ID: 1163456997

View in Genome Browser
Species Human (GRCh38)
Location 19:17412814-17412836
Sequence CTGTCTCAGGGTCTGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 343
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163456989_1163456997 26 Left 1163456989 19:17412765-17412787 CCTAAGATAAACATTTGAAGAAG 0: 1
1: 0
2: 3
3: 52
4: 487
Right 1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG 0: 1
1: 0
2: 1
3: 25
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163456997 Original CRISPR CTGTCTCAGGGTCTGGTGGA GGG Intronic
900573717 1:3372817-3372839 CTGACTCAGGCTCTGGAGGAGGG - Intronic
900799004 1:4726260-4726282 TTGTGCCAGGGTGTGGTGGAGGG + Intronic
900978411 1:6032006-6032028 CTCTTTCAGGGACTGATGGAAGG - Intronic
901060225 1:6468407-6468429 CTGCCCCTGGGTCCGGTGGACGG - Exonic
901534314 1:9872561-9872583 CTGTCTCAGTGTTTGGGGGCTGG - Intronic
902390499 1:16101742-16101764 CTGGAGGAGGGTCTGGTGGAGGG - Intergenic
902390503 1:16101754-16101776 GCGTCTTAGGGTCTGGAGGAGGG - Intergenic
903265075 1:22153358-22153380 CTCTCTCTTGGGCTGGTGGAAGG + Intergenic
903344002 1:22673030-22673052 ATGGCTCAGGATCTGGTGCACGG + Intergenic
903945064 1:26957465-26957487 CTGCCTCAGGGTCTGGAACAGGG + Intronic
905284219 1:36868824-36868846 GGTTCTGAGGGTCTGGTGGAAGG - Intronic
905460283 1:38118374-38118396 CTGTCTCAGGGTGAGCAGGATGG + Intergenic
905874956 1:41426697-41426719 CTGTCCCCGGGCCTGGTGGGAGG + Intergenic
907318726 1:53589390-53589412 GTTTCTCAGGGGCTGGCGGAGGG + Intronic
910713106 1:90202279-90202301 CAGTCTCAGGTTATGGTGGCAGG - Intergenic
911588484 1:99718570-99718592 CTGTGGGAGGGTCTGGTGGGCGG - Intronic
918133180 1:181646645-181646667 CTGTCTCTGGGGCTGGGGGCTGG + Intronic
918447790 1:184632226-184632248 GTGTGTGAGGGTCTGGTGGGTGG - Intergenic
919832662 1:201552887-201552909 CTGTCTGAGGGTCAGATGGACGG + Intergenic
922798774 1:228354378-228354400 CTTTCTCTGGGTCTGGAGGAGGG + Intronic
923262673 1:232282395-232282417 AAGACTCAGGGTCTGGTGGCTGG - Intergenic
923467727 1:234264206-234264228 TAGTCTCAGGGTGTGGTGAATGG - Intronic
924543932 1:245007755-245007777 CTATCTCAGGGACTTGGGGAAGG - Intronic
1063134158 10:3201853-3201875 CTTTCTGAGGGGCTGGGGGAGGG + Intergenic
1063209330 10:3864562-3864584 CTGTCTCAAGTTCTGGAGGCTGG - Intergenic
1063482514 10:6388380-6388402 CTGGCCCAGGGTCTGTTGCAAGG + Intergenic
1063704717 10:8419726-8419748 CTGTCTCAGGGTCTTTAGCAGGG + Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1065139377 10:22705548-22705570 GTGCCTCAGGGGCTGGTGGGAGG - Intronic
1067160201 10:43819220-43819242 CTGTCTGGGGGTCAGGTAGATGG + Intergenic
1067844679 10:49710360-49710382 CTCCCTCAGGTTCTGGTGGCTGG + Intergenic
1070788071 10:79173886-79173908 CTGTGCCAGGGTCTGGCTGAGGG - Intronic
1073140505 10:101244032-101244054 CTCTCTCCTGGTCAGGTGGAAGG + Intergenic
1076868666 10:133182082-133182104 CTGTCTCAGGGTCAGGCTGCAGG - Intronic
1077057154 11:599744-599766 GTGTCTGTGGGTCTGGTGCAGGG + Intronic
1077904101 11:6515686-6515708 CTGTCTCAGGGTCTGCTTCTGGG + Intronic
