ID: 1163453993

View in Genome Browser
Species Human (GRCh38)
Location 19:17395241-17395263
Sequence AAGGAGAAACAGGAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163453993_1163454005 22 Left 1163453993 19:17395241-17395263 CCCTCCTCTTCCTGTTTCTCCTT No data
Right 1163454005 19:17395286-17395308 TCTCCCTCCTTACACCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163453993 Original CRISPR AAGGAGAAACAGGAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr