ID: 1163456128

View in Genome Browser
Species Human (GRCh38)
Location 19:17406643-17406665
Sequence CTGGCTCTAAGTGGCTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163456128_1163456139 17 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456139 19:17406683-17406705 TGTGGTCCCAGGCTGAGGCTGGG 0: 1
1: 0
2: 4
3: 42
4: 307
1163456128_1163456143 26 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456143 19:17406692-17406714 AGGCTGAGGCTGGGAGGCTGAGG 0: 1
1: 4
2: 56
3: 335
4: 2327
1163456128_1163456136 12 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456136 19:17406678-17406700 ATGCCTGTGGTCCCAGGCTGAGG 0: 3
1: 9
2: 41
3: 131
4: 841
1163456128_1163456134 -1 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456134 19:17406665-17406687 GGCATGGTGGTACATGCCTGTGG 0: 78
1: 1117
2: 2786
3: 5938
4: 8573
1163456128_1163456144 30 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456144 19:17406696-17406718 TGAGGCTGGGAGGCTGAGGCAGG 0: 2
1: 26
2: 166
3: 863
4: 9314
1163456128_1163456138 16 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456138 19:17406682-17406704 CTGTGGTCCCAGGCTGAGGCTGG 0: 4
1: 23
2: 64
3: 172
4: 684
1163456128_1163456140 20 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456140 19:17406686-17406708 GGTCCCAGGCTGAGGCTGGGAGG 0: 1
1: 1
2: 10
3: 72
4: 619
1163456128_1163456135 6 Left 1163456128 19:17406643-17406665 CCATTAAAGCCACTTAGAGCCAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1163456135 19:17406672-17406694 TGGTACATGCCTGTGGTCCCAGG 0: 5
1: 96
2: 458
3: 1556
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163456128 Original CRISPR CTGGCTCTAAGTGGCTTTAA TGG (reversed) Intronic
901932003 1:12601924-12601946 CTGGCTCTAACTAGCTACAATGG + Intronic
902279252 1:15362408-15362430 CTGTCTGTAAGTGGATTTGATGG + Intronic
903790864 1:25891986-25892008 CTGGCTCTAAGAGCTTTTCAGGG - Intronic
904172147 1:28598902-28598924 GAGGCTGTAAGTGGCTTTGATGG + Intronic
908009286 1:59759258-59759280 CTGACTCTATGTGGAGTTAAAGG - Intronic
909292509 1:73901758-73901780 CTGGCTCTATGAGGCTGTCATGG + Intergenic
913161202 1:116147499-116147521 CAGGCTGTCAGTAGCTTTAAAGG + Intergenic
914891438 1:151627418-151627440 ATGGATCTAAGTGACTGTAAAGG - Intronic
917704796 1:177621469-177621491 TCGGCTCTGAGTGGCTATAAAGG - Intergenic
919046057 1:192453771-192453793 GTGCCTTAAAGTGGCTTTAAGGG + Intergenic
919665604 1:200288400-200288422 CTGGTTCTAAGAATCTTTAAAGG + Intergenic
1063800452 10:9571697-9571719 GTGGCTCTATGTGTATTTAAAGG + Intergenic
1064692272 10:17930464-17930486 CTGGAGCTAAGTGGCTATAATGG + Intergenic
1064913382 10:20427813-20427835 CTGGCTCCAAGTGGCTTTTGGGG - Intergenic
1065758347 10:28956667-28956689 CTGCATCCAATTGGCTTTAAGGG + Intergenic
1073224331 10:101904238-101904260 CAGGCTCTTCGTGGCATTAAAGG - Intronic
1075663989 10:124217893-124217915 GTGGCTCAAGGTGGCTTCAATGG + Intergenic
1080423239 11:32132065-32132087 CTGCATCCATGTGGCTTTAAAGG - Intergenic
1083007617 11:59362971-59362993 ATGGCTCTAGGTGGCTTGACTGG + Intergenic
1083997695 11:66280165-66280187 CAGGCTCTGGGTGGCTTTGAGGG + Intronic