1083102869 11:60328111-60328133 ATGTCCCAGGGTTTTGTGGAAGG + Intergenic
1083254812 11:61489578-61489600 GTGTTTCAGCGTCAGGTGGAGGG + Intronic
1083928141 11:65821598-65821620 CTGGCTCAGGAACTGGAGGAAGG - Intergenic
1084212644 11:67630967-67630989 CAAGCCCAGGGTCTGGTGGAAGG - Intergenic
1085357583 11:75853358-75853380 CCGTCTCAGGGTGGGGTGGGCGG - Intronic
1086178416 11:83920042-83920064 CTGTGTCAGGGTCTGTGGCATGG - Intronic
1087850679 11:103024808-103024830 CTGTCTCAAGGTCACGTGGCAGG + Intergenic
1088399965 11:109412680-109412702 CTGTCTCAGGGTCTGATTCTGGG + Intergenic
1088494687 11:110421219-110421241 CTGTTGCAGGGGCTTGTGGAGGG - Intergenic
1091490852 12:931271-931293 CTGCCTCAGGGCCTTCTGGATGG + Exonic
1091514938 12:1169567-1169589 CTGTCTCAGGGTCTGCTTTCCGG + Intronic
1094533756 12:31302780-31302802 GCATCTCAGGGTCTGGCGGAAGG + Intronic
1096675617 12:53224238-53224260 CTGTCTCGGGGTCTGAAGGGGGG - Intronic
1096796047 12:54078192-54078214 GTGTCTCAGGGTGAGGTGGTGGG + Intergenic
1097725473 12:63070882-63070904 CTGACTCAGGGTCTCTTGCAAGG - Intergenic
1098981715 12:76963218-76963240 CTCTCTCTGGGGCTGGTGGAAGG + Intergenic
1100008325 12:89921437-89921459 TTGTCTCAGGGTCTGCTGGTGGG + Intergenic
1100929165 12:99585905-99585927 CTGTCTCTGGGCCTGGATGAGGG + Intronic
1101840046 12:108321609-108321631 CTGTCTCAGGCTCTGCTTCAGGG + Intronic
1101848811 12:108386090-108386112 CTGTCTCAGGGTCTGCTTCTTGG - Intergenic
1103428263 12:120857811-120857833 CTGTCACAGGGGTGGGTGGAAGG + Intronic
1103656636 12:122476228-122476250 CTGCCTCAGGGTCTAGTAGGGGG + Intronic
1103917906 12:124385432-124385454 CTGTCTCACGGTGTGGGGGAAGG - Intronic
1104162166 12:126191396-126191418 CTGACTCGGGCTCTGGTGGCTGG - Intergenic
1104584041 12:130033326-130033348 CTGTCTAAGGGGCTCTTGGATGG + Intergenic
1105426784 13:20301538-20301560 CTGGATCGGGCTCTGGTGGAGGG + Intergenic
1106148897 13:27079152-27079174 CTGTCTCAGGGTCTGCTCTAGGG - Intronic
1106430150 13:29673252-29673274 CTGTCGCAGGGTCGGGGGCAAGG + Intergenic
1108592420 13:51923490-51923512 CTGCCTGAGGGTCTGGTGCTTGG - Intergenic
1111044653 13:82798443-82798465 CTGTGTCATGTCCTGGTGGAAGG - Intergenic
1111158182 13:84356169-84356191 CTTTCACAGGGTTTGGGGGAAGG - Intergenic
1111716615 13:91886929-91886951 CTGTTCTAGGGTCTGGAGGATGG + Intronic
1112005448 13:95249703-95249725 CTGTATGAGGTTCTGCTGGAAGG - Intronic
1112455797 13:99561855-99561877 CTGTCTCATGGTCACATGGATGG - Intronic
1115271101 14:31554050-31554072 CTTTTCCAGGGTCTGATGGAAGG - Intronic
1117144822 14:52827029-52827051 ATGGCTCATGGTCTGATGGAGGG + Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1119418533 14:74492874-74492896 CTGTATCCAGCTCTGGTGGAGGG - Intronic
1119554273 14:75541431-75541453 CTGGCTCTGTGTCTGGAGGAAGG + Intronic
1122021074 14:98838484-98838506 CGGGACCAGGGTCTGGTGGAGGG + Intergenic
1122408149 14:101512490-101512512 CCATCGCAGGGCCTGGTGGACGG - Intergenic
1122742589 14:103880831-103880853 CTGTCTCAGAGGTTGGGGGAAGG - Intergenic
1124180099 15:27465133-27465155 CTCTCTCAGCTGCTGGTGGAGGG + Intronic
