CCAGGTGGTAGAAGGCTCTGGGG - Intergenic
1042875031 8:73433964-73433986 TAATGTGTTCACAGGCTCTGAGG - Intronic
1046704279 8:117433612-117433634 GTATGTAGTCACAGGTTCTGGGG + Intergenic
1046759978 8:118010734-118010756 GAGTGTGATCGCAGGCTCTGTGG + Intronic
1048328701 8:133457835-133457857 GCCTGTGCTCCCAGGCTCGGGGG - Exonic
1049165253 8:141121721-141121743 GGCTGTTGCCGCAGGCTCTGGGG - Intronic
1049717410 8:144099491-144099513 GCAGGTGGGCACAGGGTCTGGGG - Exonic
1051224735 9:14886771-14886793 GCCTGTGGTCCCAGCCACTGGGG + Intronic
1056590848 9:87964522-87964544 GCCTGTGGCCCCAGGCTCTTTGG + Intergenic
1056691975 9:88815454-88815476 TCATTTGGTCGAGGGCTCTGTGG + Intergenic
1057700813 9:97362009-97362031 GCCTGAGGTCACAGGCTCTCAGG - Intronic
1060186441 9:121566808-121566830 GCATCTGGAAGCCGGCTCTGGGG - Intergenic
1060724239 9:125996735-125996757 GCCTGTGGTCCCAGGCACTCAGG - Intergenic
1062534596 9:137015914-137015936 GCAGGTGGGCGGAGGCCCTGGGG - Intronic
1188688477 X:33099380-33099402 GCAGGTGGCCCCTGGCTCTGGGG - Intronic
1189269104 X:39737989-39738011 GCATCTGTTGGCAGGCCCTGGGG - Intergenic
1190114755 X:47619416-47619438 GCAGGTGGGCGGCGGCTCTGGGG - Exonic
1191601956 X:63018255-63018277 GCTGGTGATAGCAGGCTCTGTGG - Intergenic
1197947805 X:131859623-131859645 GCCTGTGGTCCCAGCTTCTGTGG - Intergenic
1200146304 X:153928082-153928104 GCATGGGGACGGAGGCTCAGCGG + Intronic
1200922980 Y:8629553-8629575 GCATTTGTTAGCAGGCTCAGGGG - Intergenic
1202114454 Y:21457329-21457351 GCCTGTGGTCCCATGCACTGAGG - Intergenic