1085051216 11:73381264-73381286 CTGACTCTAACTGGCTGTAGAGG - Intronic
1091715849 12:2775612-2775634 CTGGCTCTCAGTGGCTGTGGAGG - Intergenic
1092322694 12:7495170-7495192 CTGTTTCTAAGTAGCTGTAACGG - Exonic
1096239631 12:49952834-49952856 CTGGCTCTCAGTGTCCTCAAAGG - Intronic
1098911035 12:76208969-76208991 CTGGGTCCATGTTGCTTTAATGG - Intergenic
1101134065 12:101721376-101721398 CTTGCTCCAAATGACTTTAAAGG - Intronic
1101940389 12:109095476-109095498 CTGGGTCATAGTGGCTCTAAGGG + Intergenic
1106466133 13:30016104-30016126 CTGTCACTAAGTGGCTTGGAGGG - Intergenic
1106582194 13:31027978-31028000 AGGGGTCTAAGTGGCTTTGAGGG - Intergenic
1110377578 13:74811255-74811277 CAGGCTATAAGTGTCTTTATAGG - Intergenic
1114653526 14:24301993-24302015 CTGTCTTCAAGTGGCTTTACAGG + Exonic
1115079330 14:29431413-29431435 CTCCCTCTAAGTGTCTCTAAGGG + Intergenic
1115321712 14:32087323-32087345 TTGGCTCTAACAGGTTTTAAGGG - Intronic
1115349708 14:32380777-32380799 CTGACTACAAGTGGTTTTAATGG - Intronic
1115754057 14:36516350-36516372 TTGGCTTTAAATGGCTTTGAGGG - Intergenic
1116801347 14:49447178-49447200 TTGGCTCTAAATTGCTTTCAAGG + Intergenic
1121565182 14:94904058-94904080 CTAGCTCTGATTGGCTTTAGAGG + Intergenic
1123451676 15:20368524-20368546 CTGTCTTTAAGTGTCTTTATAGG - Intergenic
1125801698 15:42454117-42454139 CTGACTTTAATTGGCTTTAAAGG + Intronic
1128453894 15:67822315-67822337 CTGGCATTAAGTGTCCTTAATGG - Intronic
1131119953 15:89815724-89815746 CTGTCTCTGAGCAGCTTTAATGG + Intergenic
1135750777 16:25057204-25057226 CTGACTCAAATTGGCTTAAAGGG + Intergenic
1136588587 16:31203037-31203059 CTGGCTCTCACTGGGTTTATTGG + Exonic
1141261364 16:82456748-82456770 GTGGCTCCAAGTGGCTCTCAAGG - Intergenic
1142692169 17:1613223-1613245 CTGGCTCTGAATGGCTTTGGTGG - Exonic
1146591508 17:34131733-34131755 CTGGGTCTCAGTGGGATTAAAGG - Intronic
1149293232 17:55237220-55237242 CCAACTCTAAGTGGCTTGAACGG - Intergenic
1151330138 17:73401777-73401799 CTGGCTCTAACTGGCCTTGGGGG - Intronic
1161621787 19:5301610-5301632 CTGGCTGTAAATGCATTTAATGG + Intronic
1163456128 19:17406643-17406665 CTGGCTCTAAGTGGCTTTAATGG - Intronic
1166340528 19:42134308-42134330 CTGGCTCTAGGGGGCTGGAATGG - Intronic
1167450116 19:49562441-49562463 CTGGCTCTAAATCATTTTAAGGG - Intronic
1167621844 19:50565089-50565111 CTGTCTCTGAGTGGGATTAAGGG + Intronic
1168232400 19:55041512-55041534 CTTGCTCTAAGTTGCTCTTACGG - Intronic
925540498 2:4961326-4961348 CTGGCTCTCACTGGCTGCAAAGG - Intergenic
927151725 2:20200115-20200137 CTGGCTCCAGGTGGCTTTGCAGG - Intergenic
932308757 2:70723123-70723145 CAGGCTCTGAATGGCATTAAGGG + Intronic
934502321 2:94870644-94870666 CTGGCCCTGAATGGCTTTGAGGG + Intergenic
935622519 2:105142410-105142432 CTGTCCGTAAGTGGCTTGAAGGG - Intergenic
937503920 2:122514741-122514763 CTGCCTCCAAGTGGTTTTGAAGG - Intergenic
938135163 2:128750723-128750745 CTGGCTCTAGGTGGACTTAGTGG - Intergenic
940791310 2:158032946-158032968 CTGGCCCTAACAGGCTTTTAGGG + Intronic
941039860 2:160609122-160609144 AAGGCTCTAAGTGGGTTTCAGGG + Intergenic
942498012 2:176559829-176559851 CAGACTCTAAGAGGCTTTCAGGG - Intergenic
943265783 2:185730249-185730271 CTGGCTCAAAGTGTCTTACAAGG + Intergenic