1124629874 15:31330018-31330040 CTGGTTCAGCATCTGGTGGAGGG + Intronic
1125729722 15:41886355-41886377 CTGAAGCAGGATCTGGTGGAGGG + Exonic
1126561091 15:50045072-50045094 CTGGCACAGTGTCTGGTGCAAGG - Intronic
1128074592 15:64818298-64818320 GTGTCTCGGGGCCTGGTGAATGG - Exonic
1128259775 15:66225046-66225068 TTGTCTCAGGGTCTCGGGAATGG - Intronic
1130965333 15:88693451-88693473 CTGACCCAGGGCCTGCTGGAGGG + Intergenic
1131559140 15:93424347-93424369 CTGGCCCAGGGGGTGGTGGAGGG - Intergenic
1131723452 15:95196746-95196768 GTGTCTCAGGGTTTGGAGGTGGG - Intergenic
1132236875 15:100228778-100228800 CTGTCCAATGGTCTGGGGGAAGG + Intronic
1133320888 16:4913204-4913226 CTGTCTGTGGTTCTGGGGGACGG - Intronic
1135053163 16:19208688-19208710 CTGTCACAGTGTCTGGTGGTTGG + Intronic
1135142802 16:19936036-19936058 CTGTCACAGGGTCGGGGGCAGGG - Intergenic
1136111153 16:28064096-28064118 CTTTCTCAGGGTCTGGTGCGGGG - Intergenic
1139129444 16:64123261-64123283 CTGTCTCAGGCTCTGCTTCAAGG + Intergenic
1139594859 16:67951584-67951606 CAGTGTCAGGGGCTGGTGGCTGG + Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1141551159 16:84807589-84807611 ATGTCTCAGCTTCTGGTGGCCGG - Intergenic
1141769940 16:86083671-86083693 TTGTCTCAGGGTCTGCTTGTGGG + Intergenic
1141814678 16:86401481-86401503 CCCTCTCAGGGGCTGGTTGAAGG + Intergenic
1141827325 16:86489719-86489741 CTTTCTCAGGATTTGGTGCATGG - Intergenic
1141995647 16:87635033-87635055 CTGTCCCAGAGTCCAGTGGAGGG - Intronic
1142483063 17:230217-230239 CTGTCTCTGGGCCTGAAGGAGGG - Intronic
1143250647 17:5520902-5520924 CTGTGTCTGGGTCTGGTTCAGGG - Exonic
1144197499 17:12908918-12908940 CTGGCTCAGTGTCTGATGGAGGG + Exonic
1144654922 17:17029329-17029351 CTGGCTCTGGGTCTGGGGGGTGG - Intergenic
1147176724 17:38660461-38660483 CTGTCTGTGTGTCTGCTGGAGGG - Intergenic
1148463260 17:47850159-47850181 CTGCCCCAGGGGCTGGAGGATGG + Intronic
1148907863 17:50922757-50922779 CAGCCTCTGGGTCTGGAGGATGG + Intergenic
1149694656 17:58607421-58607443 CTGTCTCATGGTCTCATGGCTGG + Intronic
1150640669 17:66947534-66947556 CTGCCGCATGGTGTGGTGGAGGG - Intergenic
1152656918 17:81524089-81524111 CTTTCTGAGGTGCTGGTGGACGG - Intergenic
1152882042 17:82823182-82823204 CTGGCTCAGGCTCTTGTGGGGGG + Intronic
1152927357 17:83093384-83093406 CTGTCCCCAGGGCTGGTGGAGGG - Intronic
1153577193 18:6534275-6534297 TAGTCTCAGGCTATGGTGGAAGG + Intronic
1154293501 18:13130752-13130774 CTGCCTCAGCGTCTCGTGCACGG - Intergenic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156564151 18:38164508-38164530 CTGTCTCAGGAGGTGGTGGTGGG + Intergenic
1156880277 18:42069194-42069216 CTGCCTCAGGGTCTGCTTCATGG + Intronic
1157077291 18:44479679-44479701 CTGTTCCGGGGTCTGGAGGATGG - Intergenic
1157469673 18:47979587-47979609 CTGTCTCAAGGGCTGGCAGAGGG - Intergenic
1158020561 18:52836756-52836778 CTGTCATGGGGTCTGGAGGATGG + Intronic
1158776960 18:60594222-60594244 TTGTCTCAGGGTCTGGTTTGGGG + Intergenic
1159070456 18:63617207-63617229 CTCTCTCAGCTTCTGGAGGAGGG - Intergenic
1159105381 18:63998079-63998101 CTTGCTCAGGGTCTGGCGGGTGG - Intronic
1159960864 18:74555006-74555028 CTCTCTCAAGGTCTCGGGGATGG + Intronic
1160246495 18:77164096-77164118 CTGTTTCCCCGTCTGGTGGAAGG + Intergenic
1160665765 19:327444-327466 CTGTCTCCAGCTCTGGTGGCTGG - Intronic
1161315056 19:3613836-3613858 CAGTCTCAGTGTCTTGTGGCTGG + Intronic
1161482880 19:4519529-4519551 CTGTCTCAGGGGCAGGTAGGAGG - Intergenic
1162898165 19:13777906-13777928 CTGACTGTGGGTCTGGTGGCTGG - Intronic
1163456997 19:17412814-17412836 CTGTCTCAGGGTCTGGTGGAGGG + Intronic
1164581518 19:29438300-29438322 GTGTCCCAGGATCTGGAGGATGG - Intergenic
1164582337 19:29442303-29442325 GAGTCTCAGGGCCTGGTGCAGGG + Intergenic
1165392089 19:35544707-35544729 CTGTGTCAGGGTCTGGCCAAAGG - Intronic
1166259026 19:41625311-41625333 CTTTCTCAGGGTCAGGTTCATGG + Intronic
1166270454 19:41710321-41710343 CTTTCTCAGGGTCAGGTTTACGG - Intronic
1166276400 19:41757239-41757261 CTTTCTCAGGGTCAGGTCCATGG - Intronic
1166427928 19:42696533-42696555 CTGGGTCAGGGTCTGCTGGTTGG + Intronic
1166549757 19:43657405-43657427 GAGTCTCAGGGTGTAGTGGAGGG - Intronic
1166752879 19:45173029-45173051 CACTCTCGGGGTGTGGTGGATGG + Intronic
1166825162 19:45604231-45604253 CTGTCTCAGCCTCTGGTAGCTGG + Intergenic
1167465184 19:49646799-49646821 CCGTCTCAGGGCCTGGAGGACGG + Exonic
1167563652 19:50242162-50242184 ATGTCTCAGGAACTTGTGGAGGG - Intronic
1168261348 19:55196777-55196799 CTGTGTCTGGGTCTGGGTGAAGG + Exonic
925167964 2:1730552-1730574 CAGGCTCAGGGTATGGCGGACGG + Intronic
926196698 2:10768414-10768436 CCCTCTCAGGCTCTGCTGGAGGG - Intronic
926254093 2:11175076-11175098 CTGTCTTAGGGTTTAATGGATGG + Intronic
929075225 2:38075062-38075084 CTGCACCAGGGCCTGGTGGATGG + Exonic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933235502 2:79859736-79859758 CTGTTTCAGAGGCTGGTGAAGGG + Intronic
935432122 2:102987592-102987614 CTGTCACAGTGTCTGGTAGAAGG + Intergenic
936078619 2:109417530-109417552 CTGGCTGAGGGTCCTGTGGAGGG - Intronic
936328158 2:111523260-111523282 AGGTCTCAGGGAATGGTGGAGGG + Intergenic
936525236 2:113236770-113236792 CAGGCTCAGGGTCTGCAGGAAGG - Intronic
936881146 2:117252392-117252414 CTGTCTAAGGGTTTGGGGCAAGG - Intergenic
937331763 2:121034974-121034996 CTGTTTCAGGGTCTGTGGGTAGG + Intergenic
937589531 2:123596394-123596416 CTGTCTCTGTGTCTTGAGGATGG - Intergenic
937631113 2:124102111-124102133 CTGGTTCAGGGGGTGGTGGAGGG - Intronic
937635815 2:124154269-124154291 CTGTCTTAGGGTCTGCTCTAGGG - Intronic
937751076 2:125476842-125476864 CTGTTCTAGGGTCTGGAGGATGG - Intergenic
937890589 2:126935486-126935508 CTGGCTGTGTGTCTGGTGGATGG - Intergenic
938207011 2:129432344-129432366 CTGTCACTGGGTCTGATGGAGGG + Intergenic
940737314 2:157467928-157467950 CTTTCTCAGAGTATGGTGGCTGG - Intronic
942307798 2:174625573-174625595 CTGCCTCATAGGCTGGTGGAGGG + Intronic
942552510 2:177134181-177134203 ATGTCTCACGGTTTGGTGAAGGG - Intergenic
944540380 2:200748630-200748652 CTGGCACAGGGTTTGGGGGATGG - Intergenic
946171322 2:217897697-217897719 CTGGCACAGGGGCTGGTGGCAGG + Intronic
946564580 2:220949654-220949676 CTGTGTCAGGGTCTGCTAGTAGG + Intergenic