1169768685 20:9177541-9177563 TTGGTTCTAAGTTGCTTTCAAGG - Intronic
1171209552 20:23306271-23306293 CTTGCTCTAAGTGGGTGTCAAGG + Intergenic
1174279334 20:49427498-49427520 CTGGCTTTAAGTGAGTTTACTGG - Intronic
1178880025 21:36442018-36442040 CTTGCTCTTATTGGCATTAATGG - Intergenic
1180740275 22:18048745-18048767 CTGCCTCACAGTGCCTTTAACGG + Intergenic
1181332030 22:22100252-22100274 CTGGCTCTCAGGGTCTTTATAGG + Intergenic
1182174528 22:28270735-28270757 CTGGCTGACAGTGGCTTTTATGG - Intronic
1182319211 22:29467444-29467466 CTGGCCTAAAGTGGCATTAATGG - Intergenic
1184218903 22:43086513-43086535 CTGGCACTGAGTGGCTGTCAGGG - Intronic
951637065 3:24791441-24791463 CTGGCTTAGAGTGGCTTAAAGGG + Intergenic
953026618 3:39148777-39148799 CTGGCTCTGTGTGGATTAAACGG - Intronic
953421323 3:42755701-42755723 CTGGATTTAAGTGGTTTTCAGGG + Intronic
955314911 3:57930178-57930200 GTGACTCAAAGTGGCTCTAAAGG - Intergenic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
966057189 3:175708713-175708735 CTGGCCCTAAATGGCTTTGGGGG - Intronic
971748925 4:30621295-30621317 CTGGAGCTAGGTGGCTTTGAGGG - Intergenic
974314938 4:60267445-60267467 CTGTCTCAAAGTGGCTAAAAAGG - Intergenic
975593439 4:76023370-76023392 CTGACTCTAAGTGGCATTCAAGG - Exonic
978890083 4:113815113-113815135 CTGGTTCTAAGTGGCCTGGATGG - Intergenic
981717017 4:147761785-147761807 TTGGCACTAAGTGACTTTGAAGG + Intronic
981853063 4:149254643-149254665 ATGGCTCTTAGTGGCTATTAGGG + Intergenic
986033647 5:3917563-3917585 CTGGCTGTAGGTGGCATTGAGGG + Intergenic
995131920 5:108639597-108639619 CTGTTTCTGTGTGGCTTTAAAGG + Intergenic
995389018 5:111618650-111618672 CTGGCAATAAGTGGCAGTAAGGG + Intergenic
1003299179 6:4861379-4861401 CTGCCCCTAAGTGGCTTTTGTGG + Intronic
1004065615 6:12241039-12241061 CAAAATCTAAGTGGCTTTAAGGG - Intergenic
1005809539 6:29505591-29505613 CAGGCTCTGGGTGGCTTTATGGG + Intergenic
1008976451 6:57433012-57433034 CTGGCTATATTTGGCTTGAATGG - Intronic
1019610397 7:1933858-1933880 CTGGCTGCAAGTGGCGTTAGGGG - Intronic
1019953953 7:4397844-4397866 CTTCCTCAAAGTGGCTTTTATGG - Intergenic
1020925974 7:14325130-14325152 CACTCTCTAAGTGGCTGTAAGGG - Intronic
1023952319 7:44856457-44856479 CTGGCACTAAGAGGTTATAATGG + Intergenic
1025212082 7:57025588-57025610 CCGGCCCTAAATGGTTTTAAGGG + Intergenic
1025659872 7:63551240-63551262 CCGGCCCTAAATGGTTTTAAGGG - Intergenic
1027139437 7:75646841-75646863 CTGGCTCTAAGTGGCACTGCAGG - Intronic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1030389774 7:108912590-108912612 CTGCTTCTAAGTGGATTTTATGG + Intergenic
1032866438 7:135929950-135929972 CTGGTTGTCAGTGGCTTCAAAGG + Exonic
1034558516 7:151864817-151864839 CTGGGGACAAGTGGCTTTAAGGG - Intronic
1038656675 8:29459144-29459166 CTGGCTCATAGTAGCTTGAATGG + Intergenic
1044276220 8:90302339-90302361 CTGGCTCTCAAAGGCTTTATAGG + Intergenic
1059914138 9:119079611-119079633 CTGTCTCTGAGTGACCTTAATGG - Intergenic
1060831464 9:126720287-126720309 CTGGTTGTAATTGGCTTTTAGGG - Intergenic
1060921131 9:127421302-127421324 CTGGCTCTTAATGGCTTCAGAGG - Intergenic
1062692087 9:137847119-137847141 CAGGCTTTAAGGGGATTTAAGGG + Intronic