946638960 2:221762708-221762730 CTGTCCCAGGGGCTGATGAAAGG + Intergenic
946804628 2:223459391-223459413 CTTTCCCAGGCTCTGGTTGAGGG - Intergenic
947114903 2:226759090-226759112 CTGTGTCCGGGGCTGGTGCAAGG + Intronic
947851465 2:233291939-233291961 CTGTCTTAGGGTCTGTTGATGGG + Intronic
948202985 2:236143100-236143122 CTGTCTGTGGGTTTGGGGGAGGG + Intergenic
948360772 2:237418535-237418557 CTGTCTCAGGCTCTGCTAGAAGG + Intergenic
1169250852 20:4060300-4060322 TTGTCTCAGGTTCTGCTGGCAGG - Intergenic
1170468767 20:16647558-16647580 CTGTCTCAGGGTCTGCTGGTAGG + Intergenic
1170584931 20:17727527-17727549 CTGTATCAGGGTCTGGAGTCCGG + Intronic
1171435565 20:25120510-25120532 TTGTCTCAGGGTCTGTTTGGGGG - Intergenic
1173150734 20:40564761-40564783 CAGACTCAGGGTTTAGTGGATGG + Intergenic
1173433603 20:43012991-43013013 CTGCCTCAGGCTCTGTTGGAAGG + Intronic
1173577753 20:44123999-44124021 CTGGGTGAGGGTCTGGAGGATGG + Intronic
1173691394 20:44963971-44963993 TTGTCTAAGGCCCTGGTGGAAGG - Intergenic
1174682309 20:52420458-52420480 CTGTCTCAGTGACTGGTTCAGGG + Intergenic
1174881588 20:54285108-54285130 CAGTCTCAGGGACAGGGGGAAGG - Intergenic
1175219544 20:57409032-57409054 CTGTCTTGGGGGTTGGTGGAGGG + Exonic
1175645451 20:60667069-60667091 CAGTCGCAGGGGCTGGGGGAGGG - Intergenic
1175861889 20:62154822-62154844 CTGTCTCTGGGGCTCCTGGAGGG + Intronic
1175875840 20:62228915-62228937 CTGGCTCAGGGCCTTGTGGAGGG - Intergenic
1176009915 20:62887737-62887759 CTGTCTCAGGGCCTTGTTCATGG - Intronic
1177718195 21:24867359-24867381 CTGTCTTAGGGTCTGCTTCATGG + Intergenic
1180253083 21:46602599-46602621 CTGTCTAAGAGGCCGGTGGAAGG - Intronic
1181081888 22:20421130-20421152 GTTTCTCTGTGTCTGGTGGAAGG + Intergenic
1181235411 22:21445415-21445437 CGGTATCAGGGGCTCGTGGATGG + Exonic
1181329049 22:22075018-22075040 AAGTCCTAGGGTCTGGTGGAGGG - Intergenic
1181638698 22:24185942-24185964 CTTTCCCAGGGTCTGGGGCACGG - Intronic
1182570393 22:31233170-31233192 CTGACTCATGGTCAGGTGGCTGG - Intronic
1183211202 22:36452485-36452507 CTGTATCAGGGTCTGGCAGAGGG + Intergenic
1183319659 22:37157266-37157288 CTGTCTTGGGGACTGGTGGGTGG - Intronic
1183519706 22:38289800-38289822 CAGGCTCACGGCCTGGTGGAGGG - Intergenic
1184021662 22:41825568-41825590 CTGTCTCCGTGTCTGGGGCAGGG + Intronic
1184157661 22:42678942-42678964 CTGTTTTGGGGTCTGGAGGATGG - Intergenic
1184599096 22:45532185-45532207 CTGTCCAGGGGCCTGGTGGAGGG + Intronic
1184764492 22:46564438-46564460 CTGATTCAGGGGCTGGTGGGCGG - Intergenic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184898410 22:47425957-47425979 CAGACTCAGAGTCAGGTGGAGGG + Intergenic
1184987000 22:48142517-48142539 CTGTTTCAGGGGCTGGTGACGGG + Intergenic
949864125 3:8533151-8533173 ATGCCTCGGGGTTTGGTGGATGG + Intronic
950360526 3:12446358-12446380 CTTTCTCAGGGTCTGCTTGTTGG + Intergenic
952421447 3:33135222-33135244 CTGTCTCAGGCTCTGCTTCAAGG - Intronic
953626932 3:44579364-44579386 CTGATTCAGGGCCTGCTGGATGG + Intronic
955788616 3:62565530-62565552 CTGTATCAGAGTCTTCTGGATGG + Intronic
956704257 3:71985760-71985782 CTGTCTCAGAGTCTGCTGCTCGG + Intergenic
957360995 3:79157450-79157472 CTGTCTAAGGATGTGTTGGAAGG + Intronic
958646159 3:96876999-96877021 GTGTCTCTGGGTCAGGTAGATGG + Intronic
960155351 3:114292772-114292794 TTGTCTAAGGGTCTGGAGGTGGG + Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
962365392 3:134775643-134775665 CTGTCTCAGGGTCTGATTCTGGG + Intronic
962594685 3:136928763-136928785 CTGTCTCAGGCCCTAATGGAGGG - Intronic
962826285 3:139103069-139103091 CCATCTCAAGGTCAGGTGGAGGG - Intronic
967724133 3:192845704-192845726 CTTTCTGAGCCTCTGGTGGAGGG - Intronic
967924732 3:194637267-194637289 CTGCCCCAGGGCCTGGTGGGAGG - Intergenic
968454106 4:688585-688607 CTCACTCAGAGTCAGGTGGAGGG + Intronic
968586199 4:1417200-1417222 CTGTCTCTGGGCATGGTGGCCGG + Intergenic
969088961 4:4678441-4678463 CATTCTCAGGGTCTTGTGCAAGG - Intergenic
969414148 4:7047932-7047954 CTGTCTCAGGGATTAGGGGACGG - Intronic
971036700 4:22701188-22701210 CTGTCACAAGGTGTGGGGGAAGG - Intergenic
972129646 4:35816163-35816185 ATGTCTCTGGGGCTGGGGGAGGG - Intergenic
972408218 4:38766397-38766419 CTCTCTCAGAGACTGGTGGTTGG - Intergenic
972871529 4:43305884-43305906 CTGTATCAGCATCTGCTGGAGGG + Intergenic
975493011 4:75009296-75009318 CTGACTCAGGAGCTGATGGAAGG - Intronic
975798887 4:78037779-78037801 CTGCCTCAGGCTCTGGAGTAGGG + Intergenic
977127571 4:93188805-93188827 GTGTCCCAGGGTTTCGTGGAAGG - Intronic
977859070 4:101933749-101933771 CTGTCTCACAGTCTAGTGGAAGG + Intronic
978753700 4:112281531-112281553 CTGCCTCAGTGTTTGTTGGATGG - Intronic
979199336 4:117958145-117958167 CTGTCTTAGGGTCTGGTTCTGGG + Intergenic
982617586 4:157659679-157659701 CTGTCTGGGGGTGTGGGGGAAGG + Intergenic
984241321 4:177223057-177223079 CTATTTCAAGCTCTGGTGGAGGG + Intergenic
985051332 4:185995296-185995318 TTGCCTCAGGGTCTGGTTCAGGG + Intergenic
985600339 5:825521-825543 CTGTCTTAGGCACTGGTGTAGGG - Intronic
985808197 5:2063762-2063784 ATGTCACAGGGTGTGGGGGAAGG + Intergenic
987089871 5:14500977-14500999 CTGTCTCTGGGTCTGGTTGGTGG + Intronic
988395313 5:30690623-30690645 CTTTCACTGGGGCTGGTGGAGGG - Intergenic
992091375 5:73320444-73320466 CTGTCTTGGGGTCTCTTGGAAGG - Intergenic
995712847 5:115052402-115052424 CTGTCTCAGGGTCTGCTTCTGGG + Intergenic
996393103 5:122985232-122985254 CTCTCTCAAGCTCTGGTGAAAGG - Intronic
997346260 5:133194656-133194678 GTGTCCCAGGGTCTGCTGCATGG + Intergenic
997884867 5:137621020-137621042 CTATCTTTGGGTCTGGAGGAGGG + Exonic
999061681 5:148642273-148642295 CAGTAGCAGGGTCAGGTGGAGGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999499558 5:152133034-152133056 CTGTCCTAGGGCCTTGTGGAAGG - Intergenic
999897627 5:156052262-156052284 CTGTCTCAGTGTCGGGGGTAAGG + Intronic
1000378124 5:160603066-160603088 CTGACTCAGGGGGTGGTGAAAGG - Intronic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1001266671 5:170278932-170278954 CACTGCCAGGGTCTGGTGGACGG + Intronic
1001480973 5:172089084-172089106 TTGTTTAAGGGACTGGTGGAGGG - Intronic
1001598842 5:172915846-172915868 AGGTGTCAGGGTCTGGAGGAAGG - Intronic
1002623302 5:180505909-180505931 CTGTCTTAGTGTATTGTGGAGGG + Intronic
1003024541 6:2542533-2542555 CTCTCTCCTGGGCTGGTGGAGGG - Intergenic
1003032169 6:2611342-2611364 GTGTCTCAGAGTCTGGTAAATGG + Intergenic
1003563640 6:7204153-7204175 CTCTCCCAGGGTGTGGAGGAAGG - Intronic
1004461927 6:15845012-15845034 CTGTCTCAGTTCCTGGTGGCAGG - Intergenic
1005862793 6:29914243-29914265 GTTTCTGAGGCTCTGGTGGAAGG - Intergenic
1006654617 6:35580302-35580324 CTGTACCAGGGTTTGCTGGAGGG - Intronic
1006656116 6:35594336-35594358 CTGTCTCGGGGGGTGGGGGAGGG + Intronic
1015275969 6:131383820-131383842 CTGTCTCAGGCTCTGCTACAGGG - Intergenic
1015417793 6:132969407-132969429 CTGTCTTAGCATCTGGTGGTTGG + Intergenic
1017375477 6:153762779-153762801 CTACCCCAGGGTCTGGAGGATGG + Intergenic
1017988920 6:159469567-159469589 GTGACTCAGGGTGGGGTGGATGG - Intergenic
1018029946 6:159834011-159834033 CTGTCTTAGGGTAGGGAGGAGGG - Intergenic
1018622393 6:165743003-165743025 TTGTCTCAGAGCCTGGTGGCTGG + Intronic
1018803695 6:167242360-167242382 CTGTCTCAGGTTCTTGGGAAGGG - Intergenic
1018806516 6:167266142-167266164 CTGTCTCAGGTTCTTGGGAAGGG + Intergenic
1020096749 7:5373902-5373924 TTGTCTCAGTGTCTGGCGGCAGG + Intronic
1022474221 7:30699764-30699786 GGGTCTCAGGGCCTGGTGGCTGG - Intronic
1022474243 7:30699845-30699867 GGGTCTCAGGGCCTGGTGGCTGG - Intronic
1022489150 7:30803465-30803487 CTGTTTCAGGGTCAGATGGATGG + Intronic
1022502921 7:30893891-30893913 CAGTGTCTGGGTCTGGGGGAGGG - Intergenic
1022550849 7:31237650-31237672 CTGTCTGAGGGTGTGGCGGTGGG - Intergenic
1023130447 7:36997706-36997728 CTGCCTCAGGTGCTGGTTGAAGG + Intronic
1026004756 7:66591996-66592018 CTGTCTCAGGCGCTGGTTGCCGG - Intergenic
1028567148 7:92246025-92246047 GTCTCTCAGGGGCTGGTGGCAGG + Exonic
1028890552 7:95983494-95983516 CTGCCTCATGGTCTGGGGCAGGG + Intronic
1032477390 7:132221524-132221546 CTGTCTCAGGGTGTGGTTTCAGG - Intronic
1032510213 7:132466359-132466381 ATGTCTCAGGCTCTGGAGGCAGG - Intronic
1032847020 7:135759688-135759710 GTGCCTTAGGGTCTGGTGGAGGG + Intergenic
1033507323 7:142018150-142018172 CTGGCTCAGTGTCTCTTGGAAGG + Intronic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034081990 7:148287703-148287725 CTGTGTCATGGCATGGTGGAGGG + Intronic
1034426587 7:151017220-151017242 CTGTCTCAGCGTGCGGAGGACGG - Exonic
1036055922 8:5253699-5253721 CTGTCTCAGTGTCTGCTGGCTGG + Intergenic
1036102604 8:5803173-5803195 CTCTGCCAGGGTCTGGGGGATGG - Intergenic
1037373972 8:18208889-18208911 TTGTTTTAGGGTCTGGCGGAAGG - Intronic
1037374992 8:18217829-18217851 CTGTTGCAGGGGCTGGTGCAGGG + Intronic
1038984598 8:32794729-32794751 CTGTCACGGGGTCGGGGGGAAGG - Intergenic
1039159189 8:34597883-34597905 GAGTCTCAGAGTTTGGTGGAAGG - Intergenic
1039990638 8:42484889-42484911 CTGTCTCAGGGCCAGCTGCATGG - Intronic
1040071553 8:43192857-43192879 CTGTCTCAGGGTCTGCTGCCAGG - Intronic
1040416780 8:47202691-47202713 CACTCTCAGGGTCTCCTGGAGGG - Intergenic
1040900978 8:52416875-52416897 CTGCCTTGGGGTCTGGTGGGAGG + Intronic
1041118777 8:54565831-54565853 CTGTCTCACAGTCTGGAGGCTGG + Intergenic
1043934177 8:86124516-86124538 CTGTATCAGGGTCGCCTGGAGGG - Intronic
1044158301 8:88878830-88878852 TTGTCTCAGGGTGTTGTGGGTGG - Intergenic
1045737462 8:105313574-105313596 CTGTCTCAGAGTGTGATGTAGGG - Intronic
1045790476 8:105978106-105978128 TTGACTCTGGGTCTGATGGATGG - Intergenic
1046224826 8:111264154-111264176 CTGACTCAGGGTGTCTTGGAAGG + Intergenic
1047384087 8:124393680-124393702 CCGTCTCAGGGTGGGGTGGGGGG - Intergenic
1047718012 8:127613569-127613591 CTGCCTCAGTGGCTGGTGTAGGG + Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1048064143 8:130950477-130950499 CTGTGTCAGGGTTTGGGGGCTGG + Intronic
1048170870 8:132104925-132104947 CTGTCTCATGGTCTGGGAAAGGG + Intronic
1048380200 8:133858956-133858978 CGGTCTCAGGTTCTCTTGGAAGG + Intergenic
1049309619 8:141926693-141926715 CTGTCCCAGGGGCTGGAGGCTGG + Intergenic
1049534025 8:143169752-143169774 CTGGCTCATGGTCAGGTGGCAGG - Intergenic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1050331192 9:4548219-4548241 CTACTTCAGGGTCTGGAGGAAGG - Intronic
1051607068 9:18926721-18926743 TGGGCTCAGGGCCTGGTGGAGGG - Intergenic
1052618741 9:30877628-30877650 CTGGGTCAGGGTCTGAGGGACGG + Intergenic
1053785659 9:41650868-41650890 GTGTCTCAGGGTGAGGTGGCAGG + Intergenic
1054174378 9:61864834-61864856 GTGTCTCAGGGTGAGGTGGCAGG + Intergenic
1054449233 9:65393879-65393901 GTGTCTCAGGGTGAGGTGGCAGG + Intergenic
1054663160 9:67715957-67715979 GTGTCTCAGGGTGAGGTGGCAGG - Intergenic
1054714004 9:68539456-68539478 TGGTCCCAGGGGCTGGTGGAAGG - Intronic
1055567998 9:77588250-77588272 GGGTGTCAGGGTGTGGTGGATGG - Intronic
1056523074 9:87418060-87418082 CTGTCTCAGCCTCAGGTAGATGG - Intergenic
1057126487 9:92619821-92619843 CCGTCTCAGGGTCTGGAGTCGGG - Exonic
1057339684 9:94188825-94188847 CTGGATCAAGGTGTGGTGGATGG - Intergenic
1059611985 9:115908278-115908300 CTGTCTCAGGGGCTGGGGATAGG + Intergenic
1061492627 9:130954490-130954512 CTGGCTAAGGGTGTGGTGGTGGG - Intergenic
1062015628 9:134289717-134289739 CTGTTTCACAGACTGGTGGACGG + Intergenic
1062083261 9:134635679-134635701 CTTTATCATGGTCTGATGGAGGG - Intergenic
1062236512 9:135512509-135512531 CTGTGTCAGGGTCTGGGGAAGGG + Intergenic
1203781666 EBV:104432-104454 GCGTCTCAAGGTCTGGAGGACGG - Intergenic
1186796347 X:13050316-13050338 CTGACTCAAGGTGTGGGGGAGGG + Intergenic
1188192865 X:27193790-27193812 CTGTCCCAGGGTGTGGGGGTGGG - Intergenic
1188716563 X:33465526-33465548 CAGTGTCAGGGGCTGGGGGAAGG + Intergenic
1189374377 X:40455255-40455277 CTGGCTCAGGGTCTCTTGCAAGG + Intergenic
1189644498 X:43112425-43112447 CTGTCTCAGAGTCTGCTACAAGG + Intergenic
1194723912 X:97372626-97372648 CCTTCTCAGGTTCAGGTGGATGG - Intronic
1196317809 X:114249877-114249899 TTGTCTCAGAGTCTGCTTGAAGG - Intergenic
1198321534 X:135522057-135522079 CTTTCTCCGGGTCTGGGGGTGGG - Intronic
1199808859 X:151329161-151329183 GGGTGTCAGGGGCTGGTGGAGGG + Intergenic
1199898768 X:152152411-152152433 ATGAGTCAGAGTCTGGTGGATGG + Intergenic
1199932728 X:152540734-152540756 CTGCCTCAGAGTGTGGGGGAAGG - Intergenic